ID: 969297623

View in Genome Browser
Species Human (GRCh38)
Location 4:6279110-6279132
Sequence GTCACTGATGTGGCCAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 196}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969297619_969297623 -6 Left 969297619 4:6279093-6279115 CCGTCTCCCAGTCACTGGTCACT 0: 1
1: 0
2: 5
3: 47
4: 462
Right 969297623 4:6279110-6279132 GTCACTGATGTGGCCAAAGCAGG 0: 1
1: 0
2: 2
3: 11
4: 196
969297618_969297623 -5 Left 969297618 4:6279092-6279114 CCCGTCTCCCAGTCACTGGTCAC 0: 1
1: 0
2: 1
3: 36
4: 302
Right 969297623 4:6279110-6279132 GTCACTGATGTGGCCAAAGCAGG 0: 1
1: 0
2: 2
3: 11
4: 196
969297616_969297623 19 Left 969297616 4:6279068-6279090 CCTGCAGCTGGGGGCAGTGGGCA 0: 1
1: 0
2: 9
3: 66
4: 499
Right 969297623 4:6279110-6279132 GTCACTGATGTGGCCAAAGCAGG 0: 1
1: 0
2: 2
3: 11
4: 196
969297609_969297623 30 Left 969297609 4:6279057-6279079 CCACCACTGGGCCTGCAGCTGGG 0: 1
1: 0
2: 2
3: 37
4: 565
Right 969297623 4:6279110-6279132 GTCACTGATGTGGCCAAAGCAGG 0: 1
1: 0
2: 2
3: 11
4: 196
969297613_969297623 27 Left 969297613 4:6279060-6279082 CCACTGGGCCTGCAGCTGGGGGC 0: 1
1: 0
2: 7
3: 55
4: 502
Right 969297623 4:6279110-6279132 GTCACTGATGTGGCCAAAGCAGG 0: 1
1: 0
2: 2
3: 11
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969297623 Original CRISPR GTCACTGATGTGGCCAAAGC AGG Intronic
900392308 1:2438974-2438996 GCCACCCATGTGGCCAGAGCTGG - Intronic
900837322 1:5015054-5015076 ATGTCTTATGTGGCCAAAGCAGG - Intergenic
901852043 1:12021985-12022007 GTCACTGCTGAGGCCGGAGCAGG + Intronic
902344161 1:15803672-15803694 CTCACTGATGTTGCCTAGGCTGG - Intergenic
902428544 1:16344025-16344047 TTCACTCATGTTGCCAAGGCTGG + Intronic
902744771 1:18466450-18466472 GTCAGTGATGTGGCTGGAGCAGG - Intergenic
903488105 1:23706594-23706616 TTCACTGATGTTGCCCAAGCTGG - Intergenic
904078694 1:27858520-27858542 GTCACAGATGTGGAAAGAGCAGG - Intergenic
905901572 1:41584883-41584905 TTGACCAATGTGGCCAAAGCTGG - Exonic
907663325 1:56413577-56413599 GTGAGTGATGTGCCCACAGCTGG - Intergenic
908328344 1:63045295-63045317 TTCACTGAATTGGCCAAATCTGG + Intergenic
911837218 1:102635828-102635850 ATCACTGGTGTGACCAAAGAAGG + Intergenic
912345439 1:108959142-108959164 TTCACTGTTGTTGCCCAAGCTGG - Intronic
916582878 1:166124052-166124074 GTGAGTGATGAGGCCAAAGCAGG - Intronic
916816743 1:168361465-168361487 GTCAGGGCTGTGGTCAAAGCAGG + Intergenic
917032361 1:170707444-170707466 GTAACTGATTTGGGCAAAGGTGG - Intronic
921697453 1:218228375-218228397 GTCCCTGCTGTGGCCACCGCCGG + Intergenic
921922234 1:220683099-220683121 GTCACTGATCTGGGCAGGGCTGG + Intergenic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
922723622 1:227911950-227911972 TTCACTCATGTTGCCCAAGCTGG + Intergenic
924772097 1:247087784-247087806 GGGACTGGTGTGGCCAAAGTGGG - Intergenic
1065056173 10:21844835-21844857 GTCTCTTATGTTGCCAAGGCTGG - Intronic
1065297615 10:24291498-24291520 GTCACTCTTGTTGCCCAAGCTGG - Intronic
1066431253 10:35354012-35354034 CTCACTTACGTGGCCAATGCAGG + Intronic
1066792576 10:39082030-39082052 TTCACTGATGTGGCAGATGCAGG + Intergenic
1070236215 10:74629274-74629296 GTGACTCAGGAGGCCAAAGCAGG - Intronic
1071561661 10:86650435-86650457 CGCACTGCTGTGGCCAAGGCTGG - Intergenic
1073331703 10:102674285-102674307 GTCATTGATGTGGGCTGAGCTGG - Exonic
1074218000 10:111406850-111406872 GTCACTGCAGTGGCTAAAGGTGG + Intergenic
1075735416 10:124661809-124661831 GTCACTGTTGTGGATGAAGCAGG - Intronic
1077119135 11:898789-898811 GGCTCTGATGTGGCAAAAGGAGG + Intronic
1080657715 11:34270779-34270801 GTCCCTGATCTGGCAACAGCTGG - Intronic
1082100546 11:48169636-48169658 GGCAGTGATGTGGGCAGAGCAGG - Intronic
1084561643 11:69908975-69908997 AGCTCTGATGTGGCCAAGGCTGG + Intergenic
1087231700 11:95673399-95673421 GGCCCTGATTTGGCAAAAGCTGG + Intergenic
1088688626 11:112305709-112305731 GGCACTGATGTGACCAGATCTGG + Intergenic
1089674662 11:120081728-120081750 GTCACTGTTGTGGGAAATGCTGG - Intergenic
1090479857 11:127058636-127058658 GTAATAGATGTGGCCAAAGAGGG - Intergenic
1090834335 11:130443084-130443106 GCCACAGAGGTGGGCAAAGCAGG - Intergenic
1092822288 12:12363863-12363885 TTCACTGTTGTTGCCCAAGCTGG - Intronic
1092905890 12:13100670-13100692 TTCACTGATGAGGACAAAGATGG + Intronic
1101879912 12:108619048-108619070 TTCACTGCTGTTGCCAAGGCTGG + Intergenic
1104459243 12:128941043-128941065 GTCTATGAAATGGCCAAAGCAGG - Intronic
1104795116 12:131511825-131511847 GACACAGATGTGGCCAGAGAAGG - Intergenic
1106390707 13:29333225-29333247 GTCACTGTTGTTGCCCAGGCGGG + Intronic
1110806052 13:79755798-79755820 TTCTTTGATGTGGCCAAAGTTGG - Intergenic
1112020401 13:95366483-95366505 TTCACTCTTGTGGCCCAAGCTGG + Intergenic
1112629987 13:101149953-101149975 GACACTGCTGTGGCCAAGGGAGG - Intronic
1113701765 13:112393739-112393761 GACACAGATGAGGCCAAAGCGGG + Intronic
1114503939 14:23193869-23193891 GTCACTCTTGTTGCCCAAGCTGG + Intronic
1114957703 14:27845302-27845324 GTCTCTGGTCTGGCCAAGGCCGG + Intergenic
1117136767 14:52742824-52742846 TTCACTGATGTTGCCTAGGCTGG + Intronic
1117211569 14:53506335-53506357 GCCACTGCTGTGTCCTAAGCAGG + Intergenic
1117729711 14:58710245-58710267 GTGACTGGTGTGGGCACAGCTGG + Intergenic
1118699690 14:68421233-68421255 ATCACACATGTGGCTAAAGCAGG + Intronic
1119809176 14:77501756-77501778 CTCACTGTTGTCGCCCAAGCTGG + Intergenic
1121648661 14:95539034-95539056 GTCACTGATGTGGCAGGAGGCGG - Intronic
1122104471 14:99441731-99441753 GCCCCTGATGAGGCCACAGCAGG + Intronic
1122746559 14:103900395-103900417 GTTACTCAGGTGGCCAAGGCGGG - Intergenic
1124346899 15:28929009-28929031 TTCACTGATGAGTCCAAAGAAGG + Intronic
1124661977 15:31557416-31557438 CTCACTGATGTGGTCCACGCAGG - Intronic
1125682698 15:41542270-41542292 GTCAATGATGTACCCAAAGTTGG + Intronic
1128213138 15:65916194-65916216 GCCACTGATGTGGTCACAGCTGG + Exonic
1128424940 15:67532253-67532275 TTCACTGTTGTTGCCCAAGCTGG - Intergenic
1128437144 15:67664296-67664318 CTCACTAATGTTGCCTAAGCTGG - Intronic
1129275052 15:74439763-74439785 CTCACTGAAGTGGCCTCAGCAGG - Intergenic
1129623025 15:77166824-77166846 GACACTAATGTGACAAAAGCAGG + Intronic
1131129077 15:89883505-89883527 GCTACTCATGTGGCTAAAGCAGG - Intronic
1131512758 15:93058416-93058438 GGCACTGATGTGAGCAAAGCCGG + Intronic
1138304434 16:55961389-55961411 GTCATTGATGTGGGCAAATGAGG + Intergenic
1139919232 16:70448776-70448798 TTCACTCTTGTTGCCAAAGCTGG + Intergenic
1140865077 16:79052995-79053017 GTCAGAGAGGTGGCAAAAGCAGG + Intronic
1141695368 16:85616532-85616554 GTCTCTGTTGTGGCAACAGCAGG + Intronic
1142076720 16:88122361-88122383 GTGACTGCTGTGGCCATAGTGGG - Intergenic
1142200396 16:88758349-88758371 GCCACTGCTGGGGCCAAGGCTGG - Intronic
1142590801 17:1004981-1005003 GTGACTGATGTGGCCGAAGCAGG - Exonic
1144823701 17:18093347-18093369 TTCACTGTTGTTGCCCAAGCTGG + Intronic
1145082533 17:19907045-19907067 TTCACTCTTGTGGCCCAAGCTGG + Intronic
1145185456 17:20790158-20790180 TTCACTGATGTTGCCCAGGCTGG - Intergenic
1146365313 17:32220248-32220270 GCTACTTATGTGGCTAAAGCAGG + Intronic
1146413514 17:32610413-32610435 GTCCCTATTGTTGCCAAAGCAGG + Intronic
1148137735 17:45305792-45305814 GGAACAGATGTGGTCAAAGCAGG + Intronic
1148190643 17:45676532-45676554 ATCACTGGTGTGGTTAAAGCTGG + Intergenic
1151716751 17:75834986-75835008 GTGGCTGATCTGGGCAAAGCAGG + Exonic
1152457432 17:80424349-80424371 GTGTCAGATGTGCCCAAAGCAGG + Intronic
1153488049 18:5621186-5621208 GTCACTGTAGTGGCCAAAATCGG + Intronic
1153549373 18:6245236-6245258 CTCAGTGATGTGGCTAAAGATGG + Intronic
1153851971 18:9103105-9103127 GAAACTGATCTGGCCAGAGCAGG - Intronic
1155017191 18:21855699-21855721 ACCACTGATGTGGACAAAGTAGG - Intronic
1157947653 18:51998775-51998797 CTCACTGTTCTGGGCAAAGCAGG - Intergenic
1157968239 18:52234550-52234572 TTCACTCTTGTTGCCAAAGCTGG - Intergenic
1163326267 19:16605380-16605402 CACACTGATGAGGCCAAAGGGGG + Intronic
1163330196 19:16631556-16631578 CTCACTGCTGTGGCCTAAGCAGG + Intronic
1163459464 19:17427954-17427976 TTCACTCTTGTTGCCAAAGCTGG - Intronic
1165319808 19:35078105-35078127 GTCACAGAGGTGGCCAAGCCAGG - Intergenic
1166212596 19:41316699-41316721 GCCACGCACGTGGCCAAAGCAGG - Exonic
1167984156 19:53300914-53300936 GTCACTGGTGTGGACAAGGAGGG - Intergenic
1168030409 19:53675158-53675180 TTCACTCTTGTGGCCCAAGCTGG + Intergenic
925992597 2:9265800-9265822 TTCACTCTTGTTGCCAAAGCTGG + Intronic
927195306 2:20542582-20542604 GACACAGATGTGTCCAAACCTGG + Intergenic
927585672 2:24302016-24302038 CTTACTGACATGGCCAAAGCTGG - Exonic
929011796 2:37452195-37452217 GTCACTTGTGAGGCCAAGGCGGG - Intergenic
932682129 2:73835377-73835399 GTCACTAATGTTGCCCAGGCTGG + Intronic
934605884 2:95694821-95694843 GTCACTGATGCCTCCAAATCCGG - Intergenic
937663009 2:124452266-124452288 GTCAGGGAAGTGGGCAAAGCGGG - Intronic
937825488 2:126364473-126364495 GTAAATGAGGTGGGCAAAGCAGG - Intergenic
938045904 2:128120021-128120043 GCCACTGAGGAGGCCAAGGCAGG - Intronic
938595967 2:132787431-132787453 GAGACTGATGTAGCCAAAACTGG - Intronic
941489983 2:166131537-166131559 GTCACTCAGGTGGAAAAAGCTGG + Intergenic
1169223880 20:3844078-3844100 TTCACTGTTGTTGCCCAAGCTGG + Intergenic
1169522216 20:6386210-6386232 ATCACTGATGTGGCCAGGGATGG + Intergenic
1170583420 20:17716053-17716075 GTGACTCATGTGGCCCAAGAAGG + Intronic
1171233982 20:23509680-23509702 GTCACTGATGGGGTCAAGCCAGG + Intergenic
1172690111 20:36784285-36784307 GTGACTGGTGTGGGCAGAGCAGG - Exonic
1173368498 20:42412378-42412400 CCTACTCATGTGGCCAAAGCAGG + Intronic
1175248917 20:57597273-57597295 GTCACAGCTGGGGCCACAGCTGG + Intergenic
1175737706 20:61398851-61398873 GTGACTGGTGTGCCCAGAGCAGG + Intronic
1179182072 21:39054073-39054095 CTCACTGATGAGTCCATAGCAGG - Intergenic
1180199190 21:46214674-46214696 GTCACTGAACTGGCCACACCTGG + Intronic
1180781740 22:18524114-18524136 TTCACTCTTGTGGCCCAAGCTGG - Intergenic
1181238624 22:21463457-21463479 TTCACTCTTGTGGCCCAAGCTGG - Intergenic
1182012026 22:27009085-27009107 GTCACTCATCTGGCCAGAGTAGG - Intergenic
1183381607 22:37493070-37493092 GTCACTGGTGTGTTGAAAGCAGG - Intronic
1183703234 22:39461544-39461566 CTCAGAGATGTGGCCCAAGCAGG + Intronic
1184050638 22:42001523-42001545 GCAGCTGATGTGGGCAAAGCTGG - Intronic
1184922717 22:47616651-47616673 GCCACTGAAGGGGCCAACGCCGG - Intergenic
1185154219 22:49183582-49183604 GTCACTGAGGTGACAAATGCTGG - Intergenic
949355279 3:3173980-3174002 GTCAGTGTTGAAGCCAAAGCAGG - Intronic
950554861 3:13689276-13689298 GTCACTGCTGTGGGCAATGAGGG + Intergenic
951418681 3:22457232-22457254 GTCACTGATCAGGGCAAAACAGG - Intergenic
953519053 3:43623581-43623603 GGCATTGATCTGGCCAAAGCTGG - Intronic
953772716 3:45791330-45791352 GTCTCAGATGTGGCCTAAACAGG - Intronic
954050297 3:47970001-47970023 GTCACTGCTGTGGGCAAAGTGGG - Intronic
954139298 3:48596614-48596636 GACTCTGGTGTGGCCAGAGCTGG + Intergenic
954974875 3:54683998-54684020 TTCACTCATGTAGCCCAAGCTGG + Intronic
955379104 3:58422414-58422436 CTCCCTGATGTGGCCTCAGCAGG - Intronic
955403662 3:58611394-58611416 GTCACTGGTGTGGCTTCAGCAGG + Intronic
956379844 3:68654023-68654045 GCCAGTGCTGTGGCCAGAGCTGG - Intergenic
956610983 3:71122850-71122872 GTCACTGATTAGACCAAAGATGG + Intronic
956972039 3:74537608-74537630 GTCACAGAGGTGGCAAAAGGGGG - Intergenic
966667618 3:182489803-182489825 GTGACTTATGTGGGCAAAGCAGG - Intergenic
967612514 3:191524160-191524182 TTCACTGTTGTCGCCAAGGCTGG - Intergenic
968111668 3:196053082-196053104 TTCACTGTTGTTGCCCAAGCTGG - Intronic
968664078 4:1811130-1811152 GTCACTGAGGTCCCCAGAGCAGG + Intergenic
968975848 4:3821724-3821746 GGCACTGATGTGGTCTCAGCAGG + Intergenic
969297623 4:6279110-6279132 GTCACTGATGTGGCCAAAGCAGG + Intronic
970845427 4:20532293-20532315 GTCTGTTATGTGGCCACAGCAGG + Intronic
972763771 4:42132472-42132494 TTCAGTGCTGTTGCCAAAGCTGG + Intronic
972999766 4:44931934-44931956 CTCCCTGCTGTGGCCATAGCAGG - Intergenic
976180234 4:82392000-82392022 TTCACTGTTGTTGCCCAAGCTGG + Intergenic
977530882 4:98199470-98199492 GGCACAGATGTGGCCCAGGCAGG + Intergenic
978865238 4:113499812-113499834 AACAGTGATGTGGCCAAAGGAGG + Intronic
979008746 4:115339532-115339554 CTCACTGATATAGCAAAAGCAGG + Intergenic
979989207 4:127354586-127354608 GCCACGTATGTGGCCTAAGCTGG + Intergenic
980911952 4:139001935-139001957 TTCACTCTTGTGGCCCAAGCTGG + Intergenic
981316603 4:143346443-143346465 ATCACTGCTGTGGCCAGAGTTGG + Intronic
986710344 5:10484098-10484120 CTCACTAATGTTGCCCAAGCTGG - Intergenic
989500549 5:42161719-42161741 TTCACTGTTGTGGCCCAGGCTGG + Intergenic
989790826 5:45399212-45399234 GTCCCTGATGTGGCCAAACCAGG - Intronic
990048448 5:51464605-51464627 GTCACTGCTTTGTTCAAAGCTGG + Intergenic
992842347 5:80708616-80708638 CTCACTTATGTTGCCCAAGCTGG + Intronic
999966806 5:156818993-156819015 TTCACTCCTGTAGCCAAAGCAGG + Intergenic
1002207955 5:177577186-177577208 TTCACTGTTGTCGCCCAAGCTGG + Intergenic
1002547889 5:179963524-179963546 GGCACTGAGGAGGCCAAAACTGG + Exonic
1004572242 6:16858363-16858385 GTCACTGCCGTGGCCAAGGATGG - Intergenic
1005147001 6:22702839-22702861 GGCTCTCATGTGGCAAAAGCAGG + Intergenic
1007696651 6:43737939-43737961 GGAGCTGATGTGGCCACAGCTGG + Intergenic
1011185080 6:84665694-84665716 GTCTCTGATGTGGACAACACAGG + Intergenic
1011390658 6:86848944-86848966 GTCACTGTTGAAGCCAAGGCAGG + Intergenic
1012197364 6:96360505-96360527 TTCACTGAGGTGGGGAAAGCTGG - Intergenic
1012629163 6:101442123-101442145 GACACATCTGTGGCCAAAGCCGG - Intronic
1012934473 6:105351807-105351829 AACACTGATGTGGCCAATGCTGG + Intronic
1013247388 6:108299689-108299711 GCTACTCATGAGGCCAAAGCAGG + Intronic
1013913778 6:115310291-115310313 GTCACAGAAGTGGGGAAAGCCGG + Intergenic
1014176571 6:118337775-118337797 GTCACTCTTGTTGCCCAAGCTGG + Intergenic
1016964747 6:149708570-149708592 TTCCCAGATTTGGCCAAAGCTGG + Intronic
1018770946 6:166971031-166971053 GTCACTGGGGCGGCCAGAGCAGG - Intergenic
1019478099 7:1253819-1253841 GTCACAGAAGGGGCCCAAGCTGG - Intergenic
1020423422 7:8035947-8035969 GCCCCTGATGGGGACAAAGCTGG - Intronic
1020997526 7:15281700-15281722 GAGACTGGTGTGGCAAAAGCAGG - Intronic
1021483770 7:21145866-21145888 GTGACTGCTGGGGCCACAGCTGG - Intergenic
1029406031 7:100374455-100374477 CTCACTGCGGTGGGCAAAGCGGG - Intronic
1029970160 7:104780716-104780738 GTCACTGATGTGGACAAAAGAGG - Intronic
1031793354 7:126138639-126138661 GTCACTGACGGTGGCAAAGCTGG - Intergenic
1033134440 7:138773228-138773250 GTCCCTGGAGAGGCCAAAGCTGG - Intronic
1037376499 8:18235736-18235758 TTCTCTGATTTGTCCAAAGCTGG + Intergenic
1038274201 8:26106859-26106881 TTCACTCTTGTGGCCCAAGCTGG + Intergenic
1039307838 8:36282855-36282877 TTCACTGTTGTTGCCCAAGCTGG + Intergenic
1039428373 8:37505628-37505650 GTGACTAATTTGGCCACAGCTGG - Intergenic
1040890164 8:52308998-52309020 GTCACTGCAGTGGACAAAACAGG + Intronic
1042577083 8:70232469-70232491 TTTACTGAAGTGGCAAAAGCTGG - Intronic
1046554678 8:115760134-115760156 TTCACTGATGTAGAAAAAGCAGG + Intronic
1046810309 8:118525921-118525943 TTCACTGATGTCAACAAAGCTGG - Intronic
1047795259 8:128248715-128248737 GTAGATGATGGGGCCAAAGCTGG - Intergenic
1052296407 9:26900545-26900567 ATCAATGATGTTGCCAAAACTGG - Intergenic
1056065684 9:82931996-82932018 GTCACTTATTTGATCAAAGCTGG + Intergenic
1056165171 9:83934056-83934078 GTCACTCTTGTTGCCCAAGCTGG - Intergenic
1057141291 9:92728181-92728203 GGGAACGATGTGGCCAAAGCAGG - Intronic
1058693973 9:107543641-107543663 GGCACTGAAGTCTCCAAAGCTGG + Intergenic
1059930054 9:119251494-119251516 GCCACTCAGGTGGCCAAGGCAGG + Intronic
1185610210 X:1389817-1389839 GTCACTCTTGTTGCCCAAGCTGG + Intronic
1185690220 X:2148679-2148701 TTCACTCATGTTGCCCAAGCTGG - Intergenic
1192206180 X:69097980-69098002 CTTACTGCTGTGGCCAATGCAGG + Intergenic
1193599059 X:83486557-83486579 GTCACTAATGTTGGGAAAGCTGG + Intergenic
1195380191 X:104263265-104263287 CTCACTTATGTTGCCCAAGCTGG + Intergenic
1196703133 X:118693234-118693256 TTCGCTGCTGTGGCCCAAGCTGG + Intergenic
1197705348 X:129630776-129630798 GTCACTGATCTGGACCCAGCAGG - Intergenic
1199886038 X:152022854-152022876 GTCACAGATGTTGCCCAAGTGGG + Intergenic
1200232408 X:154450565-154450587 GTCACTGATGTGGCAGGGGCAGG - Exonic
1202071318 Y:20994411-20994433 GCCTCTGATGTGGCCCTAGCAGG - Intergenic