ID: 969302011

View in Genome Browser
Species Human (GRCh38)
Location 4:6302616-6302638
Sequence CGTGGACCCCGACAAAGGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 42}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969302004_969302011 28 Left 969302004 4:6302565-6302587 CCCACGTGTGCAGACTGTGGCTG 0: 1
1: 0
2: 1
3: 7
4: 130
Right 969302011 4:6302616-6302638 CGTGGACCCCGACAAAGGGAAGG 0: 1
1: 0
2: 0
3: 3
4: 42
969302008_969302011 -9 Left 969302008 4:6302602-6302624 CCATGTGTAGATTGCGTGGACCC 0: 1
1: 0
2: 0
3: 2
4: 31
Right 969302011 4:6302616-6302638 CGTGGACCCCGACAAAGGGAAGG 0: 1
1: 0
2: 0
3: 3
4: 42
969302005_969302011 27 Left 969302005 4:6302566-6302588 CCACGTGTGCAGACTGTGGCTGC 0: 1
1: 0
2: 0
3: 4
4: 153
Right 969302011 4:6302616-6302638 CGTGGACCCCGACAAAGGGAAGG 0: 1
1: 0
2: 0
3: 3
4: 42
969302006_969302011 -1 Left 969302006 4:6302594-6302616 CCTTGCGACCATGTGTAGATTGC 0: 1
1: 0
2: 0
3: 2
4: 39
Right 969302011 4:6302616-6302638 CGTGGACCCCGACAAAGGGAAGG 0: 1
1: 0
2: 0
3: 3
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969302011 Original CRISPR CGTGGACCCCGACAAAGGGA AGG Exonic
900997804 1:6131810-6131832 CGGGGACCCCGCCACAGGCAGGG + Intronic
916504316 1:165414148-165414170 CATTTACCCTGACAAAGGGAAGG - Intronic
1075753334 10:124791657-124791679 CCTGGGCCCCGAGAAGGGGACGG - Intronic
1076829108 10:132985454-132985476 CGAGGACCCCGAAGAAAGGAGGG - Intergenic
1078414863 11:11156741-11156763 CGTGGACCCAGCCCAGGGGAGGG - Intergenic
1097370583 12:58774775-58774797 CATGGATCCAGAAAAAGGGAGGG - Intronic
1104162218 12:126191591-126191613 CGCGGTGCCCGACAAAGGTAAGG + Intergenic
1107174062 13:37379467-37379489 CTTGGACCAGAACAAAGGGATGG + Intergenic
1116294477 14:43089191-43089213 CATGGACACAGACACAGGGAGGG + Intergenic
1122052724 14:99070994-99071016 CGTGGACCCCTGCAAAGGAGTGG - Intergenic
1129109439 15:73329089-73329111 CGGGGCCCCAGACAGAGGGAGGG + Intronic
1135840098 16:25868395-25868417 CGGGGACTCCTACAGAGGGAAGG - Intronic
1137252036 16:46747801-46747823 CGTGGCCCCCACCAAAGCGATGG + Exonic
1139853760 16:69965395-69965417 CGTGGCCCCGGACAAGGGGCGGG - Intergenic
1144816806 17:18040310-18040332 CGTGGGCCCAGACATGGGGAGGG - Intronic
1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG + Intronic
1148075855 17:44934857-44934879 CGAGGACCCCGACAAGGGGGTGG - Exonic
1151728392 17:75897199-75897221 CGTGGACCCTAACGGAGGGAGGG - Intergenic
1156288436 18:35722282-35722304 CTTGGACCACCTCAAAGGGAGGG + Intergenic
1159042910 18:63342325-63342347 CATGGGCTCCGTCAAAGGGAGGG + Intronic
1160798039 19:954742-954764 AGGGGACCCAGACGAAGGGAAGG + Intronic
1160914443 19:1490082-1490104 CCTAGACCCCGACAAGGGGGAGG - Intronic
925458896 2:4043116-4043138 CGTGGACCCAGACACATAGAAGG + Intergenic
928176073 2:29035272-29035294 CCTGGCCCCTGACAAGGGGATGG + Intronic
941885233 2:170520914-170520936 AGTGGACCATGGCAAAGGGAAGG + Intronic
945845810 2:214943394-214943416 CTTGGACCCCCACAAAGTGCAGG + Intronic
1179590572 21:42405368-42405390 CGTGGACTCCTTCAAAGGCATGG - Intronic
1182466562 22:30520455-30520477 GGTGGCCCCCACCAAAGGGAGGG - Intergenic
950239436 3:11354872-11354894 TGTGGTCCCAGACAGAGGGAAGG + Intronic
967891996 3:194370085-194370107 CAAGGACCCCGAGAAAGGGATGG + Intergenic
969302011 4:6302616-6302638 CGTGGACCCCGACAAAGGGAAGG + Exonic
979358484 4:119733354-119733376 TTTAGACCCCGAGAAAGGGATGG + Intergenic
985879398 5:2627283-2627305 CGTGGGCCCAGCCAACGGGAGGG - Intergenic
987046687 5:14115521-14115543 TGAGGACCCCCACAAAGGAATGG - Intergenic
998172491 5:139880830-139880852 GGTGGGCCCAGACAGAGGGAAGG - Intronic
1009813469 6:68700167-68700189 GGTGGACCAGGGCAAAGGGAGGG + Intronic
1019256599 7:56478-56500 CGGGGACACCGACACAGGGAGGG - Intergenic
1019569871 7:1705938-1705960 CCTTCACCCTGACAAAGGGATGG + Intronic
1021839811 7:24713458-24713480 CCTGAACCCCGTCACAGGGAAGG + Intronic
1022747011 7:33182890-33182912 CCTGGATCCCAAAAAAGGGATGG + Intronic
1027453216 7:78356773-78356795 CTTGGACACCAACAAAGGCAAGG + Intronic
1049591256 8:143463870-143463892 CGTGGCCCCCCAAAAGGGGAAGG + Intronic
1049680840 8:143917370-143917392 CGTGGACCCCGAGACGGGCAAGG - Exonic
1054795347 9:69296199-69296221 CATGTACACCGACCAAGGGAAGG + Intergenic
1186220490 X:7344479-7344501 GGTGGTCCCTGACAAATGGATGG - Intronic
1199448556 X:147954457-147954479 TGTGGAGTCTGACAAAGGGATGG - Intergenic