ID: 969298983

View in Genome Browser
Species Human (GRCh38)
Location 4:6286247-6286269
Sequence CCCAGTCCCATGGTGTTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 294}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969298976_969298983 5 Left 969298976 4:6286219-6286241 CCCAGATTCATTTGCTGAGGTCT 0: 1
1: 0
2: 1
3: 43
4: 392
Right 969298983 4:6286247-6286269 CCCAGTCCCATGGTGTTAGGAGG 0: 1
1: 0
2: 2
3: 28
4: 294
969298977_969298983 4 Left 969298977 4:6286220-6286242 CCAGATTCATTTGCTGAGGTCTT 0: 1
1: 0
2: 1
3: 28
4: 276
Right 969298983 4:6286247-6286269 CCCAGTCCCATGGTGTTAGGAGG 0: 1
1: 0
2: 2
3: 28
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969298983 Original CRISPR CCCAGTCCCATGGTGTTAGG AGG Intronic
900538773 1:3192387-3192409 ACCAGGCTCAGGGTGTTAGGAGG + Intronic
900558295 1:3290983-3291005 CCCAGGCCCCTGGAGTCAGGAGG - Intronic
900728664 1:4236429-4236451 CCCAGTGCAACGATGTTAGGAGG + Intergenic
900819573 1:4876211-4876233 CCCAATGAGATGGTGTTAGGAGG - Intergenic
902606969 1:17574140-17574162 CCCAGGCCCAGGGTGGAAGGGGG - Intronic
903567247 1:24277389-24277411 CCCAGGCCCCTGGTTTTTGGGGG - Intergenic
905017656 1:34788576-34788598 CCCAGTGTGATGGTATTAGGAGG + Intronic
905474287 1:38214942-38214964 CCCAGTGCCCTGGTGTCAGGTGG + Intergenic
906923173 1:50086718-50086740 ACCACTCCCAGGGTGGTAGGAGG - Intronic
908113100 1:60916356-60916378 ACCAGTGTGATGGTGTTAGGGGG - Intronic
910683695 1:89894019-89894041 CCCAGTGTAATGGTATTAGGAGG + Intronic
912397631 1:109359317-109359339 CCTAGTGCGATGGTATTAGGAGG - Intronic
914748678 1:150517494-150517516 CCCAGTGTGATGGTATTAGGAGG + Intergenic
915364347 1:155306005-155306027 CCCAGTCCCAAGGGATTAGCAGG + Intergenic
916513504 1:165494584-165494606 CCCAGTGTGATGGTATTAGGAGG + Intergenic
916996355 1:170305892-170305914 CCCAATGTCATGGTGTTGGGAGG + Intergenic
917392914 1:174558730-174558752 ACTAGTACCATGGTGTTGGGAGG + Intronic
918014506 1:180620001-180620023 CCCAGTGCAATGGTGTTGAGAGG + Intergenic
919935599 1:202248616-202248638 GCGAGGCCCATGGTGTTTGGGGG + Intronic
922031552 1:221805222-221805244 CCCAATATGATGGTGTTAGGAGG - Intergenic
922173449 1:223176787-223176809 CCCAGGGTGATGGTGTTAGGAGG + Intergenic
922708473 1:227806773-227806795 CCCAGTGTAATGGTATTAGGAGG + Intergenic
922778288 1:228227816-228227838 CCCAAGGTCATGGTGTTAGGAGG - Intronic
922808487 1:228402656-228402678 CCCAGTGTGATGATGTTAGGAGG + Intronic
922824936 1:228511448-228511470 TCCAGTCCACTGGTGTAAGGAGG + Intergenic
923091487 1:230744522-230744544 CAGAGTCCCAGAGTGTTAGGGGG + Intergenic
923116383 1:230942790-230942812 TCCAGTCCCATGGTGTGGTGGGG - Intronic
923348499 1:233080731-233080753 CACAGTGCGATGGTATTAGGAGG - Intronic
924152928 1:241146940-241146962 CCCAATACGATGGTATTAGGAGG - Intronic
924282596 1:242453088-242453110 CCCAGCTCGATGGTGTTAGGAGG + Intronic
924798724 1:247311641-247311663 CCCAGGCCCACTGTGTTGGGAGG + Intronic
924810197 1:247394268-247394290 CCCAGTGTGATGGTATTAGGAGG - Intergenic
1063142622 10:3268774-3268796 CCCACTGTGATGGTGTTAGGAGG - Intergenic
1063427189 10:5959688-5959710 CGCAGTCCCAGGGTGCTGGGTGG - Intronic
1063467667 10:6257918-6257940 CCCAGAGCCATTGTGCTAGGAGG - Intergenic
1063624484 10:7676356-7676378 CCCACTGCAATGGTGTTAGGAGG + Intergenic
1064633544 10:17341523-17341545 CCCAGTATGATGGTATTAGGAGG + Intronic
1064637793 10:17386910-17386932 CCCAGTCCCAAGGCGCAAGGCGG - Intronic
1065863504 10:29892461-29892483 CCCAGTGCGATGGTATTTGGAGG + Intergenic
1067291896 10:44949814-44949836 CCCAGTGTGATGGCGTTAGGAGG - Intergenic
1070366461 10:75741840-75741862 CCCAGTGTGATGGTTTTAGGAGG + Intronic
1070969527 10:80552108-80552130 CCCAGTGTAATGGTATTAGGAGG - Intronic
1073456875 10:103642483-103642505 CCCTGTATCATGGTGTTGGGTGG + Intronic
1073670247 10:105579844-105579866 GCCAGTCCCATGGACTTGGGTGG - Intergenic
1077012694 11:385912-385934 CCCAAGCCTGTGGTGTTAGGGGG - Intergenic
1078443140 11:11384194-11384216 CCCAGTGTGATGGTATTAGGAGG + Intronic
1079353282 11:19711527-19711549 CCCAGTGTGATGGTATTAGGAGG - Intronic
1079551258 11:21701307-21701329 CCCAGTGCAACAGTGTTAGGAGG + Intergenic
1083006588 11:59352075-59352097 CCAAGGCCCATGGTGTGAGTGGG + Intergenic
1083201739 11:61124926-61124948 CCTATTCCCATGATGTTAGCGGG - Intronic
1083751655 11:64764204-64764226 CCCAGGCCCAGGGCCTTAGGTGG + Intergenic
1085334517 11:75681116-75681138 CCCAGTGGGATGGTATTAGGAGG + Intergenic
1085422424 11:76374829-76374851 CCCAGTGCAGTGGTGTTGGGAGG + Intronic
1087603336 11:100343562-100343584 TCCTGTCCCATTGTGTCAGGAGG - Intronic
1088928167 11:114322941-114322963 CCCAGTGTGATGGTATTAGGGGG + Intergenic
1090053381 11:123400716-123400738 CCCAGTACGATGGAATTAGGAGG - Intergenic
1091034177 11:132218251-132218273 CTCAGTCCTTTGGTGTTGGGTGG - Intronic
1091530592 12:1351070-1351092 CCCAGTATGATGGTGTTGGGAGG - Intronic
1092293328 12:7178618-7178640 CCCAGTGTGATGGTATTAGGAGG + Intergenic
1092829261 12:12427915-12427937 CCCAGTGTAATGGTATTAGGAGG - Intronic
1094214777 12:27929194-27929216 CCCTGTGTGATGGTGTTAGGAGG - Intergenic
1094752415 12:33427152-33427174 CCCAAGGCCATGGTATTAGGAGG + Intronic
1095643225 12:44509458-44509480 CCCAGTGTGATGGTATTAGGAGG + Intronic
1097915870 12:65019707-65019729 CCCAATGCTATGGTTTTAGGAGG - Intergenic
1099232328 12:80041143-80041165 CCCAGTGGGATGGTATTAGGAGG + Intergenic
1100408724 12:94294000-94294022 CCCAGTGTGATGGTATTAGGAGG - Intronic
1100450330 12:94699708-94699730 CCCAGTGCAATGGTATTAGGAGG - Intergenic
1100536078 12:95510579-95510601 CCCAGTGTGATGGTGTTGGGAGG - Intronic
1101228434 12:102713566-102713588 CCCAGTGGAATGGTATTAGGAGG - Intergenic
1101983789 12:109430063-109430085 CCCAATGTGATGGTGTTAGGAGG - Intronic
1103178983 12:118891195-118891217 CCCAGTGCGGTGGTGTTAAGAGG - Intergenic
1103838919 12:123846874-123846896 CCAAATCCCATGGTGTGATGTGG - Intronic
1104145675 12:126031529-126031551 ACCAGTCCCATGGGGTTATATGG - Intergenic
1104569479 12:129912396-129912418 CCCAGTGTGATGGTGTCAGGAGG - Intergenic
1106475596 13:30095535-30095557 CCCAGTGTGATGGTGTTAGGAGG - Intergenic
1107909039 13:45087915-45087937 CCCAGTGCAGTGGTGTTGGGAGG - Intergenic
1110778675 13:79439460-79439482 CCCAGTGTGATGGTATTAGGAGG - Intergenic
1111211979 13:85091298-85091320 CCCAATATGATGGTGTTAGGAGG + Intergenic
1115030054 14:28784458-28784480 CCCATTCCCAGGATGTTAGAGGG + Intronic
1116054989 14:39852578-39852600 CCCAGTGCAACAGTGTTAGGAGG - Intergenic
1118049924 14:62015580-62015602 CCCAGTATGATGGTATTAGGAGG + Intronic
1119882534 14:78112397-78112419 CCCAGTGTGATGGTATTAGGAGG + Intergenic
1120347567 14:83309579-83309601 TCCAGTCCTATAATGTTAGGGGG - Intergenic
1120779260 14:88471462-88471484 CCCAGTCCCATGTATTTAAGAGG - Intronic
1124463230 15:29912245-29912267 CCCGGTGCCATGGTATTAGGCGG - Intronic
1124613940 15:31228332-31228354 CCCAGTGCGATGGCATTAGGAGG + Intergenic
1128220570 15:65965471-65965493 CCCAATGCAATGGTATTAGGAGG + Intronic
1128861349 15:71076612-71076634 CCCAGTGCAACGGTGTTGGGAGG + Intergenic
1129380302 15:75160854-75160876 CCCAGGGTAATGGTGTTAGGAGG - Intergenic
1130104373 15:80918515-80918537 CACAGTGCCAGGGTGGTAGGTGG + Intronic
1130637887 15:85642546-85642568 CCCCGCCCCATGGCGTTAGGGGG + Intronic
1131885063 15:96903713-96903735 CCCAGTGCCAGGGTGGTCGGAGG - Intergenic
1132152438 15:99472331-99472353 CCCAGTGGGATGGTATTAGGAGG - Intergenic
1132181073 15:99753317-99753339 CCCAGTGGGATGGTGTTAGGCGG - Intergenic
1133836613 16:9373363-9373385 CCCAGTGTGATGTTGTTAGGAGG + Intergenic
1134186870 16:12091402-12091424 CCCAGTGTGATGGTGTTAGGAGG + Intronic
1135507942 16:23055329-23055351 CCCAGTGCAATCGTGTTAAGAGG + Intergenic
1136517139 16:30774997-30775019 CTCAGTCACAGGGTGTCAGGGGG - Exonic
1137816974 16:51407511-51407533 CACAGCCCCAAGGTGGTAGGAGG - Intergenic
1138307591 16:55991866-55991888 CCCAGTGTGATGGTATTAGGAGG + Intergenic
1141021196 16:80498140-80498162 CCCAGTGGGATGGTATTAGGAGG - Intergenic
1142061530 16:88033259-88033281 CCCTTTCCCAAGGTGTGAGGTGG - Intronic
1143019134 17:3907615-3907637 CCCAGTGCCAAGGTGAGAGGGGG - Intronic
1143316917 17:6039852-6039874 CCCAGTGCAATGGTGTTAGGAGG - Intronic
1143919319 17:10318322-10318344 TCCAGTCCAGTGGTGTTGGGGGG + Intronic
1144148004 17:12416607-12416629 CCCAGTGCAATGGTATTTGGAGG - Intergenic
1145398017 17:22511428-22511450 CCCAGCCCTTTGGTGTTTGGTGG - Intergenic
1145815074 17:27789456-27789478 CCCAGACCCGGGGTGTTGGGGGG - Intronic
1145902341 17:28497025-28497047 CCAAGTCCCCAGGTGTTTGGGGG - Intronic
1147341873 17:39757204-39757226 CCCAAACCGAAGGTGTTAGGGGG - Intergenic
1147526455 17:41228701-41228723 ACCACTCCCATGCTGGTAGGAGG - Intronic
1149788325 17:59455100-59455122 CCCAGTGTGATGGTGTTAGGAGG - Intergenic
1153408896 18:4771224-4771246 CCCAGTGGAATGGTGTTGGGAGG - Intergenic
1153656060 18:7283377-7283399 CCCAGTGTGGTGGTGTTAGGAGG - Intergenic
1158171576 18:54606178-54606200 ACCAGTCCCATGGGGTTATATGG + Intergenic
1158241247 18:55380527-55380549 CCCAGTGGGATGGTGTTAGGAGG - Intronic
1158630205 18:59106897-59106919 CCCAAGGCGATGGTGTTAGGAGG - Intergenic
1158638208 18:59179725-59179747 CCCAGTGTGATGGTATTAGGAGG - Intergenic
1159854258 18:73565466-73565488 CCCAGTATGATGGTATTAGGAGG + Intergenic
1160343416 18:78109685-78109707 CCCAGTAGGATAGTGTTAGGAGG + Intergenic
1160552834 18:79706050-79706072 CCCAGGGCGAGGGTGTTAGGAGG + Intronic
1162110629 19:8397888-8397910 CCTGGTCCCAGGGAGTTAGGGGG - Intronic
1163321606 19:16577920-16577942 CCCAGGCTCCTGGTGTCAGGGGG + Intronic
1163614128 19:18316759-18316781 CCCAGTACTATGGCGCTAGGAGG + Intronic
1164044633 19:21525925-21525947 CCAACTCCCAGGGTGTTATGAGG + Intronic
1164255802 19:23527180-23527202 ACCAGTCCCATGGGGTCATGTGG + Intronic
1164631428 19:29764334-29764356 CCCAGGCCCATGGGCTTACGAGG - Intergenic
1166108322 19:40608415-40608437 CCCAGCCCCATAGTGAAAGGAGG + Intronic
925483342 2:4301309-4301331 CCCATTGGGATGGTGTTAGGAGG + Intergenic
925541806 2:4975325-4975347 ACCAATCTGATGGTGTTAGGAGG + Intergenic
926128505 2:10286178-10286200 CCCACTCCCATGAAGTCAGGAGG + Intergenic
926626888 2:15097733-15097755 CCCAGGATGATGGTGTTAGGTGG - Intergenic
926953844 2:18272185-18272207 CCCAGCCCCAGGCTGTGAGGGGG - Intronic
927369244 2:22335685-22335707 TTCAGTGCCATGGTATTAGGAGG + Intergenic
928257143 2:29732628-29732650 CCCAGTGTGATGGTATTAGGAGG + Intronic
929896725 2:45967227-45967249 CCCACTGCCATGGTCATAGGAGG + Intronic
930483335 2:51978107-51978129 CCCAGTGCAACAGTGTTAGGAGG + Intergenic
931274400 2:60732012-60732034 CCCAGTACAATGATGTGAGGTGG + Intergenic
931377074 2:61717435-61717457 CCCAGGGTGATGGTGTTAGGGGG - Intergenic
931715117 2:65022733-65022755 CCCAGAACCATGGTGGAAGGTGG - Exonic
934985946 2:98884596-98884618 CCCAGTGCAATGGTATTAGGAGG + Intronic
935172861 2:100624173-100624195 CCCAGTGTGATGGTGTTAGGAGG - Intergenic
935387094 2:102511378-102511400 CCAAGTTCCATGGACTTAGGTGG - Intronic
937589290 2:123594064-123594086 CCCAATGCGATGGTGTTTGGAGG + Intergenic
937707262 2:124935610-124935632 CCCATTCCCCAGGTGATAGGAGG - Intergenic
937901589 2:127023786-127023808 CCCAGTGTGATGGTATTAGGAGG - Intergenic
938112378 2:128577572-128577594 CCCAGTGTGATGGTGTTAAGAGG + Intergenic
938243915 2:129763118-129763140 CCCTGTGGGATGGTGTTAGGTGG - Intergenic
938683849 2:133717933-133717955 CCCAGTGTGATGGTATTAGGAGG - Intergenic
938775445 2:134537538-134537560 CCCAGTGTGATGGTTTTAGGAGG - Intronic
939119590 2:138100496-138100518 CCCAGGGAGATGGTGTTAGGAGG - Intergenic
939888341 2:147705993-147706015 CCCAGTGTGGTGGTGTTAGGAGG - Intergenic
939982928 2:148802243-148802265 CCCAATGTGATGGTGTTAGGAGG - Intergenic
946414866 2:219534923-219534945 CCCAGTCCCAGGGGGTTGGGAGG + Intronic
946671568 2:222110407-222110429 CACAGTCCCAGGGTGTTGGCCGG - Intergenic
947702404 2:232245306-232245328 CCAAGTCCCATTATGTCAGGGGG - Intronic
948440462 2:237983938-237983960 CCCAGTCTCATGATGACAGGTGG + Intronic
948516397 2:238506412-238506434 CCCAGTGTGATGCTGTTAGGAGG - Intergenic
948523455 2:238556744-238556766 CCCAGTCTCCGGGTGTTAGCTGG - Intergenic
948582278 2:238996540-238996562 CCCTGTCCCTGGGGGTTAGGAGG + Intergenic
1168803440 20:659014-659036 CCCAGTATGATGGTATTAGGAGG + Intronic
1168965845 20:1897430-1897452 CCCAGGCCCATGGTGTGACCAGG - Intronic
1169837958 20:9901519-9901541 CCCAGTGCAATAGTGTTAAGAGG - Intergenic
1169852724 20:10070210-10070232 CCCATTCCCTTGTAGTTAGGTGG + Intergenic
1171143207 20:22760584-22760606 ACCAGTCCCATGGTTTCAGCTGG + Intergenic
1172887051 20:38238490-38238512 CCCAGTCCTATGGTATGAGTAGG - Intronic
1173504155 20:43573940-43573962 GCCACTGCCATGGTGTTGGGGGG + Intronic
1175180713 20:57144876-57144898 CCCAGTGTGATGGTGTTAGGAGG - Intergenic
1175244657 20:57574495-57574517 CCCATACCCATGGTGCAAGGAGG - Intergenic
1176376043 21:6087285-6087307 CCCAGCCCCATGAGGTCAGGAGG - Intergenic
1177471895 21:21570245-21570267 CCCAATGTGATGGTGTTAGGAGG + Intergenic
1177524253 21:22271599-22271621 TCCATTCCAATGGTGTTAGAGGG + Intergenic
1179239331 21:39575135-39575157 GCCAGTGCGATGGTATTAGGAGG - Intronic
1179747432 21:43450959-43450981 CCCAGCCCCATGAGGTCAGGAGG + Intergenic
1181999573 22:26909218-26909240 CCCAGCACGATGCTGTTAGGAGG - Intergenic
1183799237 22:40147686-40147708 CCCAGTGCAATAGTGTTGGGAGG - Intronic
1183933726 22:41250095-41250117 TCCATTCCCACGGTGTGAGGTGG - Intronic
1184486904 22:44785245-44785267 TCAGGTCCCATGGAGTTAGGAGG - Intronic
949785997 3:7742529-7742551 ACCAGTCTCATAGTGTTATGAGG + Intergenic
950226077 3:11235585-11235607 CCCACCCCCATGGTGTCAGTAGG - Intronic
950820909 3:15757517-15757539 CCCAATGTCATGGTATTAGGAGG + Intronic
951462099 3:22962630-22962652 CCCAATGCGATGGTGTTAGGAGG + Intergenic
951767434 3:26215312-26215334 CCCAGTGGGAGGGTGTTAGGTGG + Intergenic
953487855 3:43319155-43319177 CCCTGTCCCAGCATGTTAGGAGG + Intronic
954012560 3:47654881-47654903 CCCAGTGTTATGGTGTTGGGAGG - Intronic
954383951 3:50234755-50234777 CCCAGTGCCATGAGGCTAGGAGG - Intronic
956196728 3:66660550-66660572 CCCAGTGTGATGGTATTAGGAGG + Intergenic
959236592 3:103730482-103730504 CCCAGTTTGATGGTATTAGGAGG - Intergenic
959624877 3:108438538-108438560 CCCAGTATGATGGTGTTGGGAGG + Intronic
959710030 3:109376783-109376805 CCCAGTGCAATGGTATTAAGAGG + Intergenic
961342766 3:126239812-126239834 CCCATTCTCATGCTGCTAGGAGG + Intergenic
966240391 3:177749368-177749390 CCCAGTGCCATGATGTTGGAAGG + Intergenic
966493559 3:180555296-180555318 CCCAGTGCAACAGTGTTAGGAGG + Intergenic
967870721 3:194226775-194226797 CCCAAAGCAATGGTGTTAGGAGG + Intergenic
969144788 4:5113111-5113133 CCCAATGTGATGGTGTTAGGAGG + Intronic
969298983 4:6286247-6286269 CCCAGTCCCATGGTGTTAGGAGG + Intronic
969965216 4:10987070-10987092 ACCAATCTGATGGTGTTAGGAGG + Intergenic
970931692 4:21519118-21519140 CCCAGTGTGATGGTATTAGGAGG + Intronic
970994703 4:22252077-22252099 CCCAATGCAATGGTATTAGGTGG + Intergenic
971103668 4:23497811-23497833 CCCAGTGTGATGGTGTTTGGAGG + Intergenic
972275901 4:37557609-37557631 CCCAGTGTGATGGTATTAGGAGG - Intronic
973746083 4:53964848-53964870 CCCAATGCTATGGTATTAGGAGG + Intronic
974115959 4:57579226-57579248 CCCAGTGTAATGGTATTAGGAGG - Intergenic
974181012 4:58384986-58385008 TCCTGTCACATGATGTTAGGTGG + Intergenic
974365601 4:60945301-60945323 CCCAATGCGATGGTATTAGGAGG - Intergenic
975220067 4:71804593-71804615 ACCAGTCCCATGGGGTTATATGG + Intergenic
975220636 4:71809104-71809126 ACCAGTCCCATGGGGTTATATGG + Intergenic
976517385 4:85984532-85984554 CCCAGTGTGATGGTATTAGGAGG - Intronic
978505252 4:109449759-109449781 CCCAATGTGATGGTGTTAGGAGG - Intronic
979173965 4:117638248-117638270 CCCAGTGTGATGGTATTAGGAGG + Intergenic
981526799 4:145715020-145715042 CCCAGTCTCATGGAGTTGGGTGG + Intronic
982325454 4:154124888-154124910 CCCAGTGTGATGGTCTTAGGAGG - Intergenic
982648565 4:158055862-158055884 CTTAGTGCAATGGTGTTAGGAGG + Intergenic
982860894 4:160447694-160447716 CCCAGTGCCATGGTATTAGGAGG + Intergenic
983372077 4:166873102-166873124 CCCAGTCTGGTGGTGTTGGGAGG - Intronic
983748697 4:171235330-171235352 CCCAGGGTGATGGTGTTAGGAGG - Intergenic
983969248 4:173851058-173851080 CCCAGTGTGATGGTGTCAGGAGG + Intergenic
983970422 4:173864612-173864634 CCCAGTGCAATGGTGTTGAGAGG - Intergenic
984790227 4:183608459-183608481 CCCAGTGTGATGGTGTTTGGAGG + Intergenic
985793803 5:1947244-1947266 CCCACTCCCAAGGTGGTTGGTGG - Intergenic
986666953 5:10112792-10112814 CCCAAGGCCATGGTATTAGGAGG - Intergenic
986812573 5:11375949-11375971 CCCAGTGTGATGGTGTTAGGAGG + Intronic
987953755 5:24710699-24710721 CCCAGTGTGATGGTGTTTGGAGG - Intergenic
988091129 5:26542475-26542497 CACAGGCCCATAGTTTTAGGAGG - Intergenic
988793494 5:34630966-34630988 CCCTGTGCAATGGTATTAGGGGG + Intergenic
993351618 5:86856959-86856981 CCCAGTGTGATGGTATTAGGAGG - Intergenic
994278491 5:97869420-97869442 CCCAGTGTGATGGTATTAGGAGG - Intergenic
994875172 5:105413161-105413183 CCCAGTGTAATGGTATTAGGAGG - Intergenic
995528796 5:113072752-113072774 TCCAGTCCCATGATGTTATTAGG + Intronic
995712571 5:115050130-115050152 CCCAGGGTCATGGTATTAGGAGG - Intergenic
995835077 5:116392551-116392573 CCCAGTGTGATGGTATTAGGAGG - Intronic
999231867 5:150066486-150066508 CCCAGACCCATGGTATAAGAGGG + Intronic
999793048 5:154960766-154960788 CACTTTCCCATGGTGTTGGGAGG - Intronic
1000256398 5:159542495-159542517 CCCAGTGCAACGGTGTTGGGAGG + Intergenic
1001361912 5:171094908-171094930 CCCAATGCAATAGTGTTAGGAGG + Intronic
1002634224 5:180599165-180599187 CCCAGTGTGATGGCGTTAGGAGG - Intergenic
1003060993 6:2862300-2862322 CCTCGTCCCATGGTGGAAGGTGG - Intergenic
1006682930 6:35810236-35810258 TCCAGTGTGATGGTGTTAGGAGG - Intronic
1006797730 6:36742068-36742090 CCCAAACCCAGGGAGTTAGGGGG - Exonic
1008722163 6:54368008-54368030 CCCATTGCAATGGTATTAGGAGG - Intronic
1010671247 6:78689387-78689409 CCCAGTGTGATGGTATTAGGAGG + Intergenic
1013629993 6:111977133-111977155 CCCAATGCCATGGTATTAGGAGG + Intergenic
1013795400 6:113882497-113882519 CCCAGTGCCCTGGTGATAGATGG + Intergenic
1014254651 6:119148633-119148655 TCCAGTTTCATGGTGTTGGGAGG - Intronic
1016028347 6:139312010-139312032 CCCAGTGACATGGTATTAGGAGG - Intergenic
1017048314 6:150367677-150367699 CCCAGTACAATGGTATTTGGAGG + Intergenic
1017282691 6:152640622-152640644 CCCAGTGTCATGGTATTAGGAGG + Intergenic
1017721116 6:157243857-157243879 CCCAGTGTCATGGCGTTAGGAGG + Intergenic
1017935624 6:159002264-159002286 CCCACTCCCCTGGTGTTAGTGGG + Intergenic
1018714593 6:166521868-166521890 CCCAGTGTGATGGTTTTAGGTGG + Intronic
1019336418 7:485036-485058 CCCAGTCCCAGGGTCATGGGGGG - Intergenic
1019422041 7:954984-955006 CCCATGCCCATGGTCTTGGGGGG - Intronic
1021919186 7:25466602-25466624 CCCAGTGTAATGGTGTTTGGAGG + Intergenic
1021919940 7:25474771-25474793 CCCAGTGACATGGTGAGAGGTGG - Intergenic
1022365351 7:29709272-29709294 CCCAGTCTGATGGTGTTTGGAGG - Intergenic
1022796772 7:33738006-33738028 CCCAGTGTGATGGTATTAGGAGG + Intergenic
1023052805 7:36267800-36267822 CCCAGTATGATGGTGTTTGGAGG + Intronic
1023570691 7:41568385-41568407 CCCAGTGTGATGGTGTTAGAAGG + Intergenic
1023778555 7:43634456-43634478 CCCACTCCCATGGTATCAGTGGG - Intronic
1024275181 7:47671538-47671560 CCCAGCCCCGGGGGGTTAGGCGG - Intergenic
1024489241 7:49958407-49958429 CCCAATCCAACAGTGTTAGGAGG + Intronic
1025018978 7:55465964-55465986 CCCACTCCGATGGTGTTTGAAGG + Intronic
1025774450 7:64547536-64547558 CCAACTCCCAGGGTGTTATGAGG - Intronic
1025866290 7:65384806-65384828 CCAACTCCCAGGGTGTTACGAGG + Intronic
1026339110 7:69420297-69420319 CCCAGCCCCCTGCAGTTAGGTGG - Intergenic
1026830611 7:73607718-73607740 CCCAGTCCCCTGGGGTGAGGTGG - Intronic
1027672140 7:81114718-81114740 CCCATTCTCATGATGTGAGGTGG - Intergenic
1027785794 7:82577378-82577400 CCCAATCACATGGGGTTGGGGGG - Intergenic
1029502805 7:100944156-100944178 GCCAGTCTCATGGTGGTAGAGGG - Intergenic
1029949984 7:104573647-104573669 CCCAGGCCCTGGCTGTTAGGAGG - Intronic
1030275921 7:107721682-107721704 GCCAGCCACATGGTGTAAGGAGG + Intergenic
1032140672 7:129327128-129327150 CCCAGTGTGATGGTATTAGGAGG + Intronic
1032792573 7:135253318-135253340 CCCAGGGTGATGGTGTTAGGAGG - Intronic
1033706923 7:143898811-143898833 CCCAATGCAATGGTGTTAAGAGG + Intronic
1034675567 7:152890505-152890527 CCCAGTACGATGGTATTTGGAGG - Intergenic
1034752463 7:153583649-153583671 CCCAGTATAATGGTATTAGGAGG + Intergenic
1035521406 8:277515-277537 CCCAGTGGGATGGTATTAGGAGG + Intergenic
1035537119 8:400471-400493 CCCCGTGTGATGGTGTTAGGAGG + Intergenic
1035595424 8:853873-853895 CCCAATGTGATGGTGTTAGGAGG + Intergenic
1036058397 8:5286950-5286972 CCCAGTGTGATGGTGTTAGGGGG + Intergenic
1036693496 8:10959679-10959701 CACAGTGGGATGGTGTTAGGTGG - Intronic
1037174946 8:15935920-15935942 CCCAATTTGATGGTGTTAGGAGG - Intergenic
1037613523 8:20496307-20496329 CCCGGTGTGATGGTGTTAGGAGG + Intergenic
1038358024 8:26848324-26848346 ACCAGTGTGATGGTGTTAGGAGG + Intronic
1040524937 8:48213507-48213529 CCCAGTGCCACAGTGTTGGGAGG + Intergenic
1041019804 8:53627256-53627278 CCCAGGGCAATGGTATTAGGAGG + Intergenic
1041242685 8:55861728-55861750 CCCAGTGTAATGGTATTAGGAGG - Intergenic
1041954189 8:63539207-63539229 CCCAGTACAGTGGTGTTGGGAGG + Intergenic
1043587750 8:81788974-81788996 CCCACTGCAATGGTGTTGGGAGG - Intergenic
1044059313 8:87614948-87614970 CCCAGTGGGATGGTATTAGGAGG + Intronic
1044901507 8:96950591-96950613 CACACTCCCCTGGTGGTAGGGGG - Intronic
1045517181 8:102870191-102870213 CCCAGTGCAATGTTGTTGGGAGG + Intronic
1048008146 8:130435851-130435873 CCCAGACCAATGGTGTATGGTGG - Intronic
1048387053 8:133921721-133921743 CCCAGGCACAGGGTGTTGGGAGG + Intergenic
1049321952 8:142001368-142001390 CCGTGTCCCCTGGTGATAGGTGG - Intergenic
1050593398 9:7182709-7182731 CCCATTCACATGGAGTGAGGGGG - Intergenic
1050633137 9:7581619-7581641 CCCAGTGTGATGGTATTAGGAGG + Intergenic
1050639419 9:7651358-7651380 CTCAGTGCGATGGTGTTTGGAGG + Intergenic
1050665194 9:7927826-7927848 CCCAGTGTCATGGTATTAGGAGG + Intergenic
1051168787 9:14296490-14296512 CCCAATCTGATGGTATTAGGAGG + Intronic
1053359435 9:37473774-37473796 CCCAGTGTGATGGTATTAGGAGG + Intergenic
1055339908 9:75270224-75270246 CCCAATACAATGCTGTTAGGAGG + Intergenic
1055997224 9:82172977-82172999 CCCAGTGTGAAGGTGTTAGGAGG - Intergenic
1056730717 9:89164021-89164043 CCTAATTCGATGGTGTTAGGAGG - Intronic
1056789301 9:89615374-89615396 CCCAGTGTAATGGTGTTGGGAGG + Intergenic
1057293171 9:93819982-93820004 CCATGCCCCATGGTGTTAGAAGG + Intergenic
1057801667 9:98194953-98194975 CCCTGTGCCATGGTGGTTGGTGG + Intergenic
1058740375 9:107936750-107936772 CCCAGTGTGATGGTATTAGGAGG + Intergenic
1060357396 9:122922425-122922447 CCAAGTTTCATGGTATTAGGGGG + Intronic
1061948493 9:133922070-133922092 CCCAAGCCCACGCTGTTAGGGGG + Intronic
1062132699 9:134908561-134908583 CCCTGTCCCATGGGGCTTGGGGG + Intronic
1185705464 X:2263233-2263255 CCCCGTGAGATGGTGTTAGGAGG + Intronic
1186000109 X:5000121-5000143 CCCAAGGCGATGGTGTTAGGAGG - Intergenic
1187938271 X:24356883-24356905 CCCAATGTGATGGTGTTAGGAGG - Intergenic
1188936756 X:36185337-36185359 CCCAGTTTCATGGTATTAAGAGG - Intergenic
1189998430 X:46661614-46661636 CCCGGCCACATGGTGTTATGTGG - Intronic
1190108056 X:47573133-47573155 TCCAGGCCCATGGTGGCAGGTGG - Intronic
1195454771 X:105055331-105055353 CCCAGTTTGATGGTATTAGGAGG - Intronic
1195597673 X:106711189-106711211 TCCACTCCCATGGGGCTAGGCGG - Intronic
1196078478 X:111604321-111604343 CCCAGTGCAATGGTGTTGAGAGG - Intergenic
1196381152 X:115091209-115091231 CCCATTGCGATGGTATTAGGAGG - Intergenic
1196776490 X:119342880-119342902 CCCAGTTTGATGGTGTTGGGAGG - Intergenic
1198706151 X:139450682-139450704 CCCTGTCCCCTGGAGTTATGTGG - Intergenic
1198920627 X:141722007-141722029 CCCAGTGCAATAGTGTTGGGCGG - Intergenic
1199287468 X:146069725-146069747 CCCAGTCCAGTGGTGTTGGGAGG + Intergenic