ID: 969291666

View in Genome Browser
Species Human (GRCh38)
Location 4:6243945-6243967
Sequence GGGAGCTACACTTGAGCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969291666_969291668 -6 Left 969291666 4:6243945-6243967 CCAGGTGCTCAAGTGTAGCTCCC No data
Right 969291668 4:6243962-6243984 GCTCCCATAGCAGCAAAGGAAGG No data
969291666_969291671 9 Left 969291666 4:6243945-6243967 CCAGGTGCTCAAGTGTAGCTCCC No data
Right 969291671 4:6243977-6243999 AAGGAAGGATGCAAAGTCTCAGG No data
969291666_969291672 10 Left 969291666 4:6243945-6243967 CCAGGTGCTCAAGTGTAGCTCCC No data
Right 969291672 4:6243978-6244000 AGGAAGGATGCAAAGTCTCAGGG No data
969291666_969291673 19 Left 969291666 4:6243945-6243967 CCAGGTGCTCAAGTGTAGCTCCC No data
Right 969291673 4:6243987-6244009 GCAAAGTCTCAGGGCTTTGCAGG No data
969291666_969291674 22 Left 969291666 4:6243945-6243967 CCAGGTGCTCAAGTGTAGCTCCC No data
Right 969291674 4:6243990-6244012 AAGTCTCAGGGCTTTGCAGGTGG No data
969291666_969291667 -10 Left 969291666 4:6243945-6243967 CCAGGTGCTCAAGTGTAGCTCCC No data
Right 969291667 4:6243958-6243980 TGTAGCTCCCATAGCAGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969291666 Original CRISPR GGGAGCTACACTTGAGCACC TGG (reversed) Intergenic