ID: 969298543

View in Genome Browser
Species Human (GRCh38)
Location 4:6283684-6283706
Sequence CTGTAGTCAGGGAGATGACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969298539_969298543 -10 Left 969298539 4:6283671-6283693 CCTGAACCAGGTGCTGTAGTCAG 0: 1
1: 0
2: 1
3: 11
4: 140
Right 969298543 4:6283684-6283706 CTGTAGTCAGGGAGATGACCTGG No data
969298535_969298543 9 Left 969298535 4:6283652-6283674 CCGCTGGGCTGTGTCCATCCCTG 0: 1
1: 0
2: 3
3: 46
4: 362
Right 969298543 4:6283684-6283706 CTGTAGTCAGGGAGATGACCTGG No data
969298538_969298543 -9 Left 969298538 4:6283670-6283692 CCCTGAACCAGGTGCTGTAGTCA 0: 1
1: 0
2: 1
3: 22
4: 177
Right 969298543 4:6283684-6283706 CTGTAGTCAGGGAGATGACCTGG No data
969298532_969298543 30 Left 969298532 4:6283631-6283653 CCAGCAGTTCTAGCACAAACTCC 0: 1
1: 0
2: 0
3: 8
4: 126
Right 969298543 4:6283684-6283706 CTGTAGTCAGGGAGATGACCTGG No data
969298537_969298543 -5 Left 969298537 4:6283666-6283688 CCATCCCTGAACCAGGTGCTGTA 0: 1
1: 0
2: 2
3: 29
4: 245
Right 969298543 4:6283684-6283706 CTGTAGTCAGGGAGATGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969298543 Original CRISPR CTGTAGTCAGGGAGATGACC TGG Intronic
No off target data available for this crispr