ID: 969291667

View in Genome Browser
Species Human (GRCh38)
Location 4:6243958-6243980
Sequence TGTAGCTCCCATAGCAGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969291666_969291667 -10 Left 969291666 4:6243945-6243967 CCAGGTGCTCAAGTGTAGCTCCC No data
Right 969291667 4:6243958-6243980 TGTAGCTCCCATAGCAGCAAAGG No data
969291657_969291667 15 Left 969291657 4:6243920-6243942 CCAGGACCAGCCTCCAGGACCCC No data
Right 969291667 4:6243958-6243980 TGTAGCTCCCATAGCAGCAAAGG No data
969291665_969291667 -9 Left 969291665 4:6243944-6243966 CCCAGGTGCTCAAGTGTAGCTCC No data
Right 969291667 4:6243958-6243980 TGTAGCTCCCATAGCAGCAAAGG No data
969291660_969291667 5 Left 969291660 4:6243930-6243952 CCTCCAGGACCCCTCCCAGGTGC No data
Right 969291667 4:6243958-6243980 TGTAGCTCCCATAGCAGCAAAGG No data
969291663_969291667 -5 Left 969291663 4:6243940-6243962 CCCTCCCAGGTGCTCAAGTGTAG No data
Right 969291667 4:6243958-6243980 TGTAGCTCCCATAGCAGCAAAGG No data
969291655_969291667 17 Left 969291655 4:6243918-6243940 CCCCAGGACCAGCCTCCAGGACC No data
Right 969291667 4:6243958-6243980 TGTAGCTCCCATAGCAGCAAAGG No data
969291661_969291667 2 Left 969291661 4:6243933-6243955 CCAGGACCCCTCCCAGGTGCTCA No data
Right 969291667 4:6243958-6243980 TGTAGCTCCCATAGCAGCAAAGG No data
969291664_969291667 -6 Left 969291664 4:6243941-6243963 CCTCCCAGGTGCTCAAGTGTAGC No data
Right 969291667 4:6243958-6243980 TGTAGCTCCCATAGCAGCAAAGG No data
969291652_969291667 27 Left 969291652 4:6243908-6243930 CCATGTCCTGCCCCAGGACCAGC No data
Right 969291667 4:6243958-6243980 TGTAGCTCCCATAGCAGCAAAGG No data
969291658_969291667 9 Left 969291658 4:6243926-6243948 CCAGCCTCCAGGACCCCTCCCAG No data
Right 969291667 4:6243958-6243980 TGTAGCTCCCATAGCAGCAAAGG No data
969291656_969291667 16 Left 969291656 4:6243919-6243941 CCCAGGACCAGCCTCCAGGACCC No data
Right 969291667 4:6243958-6243980 TGTAGCTCCCATAGCAGCAAAGG No data
969291653_969291667 21 Left 969291653 4:6243914-6243936 CCTGCCCCAGGACCAGCCTCCAG No data
Right 969291667 4:6243958-6243980 TGTAGCTCCCATAGCAGCAAAGG No data
969291662_969291667 -4 Left 969291662 4:6243939-6243961 CCCCTCCCAGGTGCTCAAGTGTA No data
Right 969291667 4:6243958-6243980 TGTAGCTCCCATAGCAGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969291667 Original CRISPR TGTAGCTCCCATAGCAGCAA AGG Intergenic