ID: 969295655

View in Genome Browser
Species Human (GRCh38)
Location 4:6269582-6269604
Sequence TCCGCGGGCGGGGCGGGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969295644_969295655 -2 Left 969295644 4:6269561-6269583 CCTCGCTAAGCAACTGGACGTTC No data
Right 969295655 4:6269582-6269604 TCCGCGGGCGGGGCGGGGGCGGG No data
969295640_969295655 25 Left 969295640 4:6269534-6269556 CCACCTGTTACAGGAGAAGGCGA No data
Right 969295655 4:6269582-6269604 TCCGCGGGCGGGGCGGGGGCGGG No data
969295641_969295655 22 Left 969295641 4:6269537-6269559 CCTGTTACAGGAGAAGGCGAGCG No data
Right 969295655 4:6269582-6269604 TCCGCGGGCGGGGCGGGGGCGGG No data
969295638_969295655 30 Left 969295638 4:6269529-6269551 CCAAACCACCTGTTACAGGAGAA No data
Right 969295655 4:6269582-6269604 TCCGCGGGCGGGGCGGGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969295655 Original CRISPR TCCGCGGGCGGGGCGGGGGC GGG Intergenic