ID: 969291665

View in Genome Browser
Species Human (GRCh38)
Location 4:6243944-6243966
Sequence GGAGCTACACTTGAGCACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969291665_969291668 -5 Left 969291665 4:6243944-6243966 CCCAGGTGCTCAAGTGTAGCTCC No data
Right 969291668 4:6243962-6243984 GCTCCCATAGCAGCAAAGGAAGG No data
969291665_969291674 23 Left 969291665 4:6243944-6243966 CCCAGGTGCTCAAGTGTAGCTCC No data
Right 969291674 4:6243990-6244012 AAGTCTCAGGGCTTTGCAGGTGG No data
969291665_969291667 -9 Left 969291665 4:6243944-6243966 CCCAGGTGCTCAAGTGTAGCTCC No data
Right 969291667 4:6243958-6243980 TGTAGCTCCCATAGCAGCAAAGG No data
969291665_969291673 20 Left 969291665 4:6243944-6243966 CCCAGGTGCTCAAGTGTAGCTCC No data
Right 969291673 4:6243987-6244009 GCAAAGTCTCAGGGCTTTGCAGG No data
969291665_969291671 10 Left 969291665 4:6243944-6243966 CCCAGGTGCTCAAGTGTAGCTCC No data
Right 969291671 4:6243977-6243999 AAGGAAGGATGCAAAGTCTCAGG No data
969291665_969291672 11 Left 969291665 4:6243944-6243966 CCCAGGTGCTCAAGTGTAGCTCC No data
Right 969291672 4:6243978-6244000 AGGAAGGATGCAAAGTCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969291665 Original CRISPR GGAGCTACACTTGAGCACCT GGG (reversed) Intergenic