ID: 969302015

View in Genome Browser
Species Human (GRCh38)
Location 4:6302656-6302678
Sequence AACACACTTGGTATTCAGAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 160}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969302015_969302025 29 Left 969302015 4:6302656-6302678 CCACTCTGAATACCAAGTGTGTT 0: 1
1: 0
2: 0
3: 14
4: 160
Right 969302025 4:6302708-6302730 CTGACCTTTCTGAGTGACATGGG 0: 1
1: 0
2: 1
3: 15
4: 196
969302015_969302024 28 Left 969302015 4:6302656-6302678 CCACTCTGAATACCAAGTGTGTT 0: 1
1: 0
2: 0
3: 14
4: 160
Right 969302024 4:6302707-6302729 CCTGACCTTTCTGAGTGACATGG 0: 1
1: 0
2: 2
3: 17
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969302015 Original CRISPR AACACACTTGGTATTCAGAG TGG (reversed) Exonic
900647294 1:3714733-3714755 AACACTCTGTGTCTTCAGAGCGG + Intronic
902492108 1:16790334-16790356 AACACTCTTGGTATTAGGAGGGG + Intronic
902764021 1:18603040-18603062 AACACACGAGGTTCTCAGAGTGG - Intergenic
903195846 1:21687620-21687642 AACCTAATTGGTATTCTGAGAGG - Intronic
904943834 1:34184442-34184464 AACAAACTTGGTCTGCAGAGTGG + Intronic
905025267 1:34845342-34845364 AAAACACATGGCACTCAGAGAGG + Intronic
908877585 1:68695610-68695632 AAGACACTGTGGATTCAGAGTGG + Intergenic
909990359 1:82215984-82216006 AACACATTTGGTTCACAGAGGGG + Intergenic
911056047 1:93709441-93709463 AACACACTCTGTCTTCAGATTGG + Intronic
911579740 1:99621007-99621029 AACAGACTTGGGAAACAGAGGGG - Intergenic
911584103 1:99670267-99670289 AACTCATTTGGTATTCACAAAGG - Intronic
911596576 1:99804904-99804926 CACACACTGGGTCTTCTGAGAGG + Intergenic
911658956 1:100478147-100478169 GACACATTTGGGATTCAGAATGG - Intronic
912456915 1:109804110-109804132 CACTCACTTGCAATTCAGAGAGG + Intergenic
914678881 1:149925109-149925131 ATAAGACTTGGTATTAAGAGTGG + Intronic
916592246 1:166203735-166203757 AATGCACTTTGTACTCAGAGGGG + Intergenic
918673410 1:187250111-187250133 AATGTAGTTGGTATTCAGAGTGG - Intergenic
923060370 1:230466785-230466807 AAAACAACTTGTATTCAGAGAGG + Intergenic
923528338 1:234792203-234792225 AACACTCTTGGCATTAGGAGGGG - Intergenic
1063096986 10:2917241-2917263 CACACACTTGGTATTAGAAGAGG - Intergenic
1064457771 10:15504526-15504548 AAAACACTGTGTGTTCAGAGAGG - Intergenic
1065098847 10:22313144-22313166 ACCAAACTGAGTATTCAGAGGGG - Intergenic
1069236136 10:66076587-66076609 AACCCACTGGGTGTTAAGAGGGG - Intronic
1069453716 10:68537324-68537346 AAAACATTTGGTACTCAGATGGG - Intergenic
1071729836 10:88236543-88236565 AACACAAGTGCTAGTCAGAGAGG + Intergenic
1071984159 10:91034125-91034147 AACACATTTGGTTTTCAAACAGG + Intergenic
1077940162 11:6832222-6832244 AAAACATTTGGTACTCAGATGGG + Intergenic
1079733746 11:23969451-23969473 AACAAATATGGTATTCACAGTGG + Intergenic
1080069019 11:28056704-28056726 AAGACAGATTGTATTCAGAGGGG + Intronic
1081660748 11:44886743-44886765 AACAGTCTTGATATTCACAGAGG + Intronic
1083155212 11:60818626-60818648 AACACACAGGCTTTTCAGAGAGG + Intergenic
1084439150 11:69161279-69161301 AACAAACTTGGCATTCAGGATGG - Intergenic
1085038914 11:73315586-73315608 AGGACACTTGGAATTCTGAGCGG + Intronic
1086145093 11:83542980-83543002 ACCACACTTGGTCCTCAGTGTGG - Intronic
1086374524 11:86186725-86186747 ATCATACTTGTTATTCAGAATGG - Intergenic
1086808972 11:91280968-91280990 AACATACTTTGTATTGAAAGAGG - Intergenic
1090660481 11:128878595-128878617 AACACCGTGGGTCTTCAGAGAGG - Intergenic
1091178465 11:133581947-133581969 AACACAGGTGCTATTAAGAGTGG - Intergenic
1091407158 12:216223-216245 GACCCACTTGGTATTCAGACTGG + Intergenic
1091407171 12:216318-216340 GACCCACTTGGTGTTCAGACCGG + Intergenic
1091407201 12:216508-216530 GACCCACTTGGTGTTCAGACTGG + Intergenic
1091407217 12:216603-216625 GACCCACTTGGTATTCAGACTGG + Intergenic
1092246222 12:6865931-6865953 AACAAACTGGGCATTCAAAGTGG - Intronic
1093115811 12:15209618-15209640 AACACACCTGGTACTCCCAGAGG + Intronic
1097379452 12:58877603-58877625 AACACCCTTGGCACTGAGAGAGG - Exonic
1101348408 12:103906265-103906287 AACCCAGTTGGCAATCAGAGTGG + Intergenic
1103881704 12:124171278-124171300 AACATACTTGAGATTCAGATTGG - Intronic
1104190346 12:126476344-126476366 AACACACATTCTATTCAAAGAGG + Intergenic
1107194381 13:37630962-37630984 ATCACACTTCGTTTCCAGAGAGG + Intergenic
1112325039 13:98438426-98438448 TACACACATGGTCCTCAGAGAGG + Intronic
1112750821 13:102581601-102581623 ATCACACCTGGGATTCAGACAGG - Intergenic
1114948092 14:27712277-27712299 AACACACTTGAAATTCAGTACGG + Intergenic
1117872668 14:60217526-60217548 TCCACACTTGGTACTCAGAATGG - Intergenic
1121235455 14:92388644-92388666 TACTCATTTGGTACTCAGAGGGG - Intronic
1124798794 15:32809424-32809446 AATGCACTTTGTCTTCAGAGGGG - Intronic
1127507090 15:59607967-59607989 TACACTCTTGGTCTTCAGGGAGG + Intronic
1129201626 15:74005698-74005720 AACACAGTTGGCATTTACAGAGG + Intronic
1134897570 16:17902804-17902826 AACACACTTGCTTTTCCAAGTGG + Intergenic
1141706658 16:85668954-85668976 AACATCCTGGGTATTCTGAGAGG - Intronic
1142202783 16:88769033-88769055 CCCACACTTGCTATGCAGAGTGG + Intronic
1144036889 17:11375348-11375370 AAGGCACTGGGTACTCAGAGGGG - Intronic
1146362949 17:32194001-32194023 CACACACTTTTTATCCAGAGAGG + Exonic
1152991981 18:372001-372023 TGCACACTTGGTCTGCAGAGTGG + Intronic
1154477386 18:14776213-14776235 CACACAGTTGGTACTCAGAAAGG - Intronic
1157840412 18:50952784-50952806 AACACATTTGGTATATACAGTGG + Exonic
1157999283 18:52597357-52597379 GCCCAACTTGGTATTCAGAGTGG + Intronic
1164683339 19:30150459-30150481 GACAAACCTGGTATTCAGAGAGG - Intergenic
1168101270 19:54142531-54142553 ATCACACTTCCTACTCAGAGGGG - Exonic
926448784 2:12976512-12976534 AATACATTTGGGAATCAGAGAGG - Intergenic
926513894 2:13816774-13816796 CACACACTTGGTATCCATATAGG - Intergenic
929086916 2:38177063-38177085 AACACATTTGTTATTTAAAGTGG - Intergenic
929303270 2:40330368-40330390 AACACACATAGTTTTCAAAGAGG - Intronic
929572319 2:43030407-43030429 AAAATACTAGGAATTCAGAGAGG - Intergenic
929905252 2:46040116-46040138 AACACTGTGTGTATTCAGAGAGG - Intronic
931985570 2:67738651-67738673 TACACACTTGTGATTCAGAGAGG + Intergenic
933415509 2:81982365-81982387 TACACTCTTGTTATTCAGAAAGG - Intergenic
933586745 2:84187368-84187390 AACACATTTGTCATCCAGAGGGG - Intergenic
935292474 2:101621943-101621965 AACTCACTTGATATTGACAGGGG - Intergenic
935312442 2:101798522-101798544 ACGACAGTTGGAATTCAGAGAGG + Intronic
935921951 2:108025373-108025395 AACACTCTTGGGAAGCAGAGTGG - Intergenic
936001127 2:108831462-108831484 AAGAGGCTTGGTATTTAGAGGGG + Intronic
938696023 2:133836452-133836474 ATCAGGCTTGGTTTTCAGAGTGG + Intergenic
940073885 2:149719347-149719369 AACTTACTTGGTCTCCAGAGTGG + Intergenic
940117889 2:150229622-150229644 AACACATTTGATACTCGGAGAGG - Intergenic
940165183 2:150763032-150763054 AATACACATGGTAATGAGAGAGG - Intergenic
940903231 2:159145983-159146005 AATAGACTTGCTATTTAGAGTGG + Intronic
941558823 2:167018330-167018352 AACACAAATAGTATTAAGAGTGG - Intronic
943430225 2:187790444-187790466 AAGAAACTTGGTATTTGGAGGGG + Intergenic
944836216 2:203582537-203582559 AACACTTTTGAAATTCAGAGAGG - Intergenic
945054601 2:205857489-205857511 AACACCCTTGGTCTTTAGAGAGG + Intergenic
945396746 2:209327451-209327473 AACTGTCTTGTTATTCAGAGAGG - Intergenic
1169995120 20:11547505-11547527 AACACACTTGCTGTCCAGTGAGG + Intergenic
1172176248 20:32973648-32973670 CACACCCATGGGATTCAGAGAGG + Intergenic
1173410020 20:42801932-42801954 AAGGAACTTGATATTCAGAGAGG + Intronic
1173660301 20:44728638-44728660 AACACTCTTGGTATTTAAACAGG + Intergenic
1176887382 21:14272863-14272885 AACAAGCATGGTATTAAGAGAGG + Intergenic
1177005874 21:15671804-15671826 ACCACACTTTGTATCCAGGGAGG + Intergenic
1178222345 21:30674719-30674741 AACACACTTGGGCTGCAGAAAGG + Intergenic
1179256779 21:39723568-39723590 AAGGAACTTGGAATTCAGAGAGG + Intergenic
1182814518 22:33148472-33148494 AACACAAATGGTCTTCAGTGAGG - Intergenic
1183285455 22:36959749-36959771 ACCACACTGGGAATGCAGAGAGG + Intergenic
951360132 3:21715282-21715304 AACACCATTGGTATAGAGAGTGG - Intronic
952570890 3:34714536-34714558 AACAGAATTGATAATCAGAGTGG - Intergenic
957731486 3:84143913-84143935 AACACACTTTATATTCCAAGTGG - Intergenic
958510714 3:95044285-95044307 AACACACTGTGTATGCAAAGAGG - Intergenic
959282259 3:104359620-104359642 AACAGACTTCGTTTTCAGATAGG - Intergenic
961479864 3:127172746-127172768 ACCACACTTGATTTTCAGGGAGG + Intergenic
968702310 4:2062855-2062877 CAAACCCTTGGTCTTCAGAGAGG + Intronic
969302015 4:6302656-6302678 AACACACTTGGTATTCAGAGTGG - Exonic
969358078 4:6642907-6642929 AACACACTTGGTTCTTAGTGTGG + Intergenic
970271726 4:14355232-14355254 AACACACTTTGGAACCAGAGAGG + Intergenic
973676686 4:53270519-53270541 AAGACACTTGGTATCAAGTGTGG + Intronic
975511424 4:75197646-75197668 AACACACTTGGTACACAGACCGG - Intergenic
978704339 4:111688473-111688495 AGCACATTTGGTATCTAGAGAGG - Intergenic
979913251 4:126396995-126397017 AACACACATGGTATTGCCAGGGG + Intergenic
980374379 4:131924899-131924921 AACACACTTGGTTTACATAATGG - Intergenic
981528728 4:145732926-145732948 AATGCTCTTTGTATTCAGAGCGG + Intronic
982112677 4:152071150-152071172 AACACACTTGGTGGGCAGAGAGG + Intergenic
982767308 4:159363795-159363817 AACAGAATGGTTATTCAGAGAGG - Intergenic
986614646 5:9603980-9604002 AACACACTGGGGAATAAGAGGGG + Intergenic
987615210 5:20265341-20265363 AACACTCTTGGCATTCATAGAGG - Intronic
988082630 5:26433115-26433137 AACTCAGTTGGTACTCACAGAGG + Intergenic
995410773 5:111854760-111854782 AACAGAGCTGGTAATCAGAGGGG - Intronic
998846559 5:146315984-146316006 AAAACACATAGTGTTCAGAGAGG - Intronic
999158287 5:149474143-149474165 AACACAGCTGGTAAACAGAGGGG + Intergenic
999950621 5:156645983-156646005 AACACACTTTCTTTTGAGAGAGG + Intronic
1000358108 5:160420362-160420384 AAAACAGTGGTTATTCAGAGAGG + Intronic
1002700673 5:181122360-181122382 GACACTCTAGGTGTTCAGAGAGG - Intergenic
1003408123 6:5839797-5839819 GACACTTGTGGTATTCAGAGTGG - Intergenic
1004210589 6:13638323-13638345 ATCACACTTGTTGTACAGAGTGG + Intronic
1004991392 6:21142255-21142277 AGAACACTAGGTACTCAGAGAGG - Intronic
1005702784 6:28419457-28419479 AACACTTTTGTGATTCAGAGTGG - Intergenic
1006663221 6:35667375-35667397 CACACACTTGTAAGTCAGAGTGG - Intronic
1010051503 6:71509800-71509822 AACCCACTTGGTCCTCATAGTGG - Intergenic
1010052769 6:71527232-71527254 AACACTCATGATTTTCAGAGTGG + Intergenic
1011613914 6:89180700-89180722 AATACACAGGGTATGCAGAGGGG - Intronic
1012442988 6:99279129-99279151 AACACACTTGCTAGAGAGAGGGG + Exonic
1013252894 6:108352348-108352370 AATATACTTGGTATTCATGGGGG + Intronic
1013709300 6:112878748-112878770 AACACACTTAGTGTTAAGATTGG + Intergenic
1015693070 6:135947492-135947514 AACACATTTGGCATTCTGATCGG - Exonic
1015720748 6:136238701-136238723 CACACACATGGAACTCAGAGAGG + Intronic
1015822532 6:137279785-137279807 ATCTCACTTTGTATTTAGAGGGG + Intergenic
1016326713 6:142911249-142911271 AATACAGTTGGGATTCAGAAAGG + Intronic
1016533252 6:145082021-145082043 AACAAAGTCAGTATTCAGAGAGG + Intergenic
1016878330 6:148885622-148885644 AGCCCACTTGGTGTTCACAGTGG - Intronic
1021697329 7:23287572-23287594 AAGGCACTTGGTATTTACAGAGG - Intergenic
1027845072 7:83362212-83362234 AATACAGTTGGTATACACAGGGG - Intergenic
1028112184 7:86954187-86954209 AACACTCTTTATTTTCAGAGTGG - Intronic
1028849210 7:95517552-95517574 CACAGACTTTGTTTTCAGAGAGG + Intronic
1029477658 7:100794515-100794537 AACAAACATGGAGTTCAGAGAGG + Intronic
1030413018 7:109205358-109205380 ACCACACCTGTTATTTAGAGAGG + Intergenic
1033581107 7:142736646-142736668 AACTCACTGGGTACTCAGAGTGG - Intergenic
1035793155 8:2326087-2326109 AACACACTTGGGGATCAGTGAGG + Intergenic
1035799649 8:2395618-2395640 AACACACTTGGGGATCAGTGAGG - Intergenic
1035956848 8:4089786-4089808 AACACACTCGGTAGACTGAGTGG - Intronic
1037999942 8:23382943-23382965 AACACACATGGAATTGAGGGTGG - Intronic
1038866240 8:31441421-31441443 GACACAGGTGGTATTCAGAGTGG - Intergenic
1041439415 8:57877805-57877827 ATCGCACTTGGGATTCTGAGAGG + Intergenic
1043886903 8:85611350-85611372 CACAAAATTGATATTCAGAGTGG + Intergenic
1045714554 8:105026302-105026324 GACACACTAGGTATTTAGATGGG + Intronic
1045920336 8:107521663-107521685 AGAACACCTGGTATTCATAGAGG + Intergenic
1046108865 8:109697363-109697385 AACAAACTTTGAATTTAGAGAGG + Intergenic
1046349667 8:112990873-112990895 AACACATTTGGTTTTCAGAAGGG - Intronic
1048219585 8:132529129-132529151 AAAACACTTGGAGTACAGAGAGG + Intergenic
1052899737 9:33782134-33782156 AACTCACTGGGTACTCAGAGTGG - Intronic
1055016704 9:71625986-71626008 AACAGAGTTTGTATTCAGAAAGG - Intergenic
1055499095 9:76885597-76885619 AACAGACTTACTCTTCAGAGCGG + Intronic
1056847950 9:90056751-90056773 AACACATTTAGTATTAATAGGGG - Intergenic
1056991124 9:91412140-91412162 AAAACACTTACTATTCAAAGGGG + Intronic
1058231714 9:102434584-102434606 AACAGACTTGCATTTCAGAGGGG - Intergenic
1203767899 EBV:35923-35945 AACACACATGGCATAAAGAGAGG - Intergenic
1192013067 X:67296195-67296217 AAGAGAATTGATATTCAGAGAGG - Intergenic
1193984651 X:88225741-88225763 AATCCAGTTGATATTCAGAGTGG + Intergenic
1198096029 X:133380464-133380486 AAGACGCTTTGGATTCAGAGGGG - Intronic
1199330656 X:146554328-146554350 AATATTCTTGGTATTCAGATTGG - Intergenic