ID: 969302135

View in Genome Browser
Species Human (GRCh38)
Location 4:6303425-6303447
Sequence CTCCAGCTGGAGATGAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 307}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969302135_969302147 8 Left 969302135 4:6303425-6303447 CCTGGCTTCATCTCCAGCTGGAG 0: 1
1: 0
2: 1
3: 42
4: 307
Right 969302147 4:6303456-6303478 GGGGCATCTGCCGTAACTGTGGG 0: 1
1: 0
2: 0
3: 3
4: 56
969302135_969302153 23 Left 969302135 4:6303425-6303447 CCTGGCTTCATCTCCAGCTGGAG 0: 1
1: 0
2: 1
3: 42
4: 307
Right 969302153 4:6303471-6303493 ACTGTGGGGTGGCCTGGGCATGG No data
969302135_969302146 7 Left 969302135 4:6303425-6303447 CCTGGCTTCATCTCCAGCTGGAG 0: 1
1: 0
2: 1
3: 42
4: 307
Right 969302146 4:6303455-6303477 TGGGGCATCTGCCGTAACTGTGG 0: 1
1: 0
2: 3
3: 120
4: 503
969302135_969302149 12 Left 969302135 4:6303425-6303447 CCTGGCTTCATCTCCAGCTGGAG 0: 1
1: 0
2: 1
3: 42
4: 307
Right 969302149 4:6303460-6303482 CATCTGCCGTAACTGTGGGGTGG 0: 1
1: 0
2: 0
3: 6
4: 72
969302135_969302150 17 Left 969302135 4:6303425-6303447 CCTGGCTTCATCTCCAGCTGGAG 0: 1
1: 0
2: 1
3: 42
4: 307
Right 969302150 4:6303465-6303487 GCCGTAACTGTGGGGTGGCCTGG 0: 1
1: 0
2: 0
3: 8
4: 77
969302135_969302152 18 Left 969302135 4:6303425-6303447 CCTGGCTTCATCTCCAGCTGGAG 0: 1
1: 0
2: 1
3: 42
4: 307
Right 969302152 4:6303466-6303488 CCGTAACTGTGGGGTGGCCTGGG 0: 1
1: 0
2: 0
3: 7
4: 99
969302135_969302154 24 Left 969302135 4:6303425-6303447 CCTGGCTTCATCTCCAGCTGGAG 0: 1
1: 0
2: 1
3: 42
4: 307
Right 969302154 4:6303472-6303494 CTGTGGGGTGGCCTGGGCATGGG No data
969302135_969302148 9 Left 969302135 4:6303425-6303447 CCTGGCTTCATCTCCAGCTGGAG 0: 1
1: 0
2: 1
3: 42
4: 307
Right 969302148 4:6303457-6303479 GGGCATCTGCCGTAACTGTGGGG 0: 1
1: 0
2: 0
3: 5
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969302135 Original CRISPR CTCCAGCTGGAGATGAAGCC AGG (reversed) Intergenic
900713516 1:4129718-4129740 CACCAGCAGGAGATGCAGACCGG + Intergenic
903439918 1:23379978-23380000 CTTCTCCTGTAGATGAAGCCCGG - Intergenic
904684126 1:32248494-32248516 CTGGAGCTGGAGCTGGAGCCCGG + Exonic
905210085 1:36367921-36367943 CTCCAGTTGGAGGTGAAGTGTGG + Intronic
905307842 1:37031833-37031855 CTCCAGCTGGGGTTCAAGCAGGG + Intronic
905797030 1:40821524-40821546 CTCCTGCTGCAGAGGAAGCTCGG + Intronic
906058062 1:42931207-42931229 CTGCAGGGGGAGATGCAGCCTGG + Intronic
906323713 1:44831664-44831686 CCCCAGCGGGAGATGAAGCAGGG + Intronic
907702443 1:56802145-56802167 TTCCAGATGGGGAAGAAGCCAGG - Intronic
908156668 1:61360366-61360388 AGCCAGCAGGAGTTGAAGCCAGG - Intronic
910759253 1:90718705-90718727 CTCCAGCTGGAAAAAATGCCTGG + Intergenic
910790638 1:91046264-91046286 CTGCAGCAGTAGATGGAGCCAGG + Intergenic
912496267 1:110094073-110094095 CGCCAGATGGAGATGGAGCGCGG - Intergenic
914682001 1:149945012-149945034 CCTCAGCTGGAGATGAGCCCCGG - Exonic
915081176 1:153353757-153353779 CTCCACCTGCAGGTGAAGTCAGG - Intergenic
915217755 1:154351480-154351502 TTTCAGCTGAAGATGAAGACGGG + Intergenic
916873128 1:168938854-168938876 CTGAAGCTGGAGCTGCAGCCTGG - Intergenic
918413653 1:184285971-184285993 GTCCAGGAGGAGAGGAAGCCAGG + Intergenic
920615436 1:207487836-207487858 CTGCAGGTGCAGATGAAGGCAGG + Intronic
920915923 1:210257930-210257952 CTGCAGCTTGAGAAGGAGCCAGG - Intergenic
922222799 1:223621355-223621377 TACCAGCTGGAGATGCAACCTGG - Intronic
922752346 1:228076203-228076225 CTCCAGCTGGATGTGAAGGGGGG + Exonic
923391074 1:233515116-233515138 CACCAGCTGGAGACTCAGCCCGG - Intergenic
1063183338 10:3626988-3627010 CACCATATGAAGATGAAGCCGGG + Intergenic
1063196390 10:3747508-3747530 ATAGAGCTGGAAATGAAGCCAGG - Intergenic
1071452507 10:85810630-85810652 TCCCAACTGGAGATGAAGCCAGG + Intronic
1073641379 10:105255741-105255763 GTCCAGTTTGAGCTGAAGCCGGG + Exonic
1074207535 10:111297005-111297027 CTCAAGGTAGAGATGAAGGCAGG + Intergenic
1074672303 10:115805654-115805676 CTTCAGCTGTAGAAGAAACCAGG + Intronic
1076347303 10:129788304-129788326 CTCCAGCTGGCGAAGGACCCAGG + Intergenic
1079054533 11:17194233-17194255 CTGAAGCTGGAGTTGCAGCCTGG - Intronic
1079213071 11:18481034-18481056 ATCCAGCTGTAGCTGGAGCCTGG - Intronic
1080406543 11:31985058-31985080 CACCAGCTGGAGGTGGATCCAGG + Intronic
1081601962 11:44501466-44501488 CTCAAGATGGACATGAAGGCTGG - Intergenic
1082774968 11:57237631-57237653 ATCCAGCTTGAGCTGGAGCCAGG + Intergenic
1083452046 11:62752770-62752792 CTTCAGCTGGGGCTGGAGCCTGG + Exonic
1083501837 11:63115930-63115952 CTGAAGCTGGAGCTGCAGCCTGG + Intronic
1083954669 11:65976806-65976828 CTCAAGCTGGAGATGAGCACCGG + Intronic
1084229910 11:67744147-67744169 CTCCAGCTGGGGATGAACCGAGG - Intergenic
1084461179 11:69297539-69297561 CTGCGGCGGGAGAGGAAGCCGGG - Intronic
1088259239 11:107928722-107928744 CGCCTGCTGGAGATCGAGCCGGG + Exonic
1088811174 11:113393719-113393741 CTCCACCTGGACCTCAAGCCGGG + Exonic
1088933494 11:114376043-114376065 CTCCAGATGGAGCTGAATCTTGG - Intergenic
1089120434 11:116130683-116130705 CTCTAGCTGGAGATAAAGTCAGG - Intergenic
1089132352 11:116222677-116222699 CACCAGCAGGAGATGAAAGCAGG - Intergenic
1089993005 11:122879330-122879352 CTCCAGCTTGAGAAGCACCCTGG + Intergenic
1090258853 11:125304336-125304358 CTCCAGCTGGAAAAGCAGGCAGG - Intronic
1090532060 11:127601037-127601059 CCCCAGCTGGAGATGAAGGGAGG + Intergenic
1090982574 11:131736351-131736373 CCCCAGCAGTAGAAGAAGCCTGG - Intronic
1094266341 12:28564728-28564750 CTGAAGCTGGAGTTGCAGCCTGG + Intronic
1094530429 12:31269503-31269525 CTTTAGCAGGAGATGAAACCTGG - Intergenic
1094818076 12:34205620-34205642 CTCCGAGTGGGGATGAAGCCTGG + Intergenic
1095901034 12:47328311-47328333 CATCAGCTGGGGATGCAGCCTGG - Intergenic
1095910181 12:47418234-47418256 AAACAGCTGGAGATGAAGCATGG - Intergenic
1100531708 12:95467447-95467469 CTGAAGCTGGAGCTGCAGCCTGG + Intergenic
1101420876 12:104549963-104549985 CTTCAGCTAGAGGAGAAGCCTGG + Intronic
1101761587 12:107663111-107663133 GTCCAGATGGAGAAGAGGCCTGG - Intergenic
1102182099 12:110920491-110920513 CTCCAGGAGGTGATGATGCCGGG - Intronic
1102310713 12:111842450-111842472 CCCCAGCTGGGGATGAGGCTAGG + Intronic
1102657091 12:114491180-114491202 CTCTAGTTGGAGGAGAAGCCTGG + Intergenic
1103880236 12:124160342-124160364 TTCCAGCTGCAGCTGCAGCCGGG - Intronic
1104473952 12:129055002-129055024 CTCCAGCTGGAGGGGAGGCAGGG - Intergenic
1104497254 12:129252450-129252472 CACTAGCTGGTGGTGAAGCCAGG + Intronic
1104654449 12:130563309-130563331 TTCCAGCTGGAGATGCCACCAGG - Intronic
1104915444 12:132262064-132262086 CTCCGGGTGGAGATGAAGTTGGG - Intronic
1105036018 12:132921788-132921810 GTCCAGCTGGAGAGAAGGCCTGG + Exonic
1106123732 13:26882995-26883017 CTCCAGCAGGACCTGGAGCCTGG - Intergenic
1107260701 13:38487377-38487399 CTCCAGATGAGGATGCAGCCTGG - Intergenic
1107611017 13:42112972-42112994 ATCCAACTGCAGATGAAGACTGG - Intronic
1108172919 13:47761855-47761877 CTCCAGTTGGAGAAGAAACCAGG - Intergenic
1110440537 13:75521085-75521107 CCACAGCTGGAGCTGAAGACTGG - Intergenic
1113936338 13:113996979-113997001 GTGCAGCTGGAGATGTGGCCAGG + Intronic
1115968539 14:38918992-38919014 TTCCAGCTGGAGATGCAGTCTGG + Intergenic
1116368324 14:44097895-44097917 CTGAAGCTGAAGCTGAAGCCAGG - Intergenic
1118501014 14:66362741-66362763 CTTCATGTGGAGATGAAGGCAGG - Intergenic
1119853691 14:77883949-77883971 CTCCAGGGCGAGAGGAAGCCTGG - Intronic
1119937559 14:78606683-78606705 CTCCAGTTCCTGATGAAGCCAGG + Intronic
1120092095 14:80343829-80343851 CTCCATTTGAAGATGAAGGCAGG - Intronic
1120882268 14:89422793-89422815 CTCCAGCAGGGAATGCAGCCAGG + Intronic
1122162918 14:99799100-99799122 CACCTGCAGGAGAAGAAGCCAGG - Intronic
1122388983 14:101367648-101367670 CTCCTGCTGGGGCTGGAGCCAGG - Intergenic
1123988335 15:25664737-25664759 CTCCTGCTTGTGATGGAGCCAGG - Intergenic
1124466241 15:29942339-29942361 CACTAGGTGGAGATGAAGGCCGG + Intronic
1126050673 15:44682264-44682286 CTCCTGGAGGAGATGAATCCTGG - Intronic
1126343607 15:47670036-47670058 CTCCAGTTGGAGAAGAAGAAAGG - Intronic
1128276444 15:66357552-66357574 ATCCAGCTGGAGATCCAGTCTGG + Intronic
1128749809 15:70140794-70140816 CTGCAGCTGGAGAAGAAGGCAGG + Intergenic
1129228500 15:74183613-74183635 CTCCACATGGAGATGAACCCTGG - Intronic
1129677675 15:77641242-77641264 CATCAGCTGGAGAAGAAGGCAGG - Intronic
1131262749 15:90896433-90896455 GCCCAGATGGAGATGAAGGCTGG + Intergenic
1131269119 15:90935697-90935719 CTCAAGCTGGTGAGGGAGCCTGG + Exonic
1131871574 15:96769643-96769665 CCCCAGCTGTAGATGAATCATGG - Intergenic
1131972004 15:97902837-97902859 CACCACGTGGAGATGAAGGCAGG - Intergenic
1132355420 15:101168034-101168056 CTCCTCCTGAAGAGGAAGCCAGG - Intergenic
1132598268 16:762915-762937 CTGGAGCTGGAGATCCAGCCAGG + Intronic
1132716039 16:1290239-1290261 ATGCAGCTGGAGATACAGCCTGG + Intergenic
1133229830 16:4361232-4361254 CTGCAGCTGGTGAGGACGCCAGG - Exonic
1134111489 16:11517966-11517988 CTCCAGCTCCAACTGAAGCCTGG + Intronic
1137963759 16:52911121-52911143 CTCCAGGTGGAAATGTACCCAGG - Intergenic
1138511213 16:57509506-57509528 CGCCAGCATGAGATGTAGCCAGG - Intergenic
1138727976 16:59161720-59161742 ATAAAGCTGGAGATGAAGCTAGG - Intergenic
1140062284 16:71581154-71581176 CTCCAACTGGACATTAAACCAGG + Intergenic
1140201198 16:72896182-72896204 CTACGGCTGGAAACGAAGCCAGG + Intronic
1141108553 16:81253454-81253476 CTCCACATGGATATGAATCCTGG - Intronic
1141785755 16:86199603-86199625 CTTCAGCCTGAAATGAAGCCGGG + Intergenic
1142255942 16:89014024-89014046 CTTCAGCTGGAGCTGAGGACAGG + Intergenic
1143570451 17:7754778-7754800 CTGAAGCTGGAGCTGCAGCCTGG - Intronic
1143719739 17:8801196-8801218 CTCCCAGTGGAGATGAACCCAGG - Intergenic
1143940560 17:10536785-10536807 CTCCAGTGGGAAATGAGGCCAGG + Intronic
1143954696 17:10659004-10659026 CCACTGCTGGAGATGTAGCCAGG - Intergenic
1144025570 17:11273529-11273551 TTCCAGCTTGAGAGGAAGGCTGG + Intronic
1145064564 17:19753243-19753265 CTGCAGCTGGGGCTGCAGCCAGG - Intergenic
1145236891 17:21214558-21214580 CCCCAGCGGGAGAGGCAGCCTGG - Exonic
1147583490 17:41639416-41639438 CTCCAGGGGCAGATGAGGCCAGG + Intergenic
1147855497 17:43476590-43476612 CTGAAGCTGGAGCTGCAGCCTGG - Intergenic
1148028964 17:44607042-44607064 CCCCAGCTGGAGATGTGGCAGGG + Intergenic
1148732199 17:49844122-49844144 CTGCAGCTGGAGCTGAATGCTGG + Exonic
1149156439 17:53635687-53635709 CCTCAGCTGGAGAACAAGCCAGG + Intergenic
1150959371 17:69897163-69897185 CTCCAGATGAAAATGCAGCCTGG - Intergenic
1151948020 17:77330003-77330025 CCCCAGCTGGGGATGGAGCGGGG - Intronic
1152366074 17:79857227-79857249 CTCCAGGTTGGGATGGAGCCAGG + Intergenic
1152538149 17:80962134-80962156 CTCTAGCTGGAAATGAAACCAGG + Intronic
1153650947 18:7239819-7239841 CTCCAGCTGTAGAAGAAAGCTGG - Intergenic
1153948813 18:10039815-10039837 CTCCAGCTGCTGAGGAGGCCTGG - Intergenic
1154156518 18:11948071-11948093 CTGCAGCCGGAGCTGGAGCCAGG + Intergenic
1154360175 18:13654282-13654304 CTCTGGCTGGAGCTGAAGCGTGG + Intergenic
1155002753 18:21703417-21703439 CTGCAGCTGGGGGTGGAGCCGGG + Intronic
1156866307 18:41892528-41892550 CTTCAGCTGGAGGAGCAGCCTGG + Intergenic
1157490606 18:48121117-48121139 TTTCAGCTGGAGTAGAAGCCTGG - Intronic
1157501353 18:48193173-48193195 CTCCAGCTGGTGATGCAAACAGG + Intronic
1158640475 18:59199248-59199270 CTCTAGCCTGAGCTGAAGCCAGG + Intergenic
1158682069 18:59577297-59577319 CTCCAGCTGGAACTGCTGCCTGG - Intronic
1160006621 18:75073278-75073300 CTCCTGTTGAAGATGGAGCCTGG + Intergenic
1160224282 18:77000042-77000064 TGCCAGCTAGAGATGAGGCCAGG + Intronic
1161380728 19:3963790-3963812 CTGCAGCTGGGGATGAAGCGGGG - Intronic
1161727189 19:5936330-5936352 CTGCATGTGGAGATGACGCCAGG - Intronic
1162292432 19:9790305-9790327 CTCTACCAGGAGATGGAGCCCGG - Intronic
1163011447 19:14429089-14429111 CTCCATCTGGGGAGGCAGCCTGG + Intergenic
1163163615 19:15480387-15480409 CACCAGCTGGAGACTCAGCCAGG + Intronic
1164639614 19:29814314-29814336 TTCCAGCTGAAGATGAAGCAGGG + Intronic
1164865710 19:31602635-31602657 CTCCAAGTGGAGAAGAACCCAGG - Intergenic
1165154885 19:33780952-33780974 CACCAGCTGGAGATGAGCCCAGG + Intergenic
1165776468 19:38407303-38407325 CCCAAGCTGGAGAAGTAGCCAGG - Intronic
1166049818 19:40252035-40252057 CTCCAGCTGGAGAGGCAACCAGG + Intronic
1166321598 19:42022352-42022374 CTTCTGCTGGAGGGGAAGCCGGG + Exonic
1166369625 19:42293678-42293700 CTACAGCTGGAGCTGGGGCCGGG - Exonic
1166491649 19:43265873-43265895 CATTGGCTGGAGATGAAGCCAGG + Intronic
1167596335 19:50430255-50430277 ACCCAGCTGGAACTGAAGCCTGG + Exonic
1167673347 19:50869174-50869196 GGCCAGCTGGAGATGGAGCTGGG - Intronic
1168726592 19:58586240-58586262 GGCCATCTGGACATGAAGCCTGG - Intergenic
925866109 2:8227494-8227516 TTCCAGCAGGAGAAGAAGACTGG - Intergenic
926969556 2:18453156-18453178 CACCAGCTGGAGAAGAAGAGAGG + Intergenic
927638458 2:24832238-24832260 CTCCAGCTGCAGCTGCTGCCTGG + Intronic
929535973 2:42784353-42784375 CTCCAGCTGGAGCCGCAGCTTGG + Intronic
931259982 2:60609156-60609178 TTCTAGTTGGAGATGAACCCTGG + Intergenic
934782956 2:96984481-96984503 CTCAAGCAGATGATGAAGCCTGG + Intronic
936163413 2:110101447-110101469 ATCCAGCGGGAGATGAGACCTGG - Intronic
939886265 2:147685206-147685228 TTCCAGCTGGATATGAATCTTGG - Intergenic
940881998 2:158956011-158956033 AGCCAGCTAGAAATGAAGCCTGG - Intergenic
946344167 2:219094831-219094853 CCTCACCTGGAGATGAACCCTGG - Intronic
946689543 2:222300012-222300034 CCCCAGCAGGATATGACGCCAGG + Intronic
947546127 2:231011612-231011634 CTCCCACTGGCCATGAAGCCTGG + Intronic
947972909 2:234338893-234338915 CTGGAACTGGAGATGAATCCAGG - Intergenic
948318186 2:237046241-237046263 CTCCACCTGTAGAGGAAGCAAGG + Intergenic
948534408 2:238635282-238635304 CTCCAGCTGGACGTGAACGCAGG - Intergenic
948575736 2:238948298-238948320 CAACAGCTGGAGGTGAAGCTGGG - Intergenic
1168808849 20:689443-689465 CTTCAGCTGGGGATGAGGCCAGG + Intergenic
1171986015 20:31661797-31661819 CTCCAGCTGGAGGGCAGGCCTGG - Intergenic
1172046539 20:32084492-32084514 CTCAAGCTGGAGAAGAAACTTGG + Exonic
1172700972 20:36853386-36853408 CTCCAACTGGACCTGAATCCTGG - Intronic
1172911319 20:38411307-38411329 CTCCAGCTGGGGACTCAGCCAGG + Intergenic
1174444378 20:50580602-50580624 TTCCAGCTGGAGATGACTGCCGG + Intronic
1175253465 20:57623633-57623655 GCACATCTGGAGATGAAGCCAGG + Intergenic
1175951438 20:62585658-62585680 CACATGCTGGAAATGAAGCCAGG - Intergenic
1178254952 21:31043986-31044008 CTCCTGCTGCAGATGCTGCCCGG + Intergenic
1178429761 21:32508907-32508929 CTCCAGCTGGGGATGAACCAAGG + Intronic
1180036602 21:45253514-45253536 TTCCAGCAGCACATGAAGCCAGG - Intergenic
1180951732 22:19723531-19723553 CTCCCGCTGCAGAGTAAGCCGGG + Exonic
1183515762 22:38265090-38265112 CTCCTCCTGGAGATGAGGCTAGG + Intronic
1183852821 22:40605764-40605786 CCCAAACTGTAGATGAAGCCTGG - Intronic
1184391375 22:44205392-44205414 TTCCTGGTGGAGGTGAAGCCTGG - Intronic
949616395 3:5758382-5758404 CTTCAGCTGGAGATGAGGTTTGG - Intergenic
950035242 3:9880308-9880330 CCCCAGCTGGGGCTGAAGGCTGG - Intergenic
951027618 3:17846315-17846337 CAGCAGCTGGAGAGGAAGTCAGG - Intronic
951851556 3:27146949-27146971 ATACAGCTGGAGAGGTAGCCAGG + Intronic
952540492 3:34362542-34362564 CTGCAGCTTGAAAAGAAGCCAGG + Intergenic
952819225 3:37471564-37471586 GTGCAGCTGGAGAGGGAGCCAGG + Intronic
954171370 3:48805369-48805391 TTCCAGCTGTAGCTGAAGCTTGG - Intronic
955222292 3:57032968-57032990 CACCATCAGGAGATGAAGCTAGG + Intronic
955398001 3:58570956-58570978 CTCAAGCAGGGGCTGAAGCCTGG - Intronic
955467849 3:59254899-59254921 CTTCAGCTGGAAATCAAGTCTGG - Intergenic
957046484 3:75378997-75379019 CTCCAGCTGGGGATGAACCAAGG - Intergenic
959622220 3:108410830-108410852 CTCCAGCTGCAGCTGGTGCCTGG + Exonic
959905198 3:111703463-111703485 CTCCCTCTGGAGATGAAACTGGG + Intronic
960040748 3:113148088-113148110 CTCCAGTTGAAAATGAAGGCAGG + Intergenic
961119594 3:124362372-124362394 TTCCACCTGGAAATGTAGCCAGG + Intronic
961202376 3:125055493-125055515 CTACGGCTGGGGATGCAGCCCGG + Intronic
961580202 3:127874724-127874746 CTTCATCTGCAGAGGAAGCCAGG + Intergenic
962482454 3:135809492-135809514 GTCCGGCAGGAGATGCAGCCTGG + Intergenic
964283511 3:155092834-155092856 CTGAGGCTGGAGATGAAGCAGGG + Intronic
965996509 3:174889451-174889473 GTCCAGCAGGAGAGGAAGCAGGG - Intronic
966354156 3:179061230-179061252 CTCCAGCTGAAAATGGAGCAAGG + Intronic
966639738 3:182176617-182176639 CTCCAGCTGGAGATCCAGAGGGG - Intergenic
967159081 3:186718867-186718889 CTCCAGCAGGAGACAAATCCTGG + Intronic
967813592 3:193780914-193780936 CTCCAGCTTGGAATGAAGGCAGG - Intergenic
968049735 3:195646283-195646305 CTGCAGCTAGAGATGCAGACAGG + Intergenic
968106009 3:196001594-196001616 CTGCAGCTGGAGGTGCAGACAGG - Intergenic
968128790 3:196179979-196180001 CTCCAGGTGGAGTTGGAGCTGGG - Intergenic
968304398 3:197639699-197639721 CTGCAGCTAGAGATGCAGACAGG - Intergenic
968702520 4:2063644-2063666 CTCCAGCTGGACACCAAGCCAGG - Intronic
968944277 4:3655379-3655401 CCCCAGCTGGATAAGGAGCCCGG + Intergenic
968948106 4:3676081-3676103 CTCCAGCTGGGGAGGAAGCATGG + Intergenic
968990771 4:3910109-3910131 CTCCAGCTGGGGATGAACCAAGG - Intergenic
969217463 4:5733690-5733712 CTCCAGCAGGAGGTGTAGCCCGG - Intronic
969302135 4:6303425-6303447 CTCCAGCTGGAGATGAAGCCAGG - Intergenic
969824573 4:9747234-9747256 CTCCAGCTGGGGATGAACCAAGG + Intergenic
970353969 4:15234137-15234159 AGCCAGCAGGAGATGGAGCCAGG - Intergenic
970942436 4:21650795-21650817 CTCCAGATGGAAATGAAGCCTGG - Intronic
972455942 4:39255323-39255345 CTCCAGCTGGAGGCGCAGCATGG + Intronic
973053054 4:45618479-45618501 TTCCAGCTGAAAATGATGCCAGG + Intergenic
974406910 4:61484551-61484573 CTCCAGCTGGAAATAAAGTAAGG - Intronic
974433493 4:61828744-61828766 CTCCAGCTGTTGCTGATGCCAGG - Intronic
976359787 4:84164201-84164223 ATACAGCTGGAGAATAAGCCAGG - Intergenic
977248389 4:94660767-94660789 CCTCAGCTGGAGAGGAAGGCAGG - Intronic
978696355 4:111584627-111584649 CCACAGCTGGAGCTGAAGCAGGG + Intergenic
982399117 4:154946538-154946560 TTGCAGCTGAAGATTAAGCCCGG + Intergenic
985356611 4:189126667-189126689 CACCAGCTGCACAGGAAGCCTGG + Intergenic
985741713 5:1621217-1621239 CTGCAGCTGGAGATGCAGACAGG - Intergenic
985884474 5:2666245-2666267 CACCAGGAGGAGATCAAGCCTGG + Intergenic
985914494 5:2907126-2907148 CCCCACCTGGAGATCAAGGCTGG + Intergenic
985914578 5:2907522-2907544 CCCCACCTGGAGATCAAGGCTGG + Intergenic
986135994 5:4978460-4978482 CTCAAGCTGGAGGTGGGGCCTGG + Intergenic
986271605 5:6235949-6235971 CTCCTGCCAGAGAAGAAGCCTGG + Intergenic
986384999 5:7224676-7224698 CTCCAGCTGGAGAAGAGGCATGG - Intergenic
986737690 5:10680320-10680342 CTCCACCAGGAGATCAAGCAAGG - Exonic
986998796 5:13637968-13637990 CTGAAGCTGGAGCTGCAGCCAGG + Intergenic
987051318 5:14148871-14148893 CTCCAGCTGGGGACCCAGCCTGG - Intronic
988585782 5:32506289-32506311 CTCTTGCTGTGGATGAAGCCTGG + Intergenic
988878866 5:35478160-35478182 CTCCAGTTCATGATGAAGCCTGG + Intergenic
989568609 5:42924975-42924997 CTCCAGGTAGACAGGAAGCCTGG - Intergenic
989648988 5:43666818-43666840 CTGAAGCTGGAGCTGCAGCCTGG + Intronic
989698303 5:44231276-44231298 CTCCAGTTGAAAATGTAGCCTGG - Intergenic
991329053 5:65472260-65472282 CTACAGCTGGAGGTGAAGGCTGG + Intronic
991530730 5:67611108-67611130 GTGAAGCTGGAGATGAAGCTTGG - Intergenic
991639553 5:68739181-68739203 ATCCAGCTGGGGATGAAGGTAGG + Intergenic
992715861 5:79510822-79510844 CTGAAGCTGGAGCTGCAGCCTGG - Intronic
996108039 5:119529666-119529688 CTCCAGCTGATTATAAAGCCAGG + Intronic
997229553 5:132232604-132232626 CTCCAGCTGCAGGTTCAGCCAGG + Intronic
997978744 5:138455725-138455747 CTCCAGATGGAGATAATGCCGGG - Intergenic
998377303 5:141699713-141699735 CTCCAGCTGGAGGAGCTGCCAGG - Intergenic
999165429 5:149545439-149545461 CTGAAGCTGGAGCTGCAGCCTGG + Intronic
999238862 5:150115841-150115863 CTCCACCTGGAGCTCAAGCTGGG + Exonic
1000348600 5:160334760-160334782 CTCCAGGTGGATCTGATGCCAGG - Intronic
1002185432 5:177452608-177452630 CTCCACCTGGGGGTGGAGCCAGG + Intronic
1002418724 5:179134722-179134744 CTGGAGCTGGAGCTGGAGCCGGG - Intronic
1003237513 6:4309661-4309683 CTGCAGCTGGAGATATAGCCTGG + Intergenic
1003371975 6:5537421-5537443 CTCCAACTCGAGAGGAGGCCTGG - Intronic
1003371982 6:5537449-5537471 CTCCAGCTCGAGAGGAGGCCCGG - Intronic
1003371989 6:5537477-5537499 CTCCAACTCGAGAGGAGGCCCGG - Intronic
1003371996 6:5537505-5537527 CTCCAACTCGAGAGGAGGCCCGG - Intronic
1003372003 6:5537533-5537555 CTCCAACTCGAGAGGAGGCCCGG - Intronic
1003372010 6:5537561-5537583 CTCCAACTCGAGAGGAAGCCCGG - Intronic
1003372016 6:5537589-5537611 CTCCAACTCGAGAGGAAGCCCGG - Intronic
1003372022 6:5537617-5537639 CTCCAACTCGAGAGGAAGCCCGG - Intronic
1004069796 6:12288108-12288130 CTCCAGCTGAAGTAGAACCCAGG + Intergenic
1004851090 6:19699823-19699845 CTCCAGGTGGGGAGGTAGCCAGG - Intergenic
1004884961 6:20042508-20042530 CTGAAGCTGGAGCTGCAGCCTGG + Intergenic
1005755585 6:28923019-28923041 CTGTAGCTGGCGAGGAAGCCAGG - Intronic
1006075965 6:31532718-31532740 CTCCAGCTGTAGCAGAAACCTGG - Intronic
1007754346 6:44089295-44089317 CTGAAGCTGGAGCTGCAGCCTGG + Intergenic
1008862309 6:56163675-56163697 CTCCAGCTGGCGATAGAGCAAGG + Intronic
1012163234 6:95914943-95914965 ATCCAGCTAGAGATGCAGTCAGG - Intergenic
1012205436 6:96455434-96455456 ATCCATCTGGAAATGAAACCAGG - Intergenic
1012259191 6:97067822-97067844 CAGTGGCTGGAGATGAAGCCAGG - Intronic
1014146070 6:117999373-117999395 CTGAAGCTGGAGCTGCAGCCTGG - Intronic
1015729387 6:136332863-136332885 CTCCAGCTGCAAAGGAATCCAGG - Intergenic
1015823230 6:137284633-137284655 CCCCAGCTGCACATGCAGCCTGG + Intergenic
1016370329 6:143366867-143366889 CTCCAGCTGTAGATCCAGACAGG + Intergenic
1018378022 6:163231908-163231930 CTCCAGCTGAGAGTGAAGCCGGG - Intronic
1018915827 6:168131802-168131824 CTCCAGGTGGAGGCGAAGCTTGG + Intergenic
1018948515 6:168363731-168363753 CTAGTGCTGGAGATGAAGCCAGG + Intergenic
1019158407 6:170053681-170053703 CTCCAGCTGGGGCAGAGGCCGGG + Intergenic
1019506170 7:1392657-1392679 TTCCAGGTGGGGATGGAGCCGGG + Intergenic
1020313600 7:6888226-6888248 CTCCAGCTGGGGATGAACCAAGG - Intergenic
1020966337 7:14874087-14874109 CTCCAGTTGAAGATGAAGAAGGG + Intronic
1021148981 7:17126021-17126043 GTCTAGCTGGTGAGGAAGCCAGG - Intergenic
1021273956 7:18626207-18626229 TTCCAGAGGGAGATGAAGTCAGG + Intronic
1022181631 7:27926109-27926131 CTCAAGATGGAGAGGAAGGCTGG + Intronic
1022392108 7:29952164-29952186 CTCCAGCTGGTGCTGATGCACGG - Intronic
1022470456 7:30678951-30678973 CACCATCTGGAGAGGGAGCCTGG - Intronic
1022905137 7:34848479-34848501 CTCCAACAGCAGATGAAGGCTGG - Exonic
1023081970 7:36534327-36534349 GTCCAGCTGGAGGTGGAGCCAGG - Intronic
1023866020 7:44238816-44238838 CTCCAGCCTGAGCTGAAGGCTGG - Intronic
1024587416 7:50854001-50854023 CTCCTGGTGGGGAGGAAGCCTGG - Intergenic
1026091929 7:67307658-67307680 CTGAAGCTGGAGCTGCAGCCTGG + Intergenic
1026482726 7:70792161-70792183 TTCCAGCTGGTGATCAAGTCTGG + Exonic
1029706295 7:102278079-102278101 GTCCACCTGGAGCTGAGGCCAGG - Intronic
1029851351 7:103464746-103464768 ATACAGCTGGAGAGGAAGGCAGG + Intergenic
1030320952 7:108166841-108166863 CTCCAGCTGGAGATGGGGGCTGG - Intronic
1030679569 7:112420728-112420750 TGCCAGCTACAGATGAAGCCAGG - Intergenic
1031395025 7:121263255-121263277 CTCCAGCAGGACTTGAAGCATGG - Intronic
1031990631 7:128196641-128196663 CTACAGTTGGAGATAAGGCCTGG - Intergenic
1032487737 7:132300719-132300741 TCCCAGCTGGGGATGAAGCTTGG - Intronic
1035252897 7:157608713-157608735 CCCAGGCTGGAGATGAAGCCAGG + Intronic
1035451345 7:158979129-158979151 CTACAGCTGCAGATGGAGCTGGG + Intergenic
1036446883 8:8829252-8829274 CTCCAGGTGGGGGTGCAGCCCGG - Intronic
1036799746 8:11781529-11781551 CTCCAGCTGGTGACTAATCCAGG - Intronic
1037784302 8:21893411-21893433 CACCAGCTGGAGATGTTCCCTGG - Intergenic
1039612041 8:38927876-38927898 CTGGAGCTGGAGATGACGGCTGG + Intronic
1039893506 8:41700070-41700092 CTCCAGCTCCAGTTGAAGCTAGG - Intronic
1040576028 8:48652243-48652265 AACCAGCTGGAAATGAAACCTGG - Intergenic
1042789684 8:72590104-72590126 CTCCAAATGGAGTTGAACCCAGG - Intronic
1044867249 8:96584243-96584265 CTCCAGCCTGAGCTGAAGCCTGG + Intronic
1045713283 8:105011493-105011515 CTGTAGCTGGAGCTGCAGCCTGG - Intronic
1047174025 8:122523467-122523489 CTACAGCTGGAGAGGCAACCTGG - Intergenic
1048882919 8:138885086-138885108 CTCCCGCAGCAGATGAAGCCTGG - Intronic
1049103587 8:140597380-140597402 ACCCAGCTGGAGTTGAAGTCTGG + Intronic
1049784805 8:144445209-144445231 CTTCAGCTGCAGAAGTAGCCCGG + Intergenic
1050367931 9:4889718-4889740 CTCCAGTGGGAGATGAGGCATGG - Intergenic
1051493979 9:17698171-17698193 CTGCATCTGGACTTGAAGCCAGG - Intronic
1052820615 9:33135498-33135520 CTGCAGCTGCAGCTGCAGCCTGG - Intronic
1053274645 9:36774055-36774077 CTCCAGCAGCAGATGAAGTCTGG - Intergenic
1053365957 9:37522761-37522783 CACAAGCTGGAGATGGAACCTGG + Intronic
1053576511 9:39360506-39360528 CTCCAGCTGGACAGGAGGGCAGG + Exonic
1053841021 9:42188431-42188453 CTCCAGCTGGACAGGAGGGCAGG + Exonic
1054098079 9:60919197-60919219 CTCCAGCTGGACAGGAGGGCAGG + Intergenic
1054119480 9:61194827-61194849 CTCCAGCTGGACAGGAGGGCAGG + Exonic
1054588274 9:66987735-66987757 CTCCAGCTGGACAGGAGGGCAGG - Intergenic
1055415861 9:76082361-76082383 CTTCAGCTGTAGATGACCCCAGG + Intronic
1056974904 9:91243710-91243732 CTCCTGCTGGAGATCAGCCCGGG + Intronic
1057262480 9:93592901-93592923 CTCCAGTTGGAGAGGGAGTCTGG - Intronic
1059358520 9:113720072-113720094 CTCCAGCTGCAGATGGAGGCGGG - Intergenic
1059447500 9:114347846-114347868 TTCCAGCCGCAGACGAAGCCGGG + Exonic
1060733652 9:126052804-126052826 CCCCAGGTGGAGATGAGGCCGGG + Intergenic
1060818549 9:126648693-126648715 CTTCAGGTGAAGATGAGGCCTGG + Intronic
1061288423 9:129637392-129637414 GTGCAGCTGGAGAGGAAGCCTGG - Exonic
1062003419 9:134228002-134228024 CTCCCGCAGGAGGTGAAGGCAGG - Intergenic
1062055624 9:134468473-134468495 CCCCAGCAGGATATGAGGCCAGG + Intergenic
1203786327 EBV:129918-129940 GTCCTGCTGGAGATGAAGGGAGG - Intergenic
1186397761 X:9226800-9226822 CTCCAGTGGGAGAGGACGCCAGG + Intergenic
1187223810 X:17356264-17356286 GTCCAGCTGGAGAGGAAGGAGGG + Intergenic
1187722251 X:22163277-22163299 CTCCAGTTGGAAAGGAAGCTGGG + Intronic
1188440483 X:30210966-30210988 CTCAAGCCAGAGTTGAAGCCAGG + Intergenic
1190071470 X:47283441-47283463 CTGCAGCTGGAAATTAAGTCTGG + Intergenic
1190328801 X:49223215-49223237 CTCCAGCTTGAGATGCACCTCGG + Intronic
1191257105 X:58284315-58284337 GTCCCACTGGAGATGAAGACAGG - Intergenic
1192157794 X:68759269-68759291 CTCCAGCTGCAGAGCCAGCCTGG - Intergenic
1192225822 X:69227035-69227057 CTCCTGCTGAAGATGGGGCCTGG - Intergenic
1198312979 X:135438258-135438280 CTGCAGCTGGAGAAGGACCCTGG + Intergenic
1199455807 X:148027331-148027353 GTATAGCTGGAGAGGAAGCCAGG + Intergenic
1199673531 X:150166018-150166040 CTCCATCAGGAGATGGAGGCAGG - Intergenic