ID: 969301550

View in Genome Browser
Species Human (GRCh38)
Location 4:6300201-6300223
Sequence ACCTCCCTGAGCCTCCATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 243}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969301550_969301551 4 Left 969301550 4:6300201-6300223 CCTTCATGGAGGCTCAGGGAGGT 0: 1
1: 0
2: 3
3: 27
4: 243
Right 969301551 4:6300228-6300250 TCCTTGCTGTAGTGCAGAGCTGG 0: 1
1: 0
2: 1
3: 10
4: 165
969301550_969301554 29 Left 969301550 4:6300201-6300223 CCTTCATGGAGGCTCAGGGAGGT 0: 1
1: 0
2: 3
3: 27
4: 243
Right 969301554 4:6300253-6300275 CACAAAACCAGCTCCCAGACAGG 0: 1
1: 1
2: 4
3: 14
4: 186
969301550_969301553 5 Left 969301550 4:6300201-6300223 CCTTCATGGAGGCTCAGGGAGGT 0: 1
1: 0
2: 3
3: 27
4: 243
Right 969301553 4:6300229-6300251 CCTTGCTGTAGTGCAGAGCTGGG 0: 1
1: 1
2: 1
3: 17
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969301550 Original CRISPR ACCTCCCTGAGCCTCCATGA AGG (reversed) Intronic
900211046 1:1456030-1456052 AGCACCCTGAGCCTACACGAGGG - Intronic
900216872 1:1486349-1486371 AGCACCCTGAGCCTACACGAGGG - Intronic
900223953 1:1524078-1524100 AGCACCCTGAGCCTACACGAGGG - Intronic
900376931 1:2359165-2359187 AGCTCCCGGGGCCTCCATGGTGG + Intronic
900470840 1:2854224-2854246 AGCCCCATGGGCCTCCATGAAGG + Intergenic
902740444 1:18434208-18434230 ACCTCCCAGAGCAGCCAGGAAGG + Intergenic
903063567 1:20686017-20686039 ACCTCCCCGGGCCTCCATGTGGG - Intronic
903184346 1:21620742-21620764 AGCCCCCAGAGCCTCCAGGATGG + Intronic
903458827 1:23506910-23506932 ACCTCCCTCTTCCTCCCTGAAGG + Exonic
904080389 1:27868936-27868958 ACATCCCTGAGCCTGCAGAAGGG - Intergenic
904463193 1:30692594-30692616 AGCTCCCTGATCCCCCAGGATGG - Intergenic
904874192 1:33641468-33641490 ACCTCCCTGTGACTCCATTTTGG + Intronic
904906007 1:33897750-33897772 ACCTCACTGAGCGTCTTTGAGGG + Intronic
905010092 1:34741498-34741520 TCATCCCTGAGCCGCCAGGAAGG - Intronic
905010121 1:34741630-34741652 TCATCCCTGAGCCGCCAGGAAGG - Intronic
905737571 1:40340438-40340460 ATCTCCTTGAGCCTCCAGAAAGG - Intergenic
907761722 1:57367975-57367997 GCCTTCCTGGGCCTCCAAGAGGG - Intronic
909979551 1:82082470-82082492 ACCTCAATGAGCCTGCATAAAGG - Intergenic
915441337 1:155947364-155947386 ATCTCCCAGGGCTTCCATGAAGG + Exonic
915622222 1:157092766-157092788 GCCTCCCTTTGCCTCCATCATGG + Exonic
917064189 1:171073897-171073919 ACCTGCCTCAGCCTCCCAGAGGG - Intergenic
917541619 1:175920084-175920106 ACCTGCCTAAAGCTCCATGAAGG + Intergenic
917732680 1:177891820-177891842 ACCTCCCTGAGCATAGATCATGG + Intergenic
920499302 1:206476420-206476442 GCCCCCCAGAGCCCCCATGAGGG + Intronic
921122104 1:212146214-212146236 ACCTCCCTTCTCCTCCATCAAGG - Intergenic
921217676 1:212951202-212951224 GCCTCCCTGAGAATCGATGACGG - Intronic
921936099 1:220798631-220798653 CTCTCCCTGGGCTTCCATGAAGG + Intronic
1063371820 10:5527155-5527177 ACCAACCTGTGCCTCCATCATGG + Intergenic
1065711843 10:28525635-28525657 TCCTGCCTCAGCCTCCCTGAGGG + Intergenic
1068229121 10:54148273-54148295 TCCTCCCTCAGCATCCATGTGGG + Intronic
1068831114 10:61495970-61495992 CCCTCCCAGAGCCTCCAGAAAGG + Intergenic
1069271362 10:66532215-66532237 ACCTCCCTCAGCCTCCTAAAAGG - Intronic
1069854598 10:71432949-71432971 ACTGTCCTGAGCCTCCCTGAAGG - Intronic
1070226709 10:74515709-74515731 ACCTCCCTGAGCCTCTGAGAAGG - Intronic
1071980547 10:91000745-91000767 GCCTCCCTGATCCTCCATCAGGG + Intergenic
1072048557 10:91681342-91681364 AGCTCCCTCAGCCTCCAAGCTGG - Intergenic
1072790111 10:98311642-98311664 ACCTGCCTTAGCCTCCAAAAGGG - Intergenic
1076166266 10:128285072-128285094 ACCACCCTGAGCTTCTTTGAAGG - Intergenic
1076491803 10:130866814-130866836 ACCATCCTGAGCCTTCAGGAAGG + Intergenic
1076719044 10:132384947-132384969 AGAGCCCTGAGCCTCCATGGAGG - Intergenic
1076867838 10:133176797-133176819 ACCTCCCTCAGCCTAGATGCAGG - Intronic
1077324913 11:1959497-1959519 CCCTCCCTGAGCCTCCAGGCAGG - Intronic
1077396683 11:2327293-2327315 ACCCACGTGAGCCTCCATGGGGG + Intergenic
1079078402 11:17397454-17397476 CCCTCCCTGTGCCTCCAGGGAGG - Intronic
1083609729 11:63999139-63999161 ACAGCCGTGAGCCTCCGTGAAGG - Intronic
1083628940 11:64085991-64086013 CCCTCCCTGAGCCTCCTTTGAGG - Intronic
1084207017 11:67601124-67601146 ACCTCCCTGGTCCTCCGTGATGG + Intergenic
1085312395 11:75524396-75524418 ACCTTCCTGAGCATCCTTCAAGG - Intronic
1085912433 11:80843910-80843932 ACTTCTCTGAGCCTCCAAAATGG - Intergenic
1089321045 11:117626903-117626925 AGCACCCTGATCCTCCAGGAAGG + Intronic
1090350885 11:126107080-126107102 ACATCCCAGAGCCTCCAGAAAGG + Intergenic
1090680917 11:129056836-129056858 AGCTCACTCAGCCTCCATCATGG + Intronic
1202807895 11_KI270721v1_random:14676-14698 CCCTCCCTGAGCCTCCAGGCAGG - Intergenic
1094381064 12:29843449-29843471 ACCTCCAAGAACCTCCATCAGGG - Intergenic
1097152423 12:56988708-56988730 AAATCCCTCAGCCTTCATGAAGG + Intergenic
1097697839 12:62791673-62791695 ACCTGCCTGAGCCTCCCAAAGGG - Intronic
1104648980 12:130517487-130517509 GGTTGCCTGAGCCTCCATGATGG - Intronic
1106036793 13:26051304-26051326 CCCTCCCTGAGCATCCCCGAAGG + Intergenic
1109971106 13:69770118-69770140 ACCCCCTTGGGACTCCATGATGG + Intronic
1112308119 13:98293721-98293743 ACCTCCCTGAGCCTAGAGAAAGG + Intronic
1113365356 13:109670536-109670558 ACCTCCCTCAGCCTCCTAGTAGG + Intergenic
1113669575 13:112166359-112166381 CCCTCCCACCGCCTCCATGATGG - Intergenic
1113675592 13:112204873-112204895 ATCTCCATGAGGATCCATGAGGG - Intergenic
1113941667 13:114021615-114021637 GCCTCCCAGAGTCTCCATCAAGG + Intronic
1114377471 14:22163615-22163637 CCATCCCTGAGCGTCCAGGAAGG + Intergenic
1118061356 14:62141258-62141280 ACCTCCTTGACCTTCCATGTGGG + Intergenic
1119045583 14:71315790-71315812 ACCTACCTCAGCCTCCCAGAGGG + Intergenic
1120031631 14:79648109-79648131 ACCTCTCTGAACCTCAATAAAGG - Intronic
1121328343 14:93034604-93034626 ACCTCCCACATCCTGCATGAAGG + Intronic
1121448868 14:93995470-93995492 TTGTCCCTGAGCCTCCATGGAGG + Intergenic
1122941663 14:104984257-104984279 AGCTCCCTGGGCCTCAAGGACGG + Intergenic
1123149726 14:106169399-106169421 ACTTTCCTCAGTCTCCATGAAGG - Intergenic
1202909012 14_GL000194v1_random:100205-100227 ACTCCCCTGAGACCCCATGATGG + Intergenic
1202884246 14_KI270722v1_random:89024-89046 ACTCCCCTGAGACCCCATGATGG - Intergenic
1124337140 15:28865986-28866008 ACAGGCCTGAGCCACCATGACGG + Intergenic
1124418083 15:29490930-29490952 TCCTGCCTGAGCCTCCCAGAGGG - Intronic
1128694025 15:69747059-69747081 CCCTCCATGAGCCTCCAGGCTGG + Intergenic
1129266337 15:74395497-74395519 AACACTCTGAGCCTTCATGAAGG + Intergenic
1129604339 15:77017511-77017533 ACCTCCCTGGATCTCCGTGAGGG + Intronic
1129725298 15:77898544-77898566 ACCACCCTCAGGCACCATGAGGG - Intergenic
1129731615 15:77935644-77935666 ACCTCCCACAGCCTCTCTGATGG - Intergenic
1129906260 15:79189726-79189748 ATCTCCCTGATCATCCATGTGGG - Intergenic
1130025026 15:80263433-80263455 ACCTCCATCAGCCTCCATCAGGG + Intergenic
1130332404 15:82932673-82932695 ACACCCCTGAGCCTCCACAAGGG + Intronic
1130864791 15:87923452-87923474 AGCTCCATGAGCCTGAATGATGG + Intronic
1130894154 15:88157671-88157693 ACCTCCCTTGGCCTACACGAGGG + Intronic
1131118908 15:89811002-89811024 CCCTCCAAGTGCCTCCATGAGGG + Intronic
1132455988 16:23190-23212 ACCCGCCCAAGCCTCCATGAAGG - Intergenic
1132675249 16:1118707-1118729 GCCTCCCTGTGCCTCCCTGGAGG - Intergenic
1132708697 16:1257143-1257165 CCCTCCCTGAGCCGCCCTGAGGG - Intronic
1132853635 16:2035415-2035437 ACCTCCCTGTGTGTCCCTGAGGG - Intronic
1133002813 16:2859696-2859718 GGCTCCCGAAGCCTCCATGAGGG - Intergenic
1133742733 16:8663564-8663586 ACCTCCCCCAGCCTCCAGGTGGG - Intergenic
1134322140 16:13173859-13173881 CCCTCCCTGAACCTCCAAGCTGG - Intronic
1135265625 16:21023309-21023331 TCTTCCCTGACCCTCCATGAGGG - Intronic
1135389218 16:22075129-22075151 CCCTCACTGAGCCTGCATGCTGG - Intronic
1136248866 16:28990543-28990565 ACCTGGCTGAGCCCCCATGGAGG - Exonic
1136680331 16:31957399-31957421 ACATTCCTCAGTCTCCATGAAGG + Intergenic
1136780674 16:32898944-32898966 ACCTTCCTCAGTCTCCATGAAGG + Intergenic
1136889738 16:33960726-33960748 ACCTTCCTCAGTCTCCATGAAGG - Intergenic
1137893393 16:52185416-52185438 CCCTCACTGAGCTTCCATGGTGG + Intergenic
1138217849 16:55220708-55220730 AACTCCCTGAGACTCCCTGATGG + Intergenic
1138341982 16:56295965-56295987 ACCTTCCAGAGCCTCTATTAGGG + Intronic
1139275090 16:65719989-65720011 ACCTCACTGACACTCCATGATGG + Intergenic
1139442903 16:66977659-66977681 TCTTCCCTGAGGCTCCCTGAAGG + Intergenic
1140130639 16:72157695-72157717 ATCTCCCTGAGCTTTTATGAAGG + Intronic
1140995398 16:80253985-80254007 ACTTCCCCCAGCCTCCGTGATGG - Intergenic
1141058040 16:80836856-80836878 ACCTGCCTCAGCCTCCATAAAGG + Intergenic
1203083329 16_KI270728v1_random:1162973-1162995 ACCTTCCTCAGTCTCCATGAAGG + Intergenic
1142688165 17:1589862-1589884 ACCTGCCTCAGCCTCCAAAAGGG + Intronic
1142747259 17:1966089-1966111 ACCTCCCTGCCCCTCTGTGATGG + Intronic
1145242600 17:21248561-21248583 ACCACCCGCAGCCCCCATGATGG + Intronic
1145764678 17:27450247-27450269 ACCTCTCTCAGCCACCCTGAGGG + Intergenic
1146630305 17:34464784-34464806 TCCTCCCAGAGCCTCCATGAGGG + Intergenic
1150698131 17:67423612-67423634 TCCTGCCTCAGCCTCCCTGAAGG + Intronic
1152538210 17:80962411-80962433 TCCTCCCGGAGGCCCCATGAGGG - Intronic
1152623765 17:81379247-81379269 ACATCCCTGACCCTCCCTCAGGG + Intergenic
1152890664 17:82879965-82879987 GCCCCCCTGAGCCTCCAGAAAGG - Intronic
1157131792 18:45014148-45014170 ACCTCCCTCAGCCTACATTCTGG - Intronic
1159737236 18:72114989-72115011 ACCTCTCTCAGCCTTCATGGGGG - Intergenic
1160797422 19:952519-952541 GCCTGACTGAGCCTCCAGGAGGG - Intronic
1161419352 19:4167767-4167789 ACCTCCCAGAGACTCTGTGAGGG + Intronic
1161494795 19:4581116-4581138 CGCTCCCTGAGCCTCCATTATGG - Intergenic
1161628274 19:5339243-5339265 ACCTCCCAGAGCCTCATTGGGGG - Intronic
1161701444 19:5798112-5798134 CCCTCCCTCAGCCTCAGTGAAGG - Intergenic
1162322484 19:9978467-9978489 GCCTGCCTCAGCCTCCATCATGG + Intronic
1164747395 19:30626612-30626634 TCCTTCCTGAGCCTCCAAGTGGG - Intronic
1164866306 19:31607117-31607139 AGCTCCCTGAGGCCCCTTGATGG + Intergenic
1164876438 19:31693976-31693998 ACATCCCTGAGCTCCCATGAGGG + Intergenic
1164883610 19:31758827-31758849 CCTTCCCTCAGCCTCCCTGATGG + Intergenic
1164988479 19:32666977-32666999 ACCTCTCTGAGCCTCCATCTGGG + Intronic
1166093749 19:40526907-40526929 AAGACCCTGAGTCTCCATGAGGG - Intronic
1166374920 19:42322342-42322364 AACTCCCTGAGCCTCGCTGTGGG - Intronic
1167521424 19:49958366-49958388 AGCTCCCTGAGCCTCCATGGAGG - Exonic
1167523952 19:49972353-49972375 AGCTCCCTGATCCTCCAAGGGGG + Intergenic
1167756113 19:51414904-51414926 AGCTCCCTGAGCCTCCATGGAGG - Exonic
1167784697 19:51627542-51627564 AGCTCCCTGATCCTCCACGGGGG - Exonic
1168211414 19:54893456-54893478 ACCTCCCTGGCCTTCCAAGAAGG - Intergenic
1202659663 1_KI270708v1_random:56154-56176 ACTCCCCTGAGACCCCATGATGG - Intergenic
924994305 2:342786-342808 ACCTCCCTGACCCACCATCCTGG - Intergenic
925267480 2:2576262-2576284 ACAGGCCTGAACCTCCATGAGGG + Intergenic
925422060 2:3720322-3720344 ACCTCACAGAGACTCCATGCTGG - Intronic
927517448 2:23680588-23680610 ACCCCACCGAGCCTCCATGCAGG + Intronic
929206330 2:39298718-39298740 ACCTGCCTCAGCCTCCCAGAAGG - Intronic
930094879 2:47559341-47559363 ACCTCCCAGGGCCTCCCTGCTGG - Intronic
930759560 2:55019050-55019072 ATGTCCCTGAGCCTACCTGAAGG + Intronic
931088895 2:58864657-58864679 TGCTCCATGAGCCCCCATGACGG - Intergenic
932182613 2:69662259-69662281 GAAACCCTGAGCCTCCATGAAGG - Intronic
932190574 2:69738684-69738706 GAAACCCTGAGCCTCCATGAAGG + Intronic
932457260 2:71857650-71857672 AGCTCCCTAAGTCTCCTTGAAGG - Intergenic
933006373 2:77000825-77000847 CAATCCCTGAGCCTCCATGGTGG + Intronic
933836795 2:86252325-86252347 ACCTCCTGGAGCCTCCTGGAAGG - Intronic
933987218 2:87602180-87602202 ACCCCACTGAGCCTCCCAGATGG + Intergenic
934523529 2:95034608-95034630 ACCTCCCCCAGCCTCCATCCTGG + Intronic
935999986 2:108817715-108817737 TCCTCCCTTAGCCTCCAGAAAGG + Intronic
936306623 2:111348628-111348650 ACCCCACTGAGCCTCCCAGATGG - Intergenic
939095472 2:137828680-137828702 CCCTCCCTCTGCCTGCATGATGG + Intergenic
942539630 2:177002205-177002227 CTCCCCCTGAGCCTCCAGGAAGG - Intergenic
945881993 2:215334439-215334461 ACCTGCCTCAGCCTCCCAGAGGG + Intronic
948438444 2:237969367-237969389 GCTTCCCTGAGCCTCCTTCAGGG + Intronic
1168813978 20:724100-724122 ACCTGCGTGACCCTGCATGAAGG + Intergenic
1169201603 20:3712860-3712882 ACCTCCCCCAGCCTCCCTAAGGG - Intergenic
1169769655 20:9187083-9187105 TCCTGCCTCAGCCTCCCTGAGGG + Intronic
1176628372 21:9114917-9114939 ACTCCCCTGAGACCCCATGATGG + Intergenic
1177169193 21:17637370-17637392 ACCTGCCTGGTCCTCCCTGAAGG + Intergenic
1178664390 21:34533926-34533948 GCCACCCTGAGCCTCCTTGCTGG - Intronic
1178766192 21:35453226-35453248 ACCTGCCTCAGCCTCCAAAAGGG - Intronic
1179485841 21:41710348-41710370 ACTTCCCAGAGCCTCCTTCAGGG - Intergenic
1180327132 22:11439716-11439738 ACTCCCCTGAGACCCCATGATGG - Intergenic
1180693383 22:17736751-17736773 AGCTGCCTCAACCTCCATGACGG + Intronic
1181436999 22:22916942-22916964 ACCTTCCTGATCCTCCCAGAAGG - Intergenic
1181534030 22:23532592-23532614 ACCTCGCTGAGCCTTCACGCAGG - Intergenic
1181908065 22:26215528-26215550 CCCTTCCTGAGTCTCCATTAGGG - Intronic
1182368897 22:29797221-29797243 AGCTTCCTCAGCCTCCAAGATGG + Intronic
1182958904 22:34453604-34453626 ACCTCTCTGAGCCTGCATCCTGG - Intergenic
1183236661 22:36623936-36623958 ACTTCTCTGGGCCTCCAAGACGG + Intronic
1183786339 22:40031143-40031165 ACCTCCCTGAGCTTTTATGAAGG + Exonic
1185017086 22:48351121-48351143 ACCTCCTAGAGACACCATGAAGG - Intergenic
1185280168 22:49966554-49966576 ACCGCCCTGAGCCTCTCTCAGGG + Intergenic
950664901 3:14489480-14489502 TCCTCTGTGAGCCTCCATGTGGG - Exonic
950854059 3:16088982-16089004 TCTTCTCTGAGCCTTCATGAAGG - Intergenic
951633099 3:24742494-24742516 TCCTGCCTCAGCCTCCATGTTGG - Intergenic
951803579 3:26623184-26623206 TCCTCCCTGAGCCACGAGGATGG + Exonic
953468436 3:43146067-43146089 ACCTCCCGAAGACTCCATCATGG + Intergenic
954118093 3:48478316-48478338 ACCTGCCTGGGCCTACAGGATGG + Intronic
954599038 3:51853376-51853398 ACATACCTGGGGCTCCATGAGGG - Intergenic
960122303 3:113959074-113959096 ACCTCACAGAGCCGTCATGAGGG + Intronic
961682628 3:128609036-128609058 ACCTCCCTCAGCCTCCCAAAGGG + Intergenic
962154641 3:132933167-132933189 AATTCCCTGGGCTTCCATGAGGG + Intergenic
963771742 3:149393146-149393168 TCCTCCTTGAGCCTATATGATGG - Intergenic
963844911 3:150145322-150145344 TCCACCCTAAGCCTCCAAGATGG + Intergenic
964448562 3:156786973-156786995 ACCTGCCTCAGCCTCCCAGAGGG + Intergenic
965681200 3:171253344-171253366 ACCTCACTGAGGCTGCAAGAGGG - Intronic
965971481 3:174561474-174561496 ACCGCCATGAGCCACCATGCCGG + Intronic
969301550 4:6300201-6300223 ACCTCCCTGAGCCTCCATGAAGG - Intronic
969326815 4:6448841-6448863 ACCTCCGTGAGCCTTCGTGCAGG - Intronic
969877953 4:10149866-10149888 ACCTTCCTGATACTCCATGCAGG - Intergenic
970504489 4:16713648-16713670 ACCTCTCTGTGCCCCCATTAGGG - Intronic
970827479 4:20293826-20293848 ACATCCCTGAGCCACAGTGAAGG - Intronic
972671322 4:41215807-41215829 ACCTCACTGAGTCTGCATGAGGG - Intronic
974070152 4:57115820-57115842 ACCAACCTCAGCCTCCCTGATGG + Intergenic
980994931 4:139771015-139771037 ACCTCAAAGACCCTCCATGAAGG + Intronic
981815174 4:148822754-148822776 ATCTCATTGAGCCTTCATGATGG + Intergenic
985663309 5:1168268-1168290 ACCTTCCTGTGCCTGCATGTGGG + Intergenic
985696457 5:1343599-1343621 CCCTCTCTCTGCCTCCATGAAGG - Intronic
986060916 5:4189030-4189052 AGCTCCCTGACTGTCCATGAGGG - Intergenic
986658863 5:10041346-10041368 TCCTCTCAGAGCCTCCAGGAAGG - Intergenic
990808492 5:59694953-59694975 ACCTCTCTGTGCCTCCTTGGTGG - Intronic
995904280 5:117104921-117104943 ATCTCCCTGAGGGTTCATGAAGG - Intergenic
997383686 5:133455936-133455958 ACCTCCAGGAGCCTCCCTGTGGG - Intronic
1003831255 6:10014584-10014606 ACCTCTCTGTGCCTGCATCAGGG + Intronic
1007257868 6:40541293-40541315 ACCTCCCTGACCATTCATGTGGG + Intronic
1008572486 6:52829241-52829263 ACCCACCGGAGCCTCCCTGATGG - Intergenic
1017284478 6:152658452-152658474 ACCTGCCTCAGCCTCCCTGAGGG - Intergenic
1019817022 7:3208825-3208847 ACCTTCCTGAGCCTGCTAGAGGG + Intergenic
1020112336 7:5454658-5454680 ACCTCTCTGAGCCTCACTCAGGG - Intronic
1021334640 7:19384580-19384602 ACCTCACTGAGCCACCCTCAAGG + Intergenic
1022191521 7:28020887-28020909 TCCTCCCTTAGACTTCATGAGGG - Intronic
1022209594 7:28195521-28195543 AGCTCCCTTTCCCTCCATGACGG - Intergenic
1022256671 7:28665195-28665217 ACCTCCTTGGCCCTCCCTGATGG - Intronic
1022470506 7:30679204-30679226 TCCTCCCTGATCCTCCAGGCCGG + Intronic
1024758450 7:52565095-52565117 TCCTGCCTTAGCCTCCATGTTGG + Intergenic
1024823888 7:53366505-53366527 GTCTCCCTGGGCCTCCCTGAGGG - Intergenic
1025637449 7:63335389-63335411 CCCTCCCTGGACCTCCAAGAAGG - Intergenic
1025645248 7:63412710-63412732 CCCTCCCTGGACCTCCAAGAAGG + Intergenic
1025715791 7:63953885-63953907 CCCTCCCTGGACCTCCAAGAGGG + Intergenic
1026827987 7:73595979-73596001 ACCTGCCTGAGCCCCCCTGGTGG - Intronic
1027868301 7:83674741-83674763 AGCTCCCAGAGCTTCCAAGATGG + Intergenic
1030682326 7:112446986-112447008 ACCTCCCAGATCCTCCATGTAGG - Intronic
1031729239 7:125277439-125277461 ACCTGCCTCAGCCTCCAAAAGGG - Intergenic
1034201480 7:149285507-149285529 ACGTCCCCAAGCCTCCATGAGGG - Intronic
1035968988 8:4227172-4227194 ACGTCCCTCAGCAACCATGAGGG - Intronic
1036432919 8:8706369-8706391 ACCTCCCGCAGCCTCCACGGTGG - Intergenic
1036571037 8:9980042-9980064 AGAACCCAGAGCCTCCATGATGG + Intergenic
1036645538 8:10609639-10609661 GCCGCCCGGAGCCACCATGATGG - Exonic
1038399598 8:27272915-27272937 ACCTCCCTCAGAGTCCATGAAGG - Intergenic
1038615599 8:29090961-29090983 ACCTGCCTTGGCCTCCCTGAGGG + Intronic
1038653691 8:29429096-29429118 ACCTCCTAGAGCCTCCAGCAGGG - Intergenic
1038724241 8:30066033-30066055 AGCTGCCCGAGCCTCCATGAAGG + Exonic
1039519783 8:38160462-38160484 GCTTCCCTGAGCGTCCATAATGG + Intergenic
1040829368 8:51660723-51660745 GTCTCCCTGAGCTACCATGAAGG + Intronic
1042546309 8:69954577-69954599 ACCTTTCTGAGGCTCCATGTAGG - Intergenic
1043590495 8:81827133-81827155 ATCTCCTTGATCCTCCAAGATGG - Intronic
1045000497 8:97874091-97874113 ACCTCCCTGAGATTCCCAGACGG + Intronic
1046368009 8:113261507-113261529 ACCTCCCTTAGCCTCTGTGAGGG + Intronic
1047424236 8:124730688-124730710 TCCTGCCTCAGCCTCCATGTTGG + Intergenic
1047843968 8:128786004-128786026 ACCTCACTAAGACCCCATGAAGG + Intergenic
1048330704 8:133468887-133468909 ACTCCCCTGAACCTCCATGGAGG + Intronic
1049022728 8:139968803-139968825 ACCTCTCTGAGCCTCAGTGTTGG - Intronic
1049171581 8:141164677-141164699 AGCTCCCGGAGCCTGCATCAGGG - Intronic
1049255335 8:141610707-141610729 TCCTCCCGGAGCCTCCAGGTTGG + Intergenic
1049572578 8:143376162-143376184 ACCTCTCTGTGCCTGCATCAGGG - Intronic
1049743267 8:144251033-144251055 ACCTCCGGGAGACTCCATGCTGG + Intronic
1053065899 9:35068995-35069017 GCCTCCCTGAGCCTCAAGGGAGG - Intronic
1056470696 9:86902716-86902738 ACCTCCCCGGGCCTCCCTAAGGG + Intergenic
1057181619 9:93033746-93033768 ACCTCACTGAGCCTCTAGGAGGG - Intronic
1060223308 9:121775594-121775616 ACATCCCTGCTCCTCCCTGATGG + Intronic
1060892195 9:127195988-127196010 ATCTCCCTGAGTCCCCATGCAGG + Intronic
1061204679 9:129156150-129156172 TCCTCCTTAAACCTCCATGAGGG - Intergenic
1062118763 9:134822792-134822814 ACCACCCTGTGTCTCCACGAGGG + Intronic
1062126144 9:134864086-134864108 ACCTCCCTGGGCCAGCATGCAGG - Intergenic
1203751217 Un_GL000218v1:82600-82622 ACTCCCCTGAGACCCCATGATGG + Intergenic
1203482769 Un_GL000224v1:21754-21776 ACTCCCCTGAGACCCCATGATGG - Intergenic
1187325848 X:18287064-18287086 TCCTTCCTGAGTCTCCTTGATGG + Intronic
1188379044 X:29468857-29468879 ACTTCCCTAAGCTTCCATCAGGG + Intronic
1189492929 X:41483715-41483737 ACCTCCATGGGCTTCCCTGAAGG - Intergenic
1192704867 X:73518878-73518900 ACCTCAGAGAGCCTCCATTAGGG - Intergenic
1193317065 X:80076857-80076879 GCCTCCCTGAGAGCCCATGATGG - Intergenic
1193415320 X:81215507-81215529 TCCTCCCTGAGCCAGAATGAAGG + Intronic
1196840616 X:119855682-119855704 ATCTCCTAGAGCCTCCAGGAAGG - Intergenic
1200400381 X:156016535-156016557 ACCCGCCCAAGCCTCCATGAAGG + Intergenic
1201164870 Y:11200208-11200230 ACTCCCCTGAGACCCCATGATGG + Intergenic
1201304300 Y:12537436-12537458 ACCTCCGTGAGCCTCCTGCACGG + Intergenic
1202100550 Y:21303632-21303654 ACCAGCCTGAGCCTCCTCGACGG - Intergenic