ID: 969294523

View in Genome Browser
Species Human (GRCh38)
Location 4:6262012-6262034
Sequence CAGGGAACTGAGCATGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969294523_969294530 -1 Left 969294523 4:6262012-6262034 CCCTCCCCATGCTCAGTTCCCTG No data
Right 969294530 4:6262034-6262056 GATTTAAAGTCAGTGCCTCTTGG No data
969294523_969294533 22 Left 969294523 4:6262012-6262034 CCCTCCCCATGCTCAGTTCCCTG No data
Right 969294533 4:6262057-6262079 AAGCAATCACCGTGTCCTTCGGG No data
969294523_969294534 25 Left 969294523 4:6262012-6262034 CCCTCCCCATGCTCAGTTCCCTG No data
Right 969294534 4:6262060-6262082 CAATCACCGTGTCCTTCGGGAGG No data
969294523_969294532 21 Left 969294523 4:6262012-6262034 CCCTCCCCATGCTCAGTTCCCTG No data
Right 969294532 4:6262056-6262078 GAAGCAATCACCGTGTCCTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969294523 Original CRISPR CAGGGAACTGAGCATGGGGA GGG (reversed) Intergenic
No off target data available for this crispr