ID: 969291668

View in Genome Browser
Species Human (GRCh38)
Location 4:6243962-6243984
Sequence GCTCCCATAGCAGCAAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969291655_969291668 21 Left 969291655 4:6243918-6243940 CCCCAGGACCAGCCTCCAGGACC No data
Right 969291668 4:6243962-6243984 GCTCCCATAGCAGCAAAGGAAGG No data
969291663_969291668 -1 Left 969291663 4:6243940-6243962 CCCTCCCAGGTGCTCAAGTGTAG No data
Right 969291668 4:6243962-6243984 GCTCCCATAGCAGCAAAGGAAGG No data
969291666_969291668 -6 Left 969291666 4:6243945-6243967 CCAGGTGCTCAAGTGTAGCTCCC No data
Right 969291668 4:6243962-6243984 GCTCCCATAGCAGCAAAGGAAGG No data
969291658_969291668 13 Left 969291658 4:6243926-6243948 CCAGCCTCCAGGACCCCTCCCAG No data
Right 969291668 4:6243962-6243984 GCTCCCATAGCAGCAAAGGAAGG No data
969291653_969291668 25 Left 969291653 4:6243914-6243936 CCTGCCCCAGGACCAGCCTCCAG No data
Right 969291668 4:6243962-6243984 GCTCCCATAGCAGCAAAGGAAGG No data
969291664_969291668 -2 Left 969291664 4:6243941-6243963 CCTCCCAGGTGCTCAAGTGTAGC No data
Right 969291668 4:6243962-6243984 GCTCCCATAGCAGCAAAGGAAGG No data
969291662_969291668 0 Left 969291662 4:6243939-6243961 CCCCTCCCAGGTGCTCAAGTGTA No data
Right 969291668 4:6243962-6243984 GCTCCCATAGCAGCAAAGGAAGG No data
969291656_969291668 20 Left 969291656 4:6243919-6243941 CCCAGGACCAGCCTCCAGGACCC No data
Right 969291668 4:6243962-6243984 GCTCCCATAGCAGCAAAGGAAGG No data
969291660_969291668 9 Left 969291660 4:6243930-6243952 CCTCCAGGACCCCTCCCAGGTGC No data
Right 969291668 4:6243962-6243984 GCTCCCATAGCAGCAAAGGAAGG No data
969291661_969291668 6 Left 969291661 4:6243933-6243955 CCAGGACCCCTCCCAGGTGCTCA No data
Right 969291668 4:6243962-6243984 GCTCCCATAGCAGCAAAGGAAGG No data
969291665_969291668 -5 Left 969291665 4:6243944-6243966 CCCAGGTGCTCAAGTGTAGCTCC No data
Right 969291668 4:6243962-6243984 GCTCCCATAGCAGCAAAGGAAGG No data
969291657_969291668 19 Left 969291657 4:6243920-6243942 CCAGGACCAGCCTCCAGGACCCC No data
Right 969291668 4:6243962-6243984 GCTCCCATAGCAGCAAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969291668 Original CRISPR GCTCCCATAGCAGCAAAGGA AGG Intergenic