ID: 969299122

View in Genome Browser
Species Human (GRCh38)
Location 4:6287176-6287198
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 154}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969299113_969299122 9 Left 969299113 4:6287144-6287166 CCAAGGCCGGGGACCCCAAGGCA 0: 1
1: 0
2: 3
3: 21
4: 194
Right 969299122 4:6287176-6287198 GTGAGGACTGCGGTGCCGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 154
969299117_969299122 -5 Left 969299117 4:6287158-6287180 CCCAAGGCACAGACTGAGGTGAG 0: 1
1: 0
2: 2
3: 21
4: 299
Right 969299122 4:6287176-6287198 GTGAGGACTGCGGTGCCGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 154
969299114_969299122 3 Left 969299114 4:6287150-6287172 CCGGGGACCCCAAGGCACAGACT 0: 1
1: 0
2: 0
3: 29
4: 248
Right 969299122 4:6287176-6287198 GTGAGGACTGCGGTGCCGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 154
969299118_969299122 -6 Left 969299118 4:6287159-6287181 CCAAGGCACAGACTGAGGTGAGG 0: 1
1: 0
2: 3
3: 25
4: 265
Right 969299122 4:6287176-6287198 GTGAGGACTGCGGTGCCGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 154
969299110_969299122 20 Left 969299110 4:6287133-6287155 CCTGGAGAGGGCCAAGGCCGGGG 0: 1
1: 0
2: 6
3: 84
4: 452
Right 969299122 4:6287176-6287198 GTGAGGACTGCGGTGCCGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 154
969299116_969299122 -4 Left 969299116 4:6287157-6287179 CCCCAAGGCACAGACTGAGGTGA 0: 1
1: 0
2: 3
3: 21
4: 354
Right 969299122 4:6287176-6287198 GTGAGGACTGCGGTGCCGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900125067 1:1065244-1065266 GTGGGGTCTGCGGTGCCCTCGGG + Intergenic
900527258 1:3135285-3135307 GGGAGGTCTGCGGTGGGGGCAGG + Intronic
901749985 1:11400214-11400236 GTGAGGAGTGGGGTGGCTGCTGG + Intergenic
903603055 1:24556121-24556143 GGGAGCGCGGCGGTGCCGGCGGG + Exonic
911647546 1:100352521-100352543 GGGAGGACTTCAGTGCCCGCGGG - Exonic
912050647 1:105524643-105524665 GTGAGGACTTTGGTGTAGGCTGG + Intergenic
912277314 1:108273080-108273102 GCGAGTGCTGCGGTGCTGGCTGG + Intergenic
912290914 1:108421276-108421298 GCGAGTGCTGCGGTGCTGGCTGG - Intronic
914251721 1:145927337-145927359 GTGAGGACAGTGGAGACGGCTGG - Intergenic
918174253 1:182029575-182029597 GTAATGCCTGTGGTGCCGGCCGG - Intergenic
922462490 1:225824145-225824167 GGAAGGACTGCGGGGGCGGCGGG - Intronic
922917533 1:229271018-229271040 GTGAGGACTTCGGCGCGCGCCGG - Intergenic
1066656164 10:37701406-37701428 GCGAGGACTGCTGTGTCAGCAGG + Intergenic
1066685400 10:37976576-37976598 GAGAGGACTCCGGTGCCTCCGGG - Exonic
1067848276 10:49739638-49739660 GTGAGGGCTGCGGTGGTGGCTGG - Intronic
1069918697 10:71802982-71803004 GTGATGACCGAGGTGCCCGCCGG - Exonic
1072686644 10:97541571-97541593 GTGAGGACTGCAGTGCTGTGTGG - Intronic
1075129577 10:119726360-119726382 GTGAGGCTGGCGGTGCGGGCGGG + Intronic
1076372279 10:129963551-129963573 GTGAGGAGCGCGGCGCCGGCCGG + Intronic
1076526654 10:131116436-131116458 GTGAGGCCTGAGAGGCCGGCAGG - Intronic
1076733828 10:132450284-132450306 GTGAGGACTGGGGTGGGGGCTGG - Intergenic
1083270787 11:61571579-61571601 GTGTGGATGGGGGTGCCGGCAGG - Intronic
1083700887 11:64477039-64477061 ATGAGGGCTGCAGTGCCAGCCGG - Intergenic
1083993136 11:66258559-66258581 GTGAGGACGAGGGTGCGGGCAGG - Exonic
1088832303 11:113547742-113547764 GTCAGGACAGTGATGCCGGCAGG - Intergenic
1092515179 12:9203745-9203767 GTGAGTGCTACGGTGCCAGCTGG - Intronic
1099526397 12:83723393-83723415 ATGAGGACATCGGTGCAGGCTGG - Intergenic
1101633844 12:106521126-106521148 GTGGGGGCTCCGGTGCAGGCAGG + Intronic
1102026878 12:109718670-109718692 AGGAGGGCTGCGGTGCCGGCCGG + Intronic
1104521740 12:129481919-129481941 GTGAGGCCTGCGTTGGCCGCTGG + Intronic
1104641894 12:130472375-130472397 GTGTGGACTGTGCTGCAGGCGGG - Intronic
1104949477 12:132432767-132432789 GGGAGGGCTGCGGAGCCGCCGGG - Intergenic
1113082847 13:106535626-106535648 GCGGGGACCGCGGCGCCGGCCGG - Intergenic
1113654811 13:112061427-112061449 GTGATGACTGCGGGGTCGGCGGG - Intergenic
1118083809 14:62393396-62393418 GTGAGAACTGGGGTGCCAGGTGG + Intergenic
1121439370 14:93939158-93939180 TGGAGGGCTGCGGGGCCGGCGGG + Exonic
1122362244 14:101174362-101174384 GAGAGGTCTGGGGTGCAGGCTGG - Intergenic
1128462981 15:67885007-67885029 CTGAGGACTGCGGTGCCCTTAGG + Intergenic
1128562219 15:68676431-68676453 GTCAGGACTGAGGTGCCAGAGGG + Intronic
1129880842 15:79005183-79005205 GTGAGGCCTGAGGTGGGGGCAGG + Intronic
1131174475 15:90201379-90201401 GGGAGGACTGCGGTGCCCCGCGG + Exonic
1131506736 15:93026298-93026320 GTGAGGACTTCAGTGCTTGCTGG + Exonic
1132117087 15:99145500-99145522 CTGAGGACTGGGGAGTCGGCAGG + Intronic
1135052879 16:19206705-19206727 GTGAGGACAGAGGTGGAGGCTGG - Intronic
1136339024 16:29629726-29629748 GTGAGGACTGCTGAGTCCGCGGG + Intergenic
1137697127 16:50468840-50468862 GAGAGGACTAGGGAGCCGGCAGG - Intergenic
1139531216 16:67543604-67543626 GTGAGGACTGAGTTGCTGGCAGG + Intronic
1140891081 16:79285714-79285736 GTGAGTCCTGCGGTGCCCTCTGG - Intergenic
1141696691 16:85623621-85623643 GTGAGGACCCCGGTGCCTGCAGG + Intronic
1141815196 16:86404851-86404873 TGGAGGACTGCGGTGGGGGCTGG + Intergenic
1144944208 17:18961509-18961531 GTGAGGGCTGCTGTGTCTGCGGG + Intronic
1144954078 17:19010413-19010435 GTGAGAACTGGGGAGCTGGCAGG - Intronic
1145214783 17:21043139-21043161 CTGCGCAGTGCGGTGCCGGCCGG - Intronic
1146456758 17:33014858-33014880 GTGCTGACTGCTTTGCCGGCAGG + Intronic
1148496264 17:48055023-48055045 GTGAGAGCTGCGGTCCAGGCGGG - Intronic
1149288332 17:55190755-55190777 GTGAGACCTGCAGTGCCAGCTGG + Intergenic
1149864504 17:60143251-60143273 TTGAGGAGTGCGGTGGGGGCTGG - Intergenic
1150168494 17:62966668-62966690 GTGAGGACCGCGCCGCCCGCCGG - Intergenic
1152263278 17:79278579-79278601 GCGTGGCCTGTGGTGCCGGCCGG + Intronic
1152284514 17:79404411-79404433 GTGTGGCCTGGGGTGCCCGCGGG - Intronic
1154337083 18:13474542-13474564 GTGAGGACTTCGGGGCCAGGTGG + Intronic
1160442725 18:78904488-78904510 GTGAGGACTGGGGGGCCAGGAGG + Intergenic
1160778650 19:868160-868182 GTGTGGACTGCGGGCCCAGCTGG + Exonic
1161063545 19:2226925-2226947 GCGCGAACTGCGGTCCCGGCGGG - Exonic
1161138610 19:2635191-2635213 GTGAGGACAGAGGTGCAGGTGGG + Intronic
1163282231 19:16324999-16325021 GTGAGGGCGGCGGGGACGGCGGG + Intronic
1164639258 19:29812349-29812371 GTGAGGGCGGCGGGGGCGGCGGG + Intronic
925532960 2:4884303-4884325 GTGGGGCCTGAGGTGCCGGCTGG - Intergenic
927861424 2:26562491-26562513 GCGAGGACCGCGGGGCCAGCTGG + Intergenic
927955015 2:27201889-27201911 CTGAGGACTGCCGTGAGGGCTGG - Intronic
931698314 2:64888735-64888757 CTCAGCACTGCGCTGCCGGCAGG + Intergenic
932340461 2:70960079-70960101 GTGAGGCCTGCAGGGCCAGCAGG + Intronic
937060733 2:118978572-118978594 GTGAGGATTGCGGGGCCAGGCGG + Intronic
937208609 2:120252947-120252969 GTGCGGACGGCGGAGGCGGCGGG + Exonic
938392509 2:130916542-130916564 GACAGGACTGCAGGGCCGGCAGG + Intronic
938583872 2:132670503-132670525 CTGAGGACTGCGTGCCCGGCTGG + Intronic
945175314 2:207037910-207037932 GTTAGGACTTCGGTGCCAGGGGG - Intergenic
947472955 2:230414893-230414915 GTGAGGACAGCTTTGCCGGTGGG - Intergenic
947726989 2:232407188-232407210 GTGAGGGCTGCGGGGCTGGAAGG - Intronic
947815229 2:233032306-233032328 GGGAGGACAGCAGTGCAGGCCGG - Intergenic
948247365 2:236498148-236498170 GTGAGAAATGAGGTGCAGGCTGG + Intronic
1168965036 20:1894031-1894053 GGAAGGACTTCGGTGCCGCCTGG - Intergenic
1169056522 20:2626358-2626380 GTGAGGCCTCCAGTGCCAGCTGG - Intronic
1169191296 20:3660554-3660576 GTGAGGACTGCGAAGCCTTCCGG - Exonic
1171123420 20:22583684-22583706 GTGCGGAGTGCGGGGGCGGCTGG + Intronic
1171972133 20:31571019-31571041 GTGGCCTCTGCGGTGCCGGCTGG - Exonic
1171994529 20:31721909-31721931 GTTTGAACTGCGGTACCGGCGGG - Exonic
1176041520 20:63068436-63068458 GTGGGGACTGGGGTGCAGGGAGG - Intergenic
1176076740 20:63252022-63252044 GTGAGGTCTGGGCTGGCGGCTGG + Intronic
1176098352 20:63354127-63354149 GGGAGGACTGTGGTCCTGGCAGG + Intronic
1176098452 20:63354434-63354456 GGGAGGACTGTGGTCCTGGCAGG + Intronic
1176162070 20:63653157-63653179 CTGGGGTCTGCGGCGCCGGCGGG - Intronic
1176214271 20:63940871-63940893 GTGAGGACTCCGGTGAGCGCAGG + Intronic
1176295714 21:5071054-5071076 GCGAGGACGGTGTTGCCGGCTGG + Intergenic
1176306898 21:5128359-5128381 GTGAGGACAGCGGGGTCGGAAGG + Exonic
1178234094 21:30821788-30821810 GGGAGGGCTGGGGTGCAGGCAGG + Intergenic
1179522489 21:41954074-41954096 GGGAGGACTGCGGCCCCCGCAGG - Intergenic
1179784222 21:43720366-43720388 GCGGGGCCTGCGGTGCGGGCTGG + Intronic
1179798304 21:43798473-43798495 GGGAGGACTGCGTTGGGGGCTGG - Intronic
1179850160 21:44133671-44133693 GTGAGGACAGCGGGGTCGGAAGG - Exonic
1179861332 21:44191070-44191092 GCGAGGACGGTGTTGCCGGCTGG - Intergenic
1181539244 22:23564574-23564596 GTGAGGACAGTGAGGCCGGCAGG - Intergenic
1182443924 22:30379540-30379562 CTGAGGACCGGGGTGCAGGCAGG + Exonic
1183826145 22:40389301-40389323 GTAAGAACTGCAGTGCAGGCCGG + Intronic
1184281608 22:43440682-43440704 GTGAGGGCTGCGGAGGCTGCAGG - Intronic
1184386826 22:44181434-44181456 GGGAGGACGGCGGTGCGGGATGG + Intronic
1184773271 22:46610247-46610269 GTGAGGGCTGCGGTTCCCTCTGG + Intronic
1184784171 22:46663774-46663796 GTGGGGACTGCAGAGCCGGCGGG + Intronic
1184914925 22:47562806-47562828 GGGCAGACTGCGGTGCCTGCGGG + Intergenic
952927836 3:38334814-38334836 CTGAGGACTGTGGTGAAGGCTGG + Intergenic
953537231 3:43785778-43785800 GACAGGACTGCGGTGCGGGCAGG - Intergenic
954089338 3:48272185-48272207 CTGGGGCCTGTGGTGCCGGCCGG + Intronic
954112193 3:48440330-48440352 GTGAGGACTGCGGGGACGGCGGG + Intronic
954437474 3:50503680-50503702 GAGAAGAGGGCGGTGCCGGCAGG - Intronic
960026839 3:113019625-113019647 ATGATGGCTGCGGTGCCGCCGGG - Exonic
963202106 3:142596488-142596510 GGCAGGACAGCGGTGGCGGCAGG + Intronic
966882645 3:184358952-184358974 GTGAGAACTGGGGTGGGGGCAGG - Intronic
968570903 4:1340282-1340304 AGGAGGACTGCGGTCCGGGCAGG - Intergenic
968753341 4:2401703-2401725 GGGTGGACTGCGGTGCGGGGCGG - Intronic
969299122 4:6287176-6287198 GTGAGGACTGCGGTGCCGGCAGG + Intronic
969923120 4:10559459-10559481 GTGGGGACTGGGGTGCCAGAGGG + Intronic
982338567 4:154268889-154268911 GTTAGGAGTGCGGTGGCGGAGGG + Intronic
982407847 4:155040409-155040431 GAGAGGCCTGCAGTGCCTGCTGG - Intergenic
982598387 4:157414294-157414316 GTGGGGACTGGGGTGCCAGTAGG - Intergenic
983252066 4:165356873-165356895 GTGAGGAGTGCTGTGCTGGATGG + Intergenic
986462340 5:7984393-7984415 GTGAGGACTGAGTTGCAGGTGGG + Intergenic
988845123 5:35119874-35119896 GTGAGGGCTTCGGGGCAGGCGGG + Intronic
991716429 5:69455011-69455033 GTGAGGAGTGCTGTGCGGGTTGG - Intergenic
992679600 5:79140922-79140944 GTGAGGGCTGCGGTGCCCTGAGG + Intronic
997148542 5:131465838-131465860 GTGATGACTGCAGTGGGGGCAGG + Intronic
1002931374 6:1637318-1637340 GTGCTGTCTGCGGGGCCGGCCGG - Intronic
1005071456 6:21866098-21866120 ATGAGGATTGGGGTGCCTGCAGG + Intergenic
1006305164 6:33214194-33214216 GTGAGGACTGGGGACCCGGGAGG - Intergenic
1010043974 6:71420101-71420123 GTGGGGACTGCGGGGCGGGCCGG - Intergenic
1014098290 6:117482945-117482967 CTGAGGGCTGCGGGGCGGGCCGG + Intronic
1017771119 6:157645262-157645284 CTGAGGACTGCAGTGCCAACAGG - Intronic
1018390173 6:163335888-163335910 GAGAGGCGTGCGGTGCGGGCCGG - Intergenic
1018666492 6:166143255-166143277 GTGGGGACTGTGGAGCTGGCAGG - Intergenic
1019436972 7:1027576-1027598 CTGAGGACGGCGGAGCAGGCCGG - Intronic
1021655077 7:22866521-22866543 GTGAGGTCTGGGGTGCAGGGTGG - Intergenic
1021785749 7:24151050-24151072 GTGAGGACTGGGTTGCTGGAGGG + Intergenic
1022428005 7:30285719-30285741 CTGAGGACGGCGGCGGCGGCCGG + Exonic
1023951314 7:44848184-44848206 GTTAGGAAGGCGGTGCCGGGGGG - Intergenic
1024980713 7:55155538-55155560 GAGAGGGCTGAGGTGCCTGCTGG + Intronic
1028960195 7:96740162-96740184 GTGAGGACTGGGGTGCAGTTAGG + Intergenic
1031958121 7:127963407-127963429 CTGGGGACTGTGGTGGCGGCGGG - Intronic
1034531002 7:151696495-151696517 GTCAGGGCTGAGGCGCCGGCAGG - Intronic
1034777909 7:153848260-153848282 GTGAGGACTGGGGTGGGGGTAGG - Intergenic
1036642312 8:10592124-10592146 GTGAGGATTCCCGTTCCGGCTGG - Intergenic
1037890139 8:22619708-22619730 GTGAGGGCAGCGGTGGCGCCCGG + Exonic
1046186943 8:110734224-110734246 GTGGGGAATGCGGTGGCGCCCGG + Intergenic
1046624298 8:116560551-116560573 GCCAGGCCTGAGGTGCCGGCTGG + Intergenic
1047732382 8:127737719-127737741 GGAGGGGCTGCGGTGCCGGCGGG + Intronic
1049434277 8:142579320-142579342 GTGAGGACTGGGGTGACTGGGGG - Intergenic
1049475284 8:142794394-142794416 GTGAGGACTGCAGGGCGGGGCGG - Intergenic
1049513018 8:143039303-143039325 GTGAGGAGTCCCGTGCCGGGAGG - Exonic
1049861465 8:144901804-144901826 GGAGGGACTGCGGGGCCGGCAGG - Intronic
1058687051 9:107488726-107488748 GCGAGCACTGCGGAGCCGCCTGG - Intronic
1061010573 9:127952116-127952138 GTGAGGACAGCTGTGCAGCCAGG - Intronic
1061512795 9:131071251-131071273 GTGTGGTCAGCGGTGTCGGCAGG + Intronic
1062128762 9:134881230-134881252 GTGAGGCTTGTGGTGCCAGCTGG + Intronic
1062332239 9:136049887-136049909 GCGGGGGCTGCGGTGGCGGCGGG - Exonic
1062456900 9:136644316-136644338 GTGGTGACAGCGGTGCCCGCTGG + Intergenic
1191843028 X:65526549-65526571 GTGAGAACTGCAGTGTAGGCTGG - Intronic
1194849209 X:98851894-98851916 GTGAGGCCATCGGTGCAGGCTGG + Intergenic
1198018288 X:132633554-132633576 GGAAGGACTGAGGTGCCTGCGGG + Intronic
1199745843 X:150771542-150771564 GTGAGGACTCAGGTGCCCACTGG - Intronic