ID: 969299703

View in Genome Browser
Species Human (GRCh38)
Location 4:6290724-6290746
Sequence AGCCCAGCCCTTTCTAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 182}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969299703_969299706 12 Left 969299703 4:6290724-6290746 CCTTCCTTAGAAAGGGCTGGGCT 0: 1
1: 0
2: 1
3: 14
4: 182
Right 969299706 4:6290759-6290781 GAGGAAAGCTCTGTAGACACAGG 0: 1
1: 0
2: 1
3: 22
4: 238
969299703_969299705 -7 Left 969299703 4:6290724-6290746 CCTTCCTTAGAAAGGGCTGGGCT 0: 1
1: 0
2: 1
3: 14
4: 182
Right 969299705 4:6290740-6290762 CTGGGCTGTGTGTGAGACAGAGG 0: 1
1: 0
2: 5
3: 52
4: 419
969299703_969299707 13 Left 969299703 4:6290724-6290746 CCTTCCTTAGAAAGGGCTGGGCT 0: 1
1: 0
2: 1
3: 14
4: 182
Right 969299707 4:6290760-6290782 AGGAAAGCTCTGTAGACACAGGG 0: 1
1: 0
2: 0
3: 21
4: 260
969299703_969299708 14 Left 969299703 4:6290724-6290746 CCTTCCTTAGAAAGGGCTGGGCT 0: 1
1: 0
2: 1
3: 14
4: 182
Right 969299708 4:6290761-6290783 GGAAAGCTCTGTAGACACAGGGG No data
969299703_969299709 17 Left 969299703 4:6290724-6290746 CCTTCCTTAGAAAGGGCTGGGCT 0: 1
1: 0
2: 1
3: 14
4: 182
Right 969299709 4:6290764-6290786 AAGCTCTGTAGACACAGGGGTGG 0: 1
1: 0
2: 1
3: 21
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969299703 Original CRISPR AGCCCAGCCCTTTCTAAGGA AGG (reversed) Intronic
900544040 1:3218588-3218610 AGAACATCCCTTTCTAAGGAAGG - Intronic
900587318 1:3439594-3439616 AACCCACCCCTTCCTAAGGGTGG + Intergenic
900752775 1:4409259-4409281 AGGCCAGTCCTGTCTGAGGAGGG - Intergenic
901430817 1:9213534-9213556 AGCCTGGCCCTTTCTAATGGAGG + Intergenic
901473808 1:9475414-9475436 AGCCCAGCCCTTTCTCGTGGTGG + Intergenic
903936354 1:26897717-26897739 AGCCCAGACCTTGGAAAGGAGGG + Exonic
906708883 1:47914691-47914713 GGACCAGCTCTTTCTATGGAGGG - Intronic
906888134 1:49675178-49675200 AGCCCACACCCTTCTAGGGATGG - Intronic
907482336 1:54753992-54754014 AGCCCAGCCCTGTCTAGACAAGG - Intergenic
907519625 1:55014717-55014739 ATCCCAGACTTTTCTGAGGATGG - Intergenic
910419529 1:87042948-87042970 AACCCAGCCCTCTCTAATCATGG + Intronic
913116571 1:115702810-115702832 AGCCCAGCCTTTTCAGAAGAGGG - Intronic
918475663 1:184921516-184921538 AGCACAGCCCTTTGTAAAGACGG - Intronic
921007452 1:211108652-211108674 AGCCAAGACCTTACAAAGGAGGG + Intronic
922163776 1:223097805-223097827 AATCCAGCACTCTCTAAGGATGG - Intergenic
922899289 1:229123693-229123715 AGCCCAGGCCCTTCTTAGGAGGG - Intergenic
1064964415 10:21000556-21000578 AGACCAGCCTTTGCAAAGGAAGG + Intronic
1066020680 10:31297631-31297653 GGCCCAAGCCTTTCAAAGGATGG + Intergenic
1069157329 10:65047247-65047269 AGCCCAGCCCTGTTAAAGCAAGG - Intergenic
1069429183 10:68318285-68318307 ATCCCAGCCCTTTGGGAGGAAGG + Intronic
1070143874 10:73759769-73759791 AGCCCAGCCCTGAAGAAGGAGGG - Exonic
1070913386 10:80137217-80137239 AGCCCAGCCTTTTCCCTGGAGGG + Intronic
1072264348 10:93713173-93713195 AGGCCAGCCTGTTCTCAGGATGG - Intergenic
1074235234 10:111578210-111578232 AGCCCAGTCCTTCCTTAGGACGG - Intergenic
1074707756 10:116150490-116150512 AGCCCATGCCTTTCTAAGAACGG + Intronic
1075007598 10:118842107-118842129 AGCCCAGCCCCTTCCAAGTTGGG + Intergenic
1075389826 10:122084181-122084203 AGCCCAGCCGTGGCTAAAGAAGG + Exonic
1077049852 11:561660-561682 AGCCCAGCCGTTTCTAGGGCAGG + Intronic
1077364266 11:2155209-2155231 AGCCCAGCCCTTGCCAGGGATGG - Intronic
1077498054 11:2896279-2896301 AGAACAGCCCTTGCAAAGGACGG - Intronic
1078564352 11:12401636-12401658 AATCCAGCCCTTTCTAAAGTAGG - Intronic
1078797993 11:14612857-14612879 ACTCCTGCCCTTTCTAAGGAAGG - Intronic
1079099986 11:17535055-17535077 AGCCCAGGCCTGTCTCAGGGAGG - Intronic
1081759731 11:45568803-45568825 AGCCCTTCCCCTTCAAAGGATGG + Intergenic
1082170448 11:48997841-48997863 AGCCCAGATAATTCTAAGGAAGG - Intergenic
1084208211 11:67608292-67608314 AGCCCAGCCCCTCCTAAATAGGG + Intronic
1084326059 11:68400796-68400818 ATCCCAGCACTTTGGAAGGAAGG + Intronic
1085286280 11:75363782-75363804 AGTCCATCCCTTTCTGATGAAGG - Intergenic
1086695368 11:89838515-89838537 AGCCCAGATAATTCTAAGGAAGG + Intergenic
1086710785 11:90005970-90005992 AGCCCAGATAATTCTAAGGAAGG - Intergenic
1093872555 12:24309048-24309070 ATCCCAGCCCTTTTGGAGGAGGG - Intergenic
1095599850 12:44002124-44002146 AGCCCAGACCATCCTAAGAAGGG + Intronic
1097170977 12:57112447-57112469 AGCCCAGCCCCTGCTATGGGAGG - Intronic
1100189574 12:92176382-92176404 ATCCCAGCACTTTGTAAGGCAGG + Intergenic
1100564672 12:95783766-95783788 TGCCCAGCTCTTTCAAAGAATGG - Intronic
1100958826 12:99939481-99939503 ATCCCAGCACTTTCGAAGGCTGG - Intronic
1101248800 12:102911104-102911126 AGCCAAGCCCCTACCAAGGATGG - Intronic
1101330426 12:103753404-103753426 AGTGCAGCCCTTTCTTAAGATGG + Intronic
1101544911 12:105703562-105703584 ATCCCAGCCCTTGCCAAAGATGG + Intergenic
1107513429 13:41107265-41107287 AGCCCGGCCCCTTCTAAGTTGGG + Intergenic
1107887318 13:44884602-44884624 AGCTCAGCCCATGCTAAGGATGG + Intergenic
1111630057 13:90839164-90839186 TGCCCAGCCCTTTCCCTGGAGGG - Intergenic
1117136524 14:52739892-52739914 ATCCCAGCCCTTTGGAAGGCTGG - Intronic
1118320512 14:64749614-64749636 AGCCCAGACCTGGCTAAGAAGGG - Exonic
1118960517 14:70525820-70525842 AGCCCTGGGCATTCTAAGGAAGG + Intronic
1119566576 14:75634200-75634222 AGCCTAGTCCTTTCAAAAGAGGG - Intronic
1120530498 14:85625131-85625153 AGCCCTTCTCTATCTAAGGATGG - Exonic
1121065947 14:90965141-90965163 ATCCCAGCACTTTGTAAGGCAGG + Intronic
1121327702 14:93031143-93031165 ATCCAAGGCCTCTCTAAGGAAGG + Intronic
1122308274 14:100779140-100779162 AGCCCCGGGCTTTCTAAGAAAGG - Intergenic
1122728401 14:103776510-103776532 TGCCCAGCCCTGTGTGAGGAAGG + Intronic
1125892477 15:43276724-43276746 AGCTCAGCCTTTCCTGAGGAGGG + Intronic
1128087062 15:64893885-64893907 AGCACAGCCCTTTCCACTGAGGG - Intronic
1128353768 15:66909937-66909959 AGGCCTGCCCTTGCTGAGGAAGG + Intergenic
1128980802 15:72184259-72184281 TTCCCAGCCCTTTCCAAGGCAGG - Intronic
1132342151 15:101085549-101085571 GGCCCAGCCGTTTCTGGGGACGG - Intergenic
1132419519 15:101652981-101653003 AGCCCAGCCCTGCCTGGGGAAGG + Intergenic
1132642135 16:982748-982770 AGCTGAGCCCTTTCTAAGGAGGG - Intronic
1132720663 16:1314084-1314106 AGACCACCCATTTGTAAGGAGGG + Exonic
1134839297 16:17388811-17388833 ATGCCAGCCTTTTCTCAGGAGGG + Intronic
1135988439 16:27201997-27202019 AGGCCAGCCTATTCTGAGGAGGG + Intergenic
1136628287 16:31474803-31474825 AGCCCAGCTCTCACTAAAGATGG - Intronic
1138192767 16:55029971-55029993 AGCTCACTCCTTTCCAAGGAAGG + Intergenic
1138849554 16:60610583-60610605 ATCCCAGCACTTTGTAAGGCTGG + Intergenic
1139594651 16:67950614-67950636 AGCCCAGCCGCTGCTAAAGAGGG + Intronic
1139924939 16:70480883-70480905 AGCCCAGACCTTTCTACGGCTGG - Exonic
1143611496 17:8020407-8020429 AGCCCTGCCATTTCCAGGGAGGG + Intergenic
1144402652 17:14921170-14921192 AACACAGCCCCTTCTAATGATGG + Intergenic
1144654225 17:17025187-17025209 AGCCCTGTTCTTTCTCAGGAAGG - Intergenic
1146628896 17:34455889-34455911 AGCCCAGCCGGGTCTTAGGAAGG + Intergenic
1147182735 17:38696901-38696923 AGCCCAGCCCCTAGGAAGGATGG + Intergenic
1147546387 17:41405233-41405255 AGGCCAGCCCTTTCTGTAGAGGG + Intergenic
1149160583 17:53687513-53687535 AGCCCCGCCCCTTCTTGGGATGG - Intergenic
1149348375 17:55762155-55762177 AGCCCAGCCTGTTTTCAGGAGGG + Intronic
1150722368 17:67624449-67624471 ATCCCAGCACTTTGTGAGGATGG - Intronic
1151425253 17:74026933-74026955 AGTCCAGCCTGTTCTCAGGAGGG + Intergenic
1152718070 17:81909358-81909380 AGCCCAGCCCCAGCTGAGGATGG - Intronic
1153476989 18:5508019-5508041 ACCCCAGGACTTTCTCAGGAGGG + Intronic
1153812817 18:8766736-8766758 TGCCCAGCCCTCTCCCAGGAAGG - Intronic
1155514910 18:26614995-26615017 AACTCAGCACTTTCTTAGGAAGG + Intronic
1155621599 18:27786034-27786056 AGCCCTGCACTGGCTAAGGAAGG + Intergenic
1157086696 18:44587431-44587453 AGCCAGGCCCTTTGAAAGGAGGG - Intergenic
1158217690 18:55116949-55116971 AGGCCAGTCCTTTCTGAGGTTGG - Intergenic
1158883029 18:61799191-61799213 AGCCCAGGCCTTTGCAAGGCGGG + Intergenic
1160503870 18:79416722-79416744 AGCCCCTCCCTTTCTGGGGAGGG + Intronic
1161378490 19:3951944-3951966 TGCCCAGCCCCCTCTGAGGATGG - Intergenic
1162708703 19:12575357-12575379 AGCCCAGACCATTTTAAGGAGGG + Intronic
1162823078 19:13235139-13235161 GACCCACCCCTTTCTAAGGGTGG + Intronic
1163468181 19:17481757-17481779 ATCCCAGCACTTTGGAAGGAAGG - Intronic
1163782156 19:19256322-19256344 AGTCCAGCCCTGTCTGGGGAAGG + Exonic
1163868099 19:19791731-19791753 ATCCCAGCACTTTCCAAGGCAGG - Exonic
1164391033 19:27821765-27821787 AGCCCACCCCTTTCTCTGGGAGG + Intergenic
1164522136 19:28987728-28987750 ATCCCAGCACTTTGTAAGGGAGG - Intergenic
1167279505 19:48558589-48558611 GGCTCAGCCCTCCCTAAGGAAGG - Intronic
928080967 2:28311666-28311688 AGCCCAGTACTTTCAGAGGAAGG - Intronic
932337649 2:70940088-70940110 AGCCCAGCCCTTCCTCCTGAGGG + Exonic
933144256 2:78831879-78831901 AGCAGAGACTTTTCTAAGGATGG + Intergenic
935328938 2:101962276-101962298 ACCCCAGGAGTTTCTAAGGAGGG + Intergenic
937377997 2:121351022-121351044 AGCCCAGCCCTGGCTCAGGGTGG + Intronic
937919719 2:127120609-127120631 GGACCAGCGCTTTCTAAGAATGG - Intergenic
938065738 2:128281093-128281115 AGCCCAGCCCCTTGGCAGGAAGG + Intronic
938266185 2:129929828-129929850 AGCCCAGCCTTTTCCCTGGAGGG - Intergenic
938573527 2:132584003-132584025 AGACCACACCTTTCTAGGGAGGG + Intronic
938630542 2:133161777-133161799 AGCTCAGGCCTGTCCAAGGAAGG + Intronic
938956202 2:136300886-136300908 AGCCCAGCCCTTTCAATTGGAGG + Intergenic
939563568 2:143759747-143759769 AGGGAAGCCCTCTCTAAGGAAGG - Intronic
947392613 2:229654593-229654615 AGCCAAGCCCTTTCCAGAGAAGG + Intronic
948229641 2:236340716-236340738 ATCCCTGCCCTTTCTGAGGCAGG + Intronic
948790863 2:240376192-240376214 GGCACAGCCCTTTCTATGGAGGG - Intergenic
1169753184 20:9016011-9016033 AGGCCAGCCCATTCTCAGGGAGG - Intergenic
1170710918 20:18789865-18789887 AGCCCTGCCCTTTCCAGGGGAGG + Intergenic
1172374340 20:34424902-34424924 AGCTCTGCCCCTTCTAATGAAGG - Intronic
1175154007 20:56957396-56957418 AGCCCACCCCATTCTGGGGAGGG + Intergenic
1176093736 20:63330151-63330173 TGCCCAGCGCTTCCTGAGGAAGG - Intronic
1179626694 21:42653328-42653350 AGCCCAGCGCTGGCTTAGGAGGG + Intergenic
1179951772 21:44712272-44712294 AGCCCAGCCCCTCCTGGGGATGG - Intergenic
1181572695 22:23776287-23776309 AGCTCTGCCCTTTCCAGGGAGGG + Intronic
1184441099 22:44516538-44516560 AGGCCAGCCTATTCTTAGGAAGG - Intergenic
1185065769 22:48631064-48631086 CGCCCTGTCCTTTCTAAGGACGG + Intronic
949525763 3:4901629-4901651 ATCCCAGCACTTTCTGAGGCGGG + Intergenic
951941244 3:28081124-28081146 ATCCCAGGCCTTTCTGAGTACGG - Intergenic
952942790 3:38456034-38456056 CGCCCTGCCCTGCCTAAGGAGGG - Intronic
953589161 3:44235026-44235048 AGGCCAGCCTCTTCTCAGGAGGG - Intergenic
953606288 3:44415286-44415308 AGCCCAGCCCTGGCTCAGGAGGG - Intergenic
954130031 3:48556218-48556240 AGCCCAGAACTTTCAAAGGTGGG - Intronic
955544463 3:60013352-60013374 ACCCCAGCCCTTTCCATAGAGGG + Intronic
956002239 3:64741709-64741731 ATCCCAGCACTTTCTTTGGAAGG - Intergenic
961499774 3:127324000-127324022 AGCCCTGCACTTTCCAGGGAAGG - Intergenic
965087113 3:164113617-164113639 AGCCCCGCCCTTTCTTAGTTCGG + Intergenic
966154259 3:176899018-176899040 ATCCCAGCCCTTTGGGAGGACGG + Intergenic
968662473 4:1804454-1804476 AGCCCAGGCCTTTCTTGGGGGGG - Exonic
969240740 4:5895450-5895472 TGCCCAGCCCTTTCTCACAATGG - Intergenic
969299703 4:6290724-6290746 AGCCCAGCCCTTTCTAAGGAAGG - Intronic
970743808 4:19270302-19270324 AACCCAGCACTGTCTAAAGATGG + Intergenic
971253612 4:24993755-24993777 AGCCTGGCTCTTTCTAAGCATGG - Intergenic
977100981 4:92814749-92814771 AGCCCAGCACTTCCTGTGGATGG - Intronic
982099284 4:151952626-151952648 ACCTCAGCCCCTTCCAAGGAAGG + Intergenic
982779507 4:159476223-159476245 ATCCCAGCACTTTCCAAGAAGGG - Intergenic
989398690 5:40985849-40985871 AGCCCACCCCTTTCAAACAACGG - Intergenic
990088921 5:52015968-52015990 AGCCCAGCCCACTCTCAGAATGG + Intronic
991350583 5:65716777-65716799 AGCCCAGACCTTTCTTCTGAAGG - Intronic
992351478 5:75933482-75933504 AACTCAGGCCTTTCTTAGGAAGG - Intergenic
992937805 5:81727964-81727986 TCCCCAGCCCTTTCTATGGCTGG - Intronic
995528804 5:113072807-113072829 AGCCCAGCGCTTTCTTCTGAGGG + Intronic
997203491 5:132027005-132027027 ACCCCAGCCCTTCCCAAGGTGGG + Intergenic
997612968 5:135228044-135228066 AGCACAGTGCTTTCCAAGGATGG - Intronic
997902438 5:137779230-137779252 AGTCCAGCCCTCTTGAAGGAAGG + Intergenic
999114211 5:149148357-149148379 AGCCCAGGCCTTTCCAAGCCTGG - Intronic
1001512121 5:172331284-172331306 AGCCCGGCCATTTCTCAGGGTGG + Intronic
1002719103 5:181247045-181247067 AGCCCGGCCCTTTCTAGCGGGGG + Intronic
1005043575 6:21620801-21620823 AGCCCGGCCCTTTCTGAGTTGGG - Intergenic
1005204500 6:23386330-23386352 AACCAAGCCCTTCCTAAGTAGGG + Intergenic
1006115957 6:31776367-31776389 GTCCCGGACCTTTCTAAGGAGGG + Intronic
1006753652 6:36396291-36396313 AGCCCAGCCCCTTCTGAGTTGGG + Intronic
1007017824 6:38487280-38487302 AGCCCACCCCCTCCTAAGGTAGG - Intronic
1007170734 6:39861520-39861542 AGCATACCCCTTTCTAGGGAGGG - Intronic
1007252766 6:40507430-40507452 AGCTCAGCCCTCTCTCAGCAAGG - Intronic
1007653413 6:43437348-43437370 AGCCCAGTCCCTTCTAGAGAAGG + Intronic
1011576365 6:88805167-88805189 ATCCCAGCCCCTCCAAAGGAGGG + Intronic
1017531737 6:155299647-155299669 TGCCCAGCACTTTATAGGGATGG + Intronic
1018765100 6:166926718-166926740 AGACCAGCCCCTTCTCAGCAGGG - Intronic
1019406880 7:888646-888668 GGGCCAGCCCCTTCTGAGGAAGG - Intronic
1021479797 7:21103611-21103633 AGTCCAGCCCTTACTCAGAAGGG - Intergenic
1021931419 7:25584997-25585019 TGCCCTGCCCTTTCAAAGAAAGG - Intergenic
1024477768 7:49831988-49832010 AGGCCAGCCTGTTCTCAGGAGGG + Intronic
1032125655 7:129190512-129190534 ACCCCAGCCCTGTCAAAAGAGGG - Intronic
1034875423 7:154720747-154720769 TGCCCACCCCTTTTTCAGGATGG - Intronic
1036793069 8:11736155-11736177 ATCCCAGCCCTTTGTGAGGTCGG - Intronic
1039607654 8:38895721-38895743 AGCTCATCTCTTACTAAGGAGGG - Intergenic
1039906740 8:41791857-41791879 GGCCCAGAGCTTTCTCAGGAAGG + Intronic
1040476532 8:47783023-47783045 ATCCCAGCACTTTGGAAGGATGG + Intronic
1040582433 8:48708438-48708460 ATGCCAGCCCTTTCAGAGGAGGG + Intergenic
1041356466 8:57005875-57005897 AGCCCAGCTCTTTCTAGGTCTGG + Intergenic
1047599227 8:126409597-126409619 ATCCCAGCACTTTGGAAGGAGGG - Intergenic
1049283453 8:141762238-141762260 AGTCCAGCCCCTTCTGAGGCTGG + Intergenic
1053002461 9:34584836-34584858 GGTCCAGACCTTTCCAAGGAAGG + Intronic
1056768538 9:89460220-89460242 AGGCCAGCTGTTTCTCAGGAGGG - Intronic
1056855868 9:90129201-90129223 AGCCCAGCCCTTCTTGGGGAAGG - Intergenic
1060156685 9:121325269-121325291 AGCCCACCCCTGTCCCAGGAGGG + Intronic
1062374736 9:136256804-136256826 AGCCCGGCCCTTCCTTAGCAGGG - Intergenic
1185516325 X:701730-701752 TGCCCAGCCCTAGCCAAGGAAGG + Intergenic
1186372372 X:8960324-8960346 AGCCCAGCCTGGTCTTAGGAGGG - Intergenic
1186625211 X:11286115-11286137 ATTCCAGTCCTTTATAAGGAAGG + Intronic
1186681397 X:11877885-11877907 AGCCCACCTTTTCCTAAGGATGG - Intergenic
1190381814 X:49846639-49846661 AACCCACAACTTTCTAAGGAGGG + Intergenic
1191790529 X:64967629-64967651 AGCCCAGGGAATTCTAAGGAGGG - Intronic
1197083533 X:122446466-122446488 TACCAAGCCCTGTCTAAGGAGGG + Intergenic
1197778941 X:130140456-130140478 AGTCCAGCCTTCTCTATGGAAGG - Intronic