ID: 969300407

View in Genome Browser
Species Human (GRCh38)
Location 4:6293974-6293996
Sequence CACTTGTGTGGGCCCCCCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969300400_969300407 24 Left 969300400 4:6293927-6293949 CCTCACAGCTCAGTCTACAGTGA 0: 1
1: 0
2: 2
3: 19
4: 234
Right 969300407 4:6293974-6293996 CACTTGTGTGGGCCCCCCCAAGG No data
969300402_969300407 -9 Left 969300402 4:6293960-6293982 CCTGTGCTACCTGCCACTTGTGT 0: 1
1: 0
2: 0
3: 11
4: 165
Right 969300407 4:6293974-6293996 CACTTGTGTGGGCCCCCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969300407 Original CRISPR CACTTGTGTGGGCCCCCCCA AGG Intronic
No off target data available for this crispr