ID: 969306325

View in Genome Browser
Species Human (GRCh38)
Location 4:6328081-6328103
Sequence GGGCTCTCCCAGACCTCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 198}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969306325_969306330 10 Left 969306325 4:6328081-6328103 CCCTCAGAGGTCTGGGAGAGCCC 0: 1
1: 0
2: 0
3: 18
4: 198
Right 969306330 4:6328114-6328136 TGTTGACTGATGCCATCCACAGG No data
969306325_969306332 14 Left 969306325 4:6328081-6328103 CCCTCAGAGGTCTGGGAGAGCCC 0: 1
1: 0
2: 0
3: 18
4: 198
Right 969306332 4:6328118-6328140 GACTGATGCCATCCACAGGGTGG 0: 1
1: 0
2: 0
3: 13
4: 117
969306325_969306331 11 Left 969306325 4:6328081-6328103 CCCTCAGAGGTCTGGGAGAGCCC 0: 1
1: 0
2: 0
3: 18
4: 198
Right 969306331 4:6328115-6328137 GTTGACTGATGCCATCCACAGGG 0: 1
1: 0
2: 0
3: 9
4: 101
969306325_969306335 30 Left 969306325 4:6328081-6328103 CCCTCAGAGGTCTGGGAGAGCCC 0: 1
1: 0
2: 0
3: 18
4: 198
Right 969306335 4:6328134-6328156 AGGGTGGACAGCCCCCCACCAGG 0: 1
1: 0
2: 10
3: 433
4: 3960

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969306325 Original CRISPR GGGCTCTCCCAGACCTCTGA GGG (reversed) Intronic
900130918 1:1086925-1086947 GGGCTCTGCCACATCTCTAAAGG - Intronic
900422832 1:2562985-2563007 GGGGGCTCCCAGTTCTCTGAGGG + Intronic
900940921 1:5798176-5798198 GGGCTCTCCTAGGCCACTGCTGG - Intergenic
901845945 1:11982170-11982192 GTGCTCTCCTGGACCTCTGGTGG + Intronic
901869622 1:12130327-12130349 GGGCTCTCCCTGACCTCATCTGG - Intronic
902754868 1:18542359-18542381 GGGCTCTCCCATCCCTAGGAGGG + Intergenic
903072282 1:20732287-20732309 GGGCTCGCCCGGAGCTCAGAAGG + Exonic
903650106 1:24916945-24916967 TGGGTCTCCCAGACCTGAGATGG - Intronic
905290899 1:36921060-36921082 TGGCCCTCCCAGCCCTCTGGAGG - Intronic
907540829 1:55214759-55214781 GGGCAACCCCAGACCTCTGTGGG - Intronic
907669237 1:56460270-56460292 GGGATCTCCCATACCTCCAATGG + Intergenic
908336273 1:63127324-63127346 GGTCTCCCCCAGATCTCTGAGGG - Intergenic
910300295 1:85698832-85698854 GTGCTATCCCAGACCTATGAGGG + Intronic
915170301 1:153972872-153972894 GGCCTCACCATGACCTCTGAGGG + Intronic
915347886 1:155207367-155207389 GGGCTCTCCCGGAGGTCTGGTGG - Intronic
919747264 1:201016711-201016733 TGGCTGTCACAGAGCTCTGATGG - Intronic
920913615 1:210240025-210240047 GGGCTTTTCCTGACCTCTTATGG + Intronic
921620256 1:217317911-217317933 GGCCTCTCCCAGACTACTGAAGG - Intergenic
924130487 1:240901813-240901835 GTATTCTCCCAGACCTCTGCAGG + Intronic
1062950148 10:1492868-1492890 AAGCTCTCCCAGGCCTCTCATGG - Intronic
1064030697 10:11880785-11880807 CAGCTCTCCTAGAACTCTGATGG + Intergenic
1066478817 10:35774909-35774931 TGGCTCTCCCAGATCTCTGCTGG + Intergenic
1067109712 10:43391572-43391594 AGGCTGCCCCAGACATCTGAAGG - Intronic
1069624458 10:69859377-69859399 AGCCCCTCCCAGGCCTCTGAGGG + Intronic
1069921725 10:71819656-71819678 GGGCCCTCCCAGACCCAAGAGGG + Intronic
1070779792 10:79130902-79130924 GGGCCCTCCCAGTTCTTTGAAGG + Intronic
1070831878 10:79422739-79422761 AGGCCCTCCCAGACCTCTCGCGG + Intronic
1070969124 10:80549173-80549195 GGGATCTCCGAGAGCTGTGATGG + Intronic
1071475272 10:86020130-86020152 GGGCACTGCCAGCCCTCTGAGGG - Intronic
1072737329 10:97888051-97888073 GGGATCTCTCGGACCTCTGCTGG - Intronic
1073426775 10:103459788-103459810 GGGCTCTCCCTGACCTCCCAAGG + Intergenic
1073839923 10:107486602-107486624 GGGCTATCACATACCTGTGAGGG + Intergenic
1074869665 10:117566835-117566857 GGGCTTTGCTAGAACTCTGAGGG + Intergenic
1075122340 10:119673140-119673162 AGGTTCTCCCTGTCCTCTGAGGG + Intronic
1075714981 10:124550803-124550825 CAGCTGTCCCAGACCTCTGTGGG - Intronic
1075803869 10:125171139-125171161 GGTCTCTACCAAACTTCTGATGG + Intergenic
1076667427 10:132101127-132101149 GGGCACTCCCAGGCCTGGGACGG + Intergenic
1076888983 10:133274866-133274888 AGGCTGTCCCAGAGCTCTGCAGG - Intronic
1079246051 11:18753124-18753146 GGATTTTCCTAGACCTCTGAGGG - Intronic
1082616541 11:55368013-55368035 GGGCTCACACAGAACCCTGAGGG + Exonic
1082626319 11:55491243-55491265 GGGCTCACACAGAACCCTGAGGG + Intergenic
1083187415 11:61025906-61025928 GGGCTCTCTCAGATGTCTGGAGG - Intergenic
1083332832 11:61906956-61906978 GGGCGGTCCCAGAACTCTCATGG - Intronic
1083775604 11:64893111-64893133 GGTCTCGCCCAGGCCTCTGTGGG - Intergenic
1084741966 11:71145920-71145942 GGGTCCTCCCAGCCCACTGAGGG + Intronic
1089337383 11:117734497-117734519 GGGCTCTCCCCCAGCTCTGCTGG + Intronic
1090175012 11:124640921-124640943 GGGCTCTTTCAGACCTCTGTGGG - Intronic
1091356884 11:134944219-134944241 GGACTCTGCCTGAGCTCTGAGGG - Intergenic
1106493576 13:30252695-30252717 GGGGACTCCCATATCTCTGAGGG + Intronic
1111843037 13:93473501-93473523 GGGCCTTCCCAGACCCCTGAGGG + Intronic
1113896582 13:113768471-113768493 GGGCTCTGCCGGACCCCTGGTGG + Intronic
1117293475 14:54356410-54356432 GTGCTTTCCCAGACCACTGCTGG - Intergenic
1119491691 14:75039472-75039494 GGGCTTTCCCAAACCTGTGTAGG + Intronic
1122468016 14:101947686-101947708 GGGCCCTGCCAGTCCTGTGATGG + Intergenic
1122691246 14:103533069-103533091 GGCCTCTCCCAACCCCCTGATGG + Intronic
1123790334 15:23713047-23713069 GGGCCCTCCCCGACCTTTGTGGG - Intergenic
1126982892 15:54266367-54266389 AATCTCTCCCAGAACTCTGAAGG - Intronic
1128217687 15:65945582-65945604 GTGCTCTCACTGCCCTCTGAGGG - Intronic
1130062617 15:80580703-80580725 TGGCTCTCCGAGAGCCCTGAGGG - Intronic
1132565266 16:619598-619620 TGGCTCTTCCAGAACTCTTAGGG - Intronic
1132608085 16:801775-801797 GGGGTGGCCCAGACCTCTGCAGG + Intergenic
1132906848 16:2286867-2286889 GCGCTCTCCCACATCTCTGAAGG + Exonic
1132957038 16:2599767-2599789 TGGCTCTCTCAGATCTCTCAGGG + Exonic
1134121515 16:11587359-11587381 GGGCGCTCCCGGCCCTCTGGAGG + Exonic
1135070724 16:19349194-19349216 GGGCTCTCCCAGACCAGGCAGGG - Intergenic
1135825327 16:25722250-25722272 GGGCTCTACCAGATCTCAGAGGG + Intronic
1136286812 16:29248979-29249001 GGGCTCTCACTGATCTCAGAGGG - Intergenic
1137238239 16:46633289-46633311 GGGCTTTTACAGACCTCAGAGGG + Intergenic
1140035951 16:71371473-71371495 AGGCTCTGCTAGAGCTCTGAGGG + Intronic
1141180846 16:81752568-81752590 GGGCTCACAGAGACCTCAGATGG - Intronic
1141614474 16:85202663-85202685 GGGCTCTCCCAGAACCCTGTGGG - Intergenic
1142092410 16:88221614-88221636 GGGCTCTCACTGATCTCAGAGGG - Intergenic
1142210711 16:88807155-88807177 AGCCTCTCCCAGTGCTCTGAAGG + Exonic
1142866106 17:2792534-2792556 GGACTCTCCCAGACGGCTCATGG - Intronic
1143011918 17:3870683-3870705 GGGCTCCCCAAGACCACTGGTGG - Intronic
1143385539 17:6527905-6527927 GGGGTCTCCCAGGGCTCTGGAGG + Intronic
1144851202 17:18244951-18244973 TGGATTTCCCAGACCCCTGAGGG + Exonic
1146484661 17:33233159-33233181 TGGCTTACCCAGACCGCTGAGGG - Intronic
1148050443 17:44767609-44767631 GGGCTCTCCCAGCCCCCTCCTGG + Intronic
1148634019 17:49133211-49133233 GGGCACTCACATACCCCTGACGG - Exonic
1150847281 17:68672305-68672327 GTTCTTTCCCATACCTCTGATGG + Intergenic
1151014170 17:70535162-70535184 GGTCTCTCCCTGACCATTGAAGG + Intergenic
1154497781 18:14975082-14975104 GGACTCTGCCTGAGCTCTGAGGG + Intergenic
1158985701 18:62814401-62814423 GTGCTCCCCTAGACCTCTTACGG + Intronic
1159981697 18:74789293-74789315 AAGCTCTCCCACACCTCTCAGGG - Intronic
1161731907 19:5965789-5965811 GGGGTCTCCCAGACGCGTGATGG + Intronic
1162430674 19:10626186-10626208 GGGCTCTCCCAGCCCTGTCTTGG + Intronic
1165827131 19:38711845-38711867 GGGCTCTGCCTGGCCTCTGGAGG - Intronic
1167721469 19:51182948-51182970 AGGCTGTCCCAGACCCCTGTGGG + Intergenic
1167763507 19:51463822-51463844 AGGCTGTCCCAGACCCCTGTGGG - Intergenic
1168471010 19:56640829-56640851 GGGCTTCCCCAGAATTCTGAGGG - Intergenic
925577101 2:5371172-5371194 GGGCTCTCCCAGCCTTCTGCTGG + Intergenic
925585304 2:5459065-5459087 GGGCTCTCACAGACTTCAGTGGG - Intergenic
925638937 2:5969014-5969036 GGTGTCTCCCAAAGCTCTGAGGG - Intergenic
926320927 2:11747949-11747971 GGGCTCTGCCTGAGCTCTGTGGG + Intronic
928085601 2:28344604-28344626 GGGCTCTCCTAGTTCTCTGAAGG - Intergenic
932446793 2:71786490-71786512 GGTCTCACCCAGGCCTCTGTAGG + Intergenic
933782768 2:85813504-85813526 TGGATCTCCCAGACCTCTGCTGG + Intergenic
935673182 2:105572649-105572671 CACCTCTCCCAGACCCCTGAAGG - Intergenic
935893257 2:107703931-107703953 AGGCTCATTCAGACCTCTGATGG + Intergenic
937038023 2:118797838-118797860 TGGCTCCCTCACACCTCTGATGG + Intergenic
937656203 2:124379698-124379720 GGGCGCTGCCAGACCTCACAAGG - Intronic
940099536 2:150018302-150018324 GGACTCTCCTAGTCCTGTGAAGG - Intergenic
942509343 2:176680082-176680104 GGACTCTCCCAGACCACTCTGGG - Intergenic
944104897 2:196069115-196069137 TGTTTCTCCGAGACCTCTGAGGG - Intergenic
946575396 2:221070621-221070643 GGGCTCTCTCACATCTCTGCAGG - Intergenic
947791021 2:232869402-232869424 GGGCGCTGACAGAACTCTGAGGG + Intronic
948530012 2:238598249-238598271 GGTCACTCCCAGACCTCGGCAGG + Intergenic
1172092857 20:32446157-32446179 GGACTCGCCCAGACCTCAGCAGG - Exonic
1172121032 20:32598826-32598848 GGGCTCTCCCAGCCAGCTGAGGG + Intronic
1172931029 20:38586473-38586495 GGGCACTCCCTCCCCTCTGAGGG + Intronic
1173862704 20:46294679-46294701 GGGCTCCCCCCAACCTCTGCTGG + Intronic
1175237456 20:57524833-57524855 GGGCCCTGCCAGGCCTCCGAGGG - Intronic
1175250280 20:57605024-57605046 GGGCTCTCCCAGTCCTCCCAGGG + Intronic
1176342431 21:5710696-5710718 GGGCGCGCCCAGACCTTTGCAGG + Intergenic
1176474685 21:7142848-7142870 GGGCGCGCCCAGACCTTTGCAGG + Intergenic
1176502396 21:7613760-7613782 GGGCGCGCCCAGACCTTTGCAGG - Intergenic
1176536752 21:8108765-8108787 GGGCGCGCCCAGACCTTTGCAGG + Intergenic
1178858997 21:36273608-36273630 GTGCCTTCCCAGACCTCTGCAGG - Intronic
1179507759 21:41853017-41853039 GGACTCTCCCCAACCTCTGGTGG - Intronic
1179647981 21:42786860-42786882 GAGCTATCCCAGGCCTCTCAGGG - Intergenic
1179787532 21:43738179-43738201 GGGCCCACCCAGAGCCCTGATGG - Intronic
1179821293 21:43938899-43938921 GGGCTCCCCCAGGCCTGGGAAGG + Intronic
1180060994 21:45385027-45385049 GGGCTCCTCCAGGCCACTGAAGG - Intergenic
1180068052 21:45422612-45422634 GGGCTCTCCCAGCCGTCGGTTGG + Intronic
1180839804 22:18954083-18954105 GGCCTCTCCCCGAGCTCTGGCGG + Intergenic
1181062091 22:20286396-20286418 GGCCTCTCCCCGAGCTCTGGCGG - Intergenic
1181459076 22:23075730-23075752 GGGCTCAGCCAGGCCTCTCATGG + Intronic
1182062276 22:27406795-27406817 GTGGTCACCCAGACCCCTGATGG - Intergenic
1183478040 22:38046679-38046701 AGGCTCCCCCAGGCCTCCGAGGG - Intergenic
1183718405 22:39547944-39547966 GGGGACCCCCAGACCTCTGCAGG + Intergenic
1203241699 22_KI270733v1_random:25176-25198 GGGCGCGCCCAGACCTTTGCAGG + Intergenic
949318902 3:2786825-2786847 CTGCTCTCCCTGACCTGTGATGG - Intronic
950180473 3:10909539-10909561 CAGCTCTCCCACAACTCTGAGGG + Intronic
950665642 3:14493338-14493360 GGGCTGTCCCAGGTCTCTGTGGG - Exonic
951896021 3:27610435-27610457 GTGATCTCACAGACTTCTGAAGG - Intergenic
951986373 3:28626121-28626143 TGGCTCTCCTGGACCTCTGACGG - Intergenic
952702111 3:36338695-36338717 GGTTTCTCCCATACCTCAGAAGG - Intergenic
953717279 3:45326337-45326359 GGGCACTCTAAGACCACTGAAGG - Intergenic
953791352 3:45950326-45950348 GGCCTCTGCCATATCTCTGAAGG - Intronic
955355244 3:58225655-58225677 GAGCTCACCCAGTCCTCAGAGGG - Intergenic
956736463 3:72242367-72242389 TGTCTCTCCCAGACCTCTCCAGG + Intergenic
961324592 3:126102781-126102803 GGGAACTCACAGGCCTCTGAAGG + Intergenic
961393251 3:126569140-126569162 GGCCTCTCCCAGCCCTGTCAAGG - Intergenic
968678508 4:1899387-1899409 GGGCGGACCCTGACCTCTGATGG - Exonic
968730902 4:2268765-2268787 GGCCACATCCAGACCTCTGAGGG + Intergenic
969158060 4:5230623-5230645 GGGCTGTCCCAGACCTTTCCAGG - Intronic
969286380 4:6204990-6205012 TGGCTCTCCCAGGCCTTGGAAGG + Intergenic
969306325 4:6328081-6328103 GGGCTCTCCCAGACCTCTGAGGG - Intronic
978287387 4:107095019-107095041 GGGCCCACTCAAACCTCTGAGGG - Intronic
982797958 4:159668293-159668315 GGGCTCTCCAAGAATTCAGAGGG + Intergenic
983935771 4:173501608-173501630 GGGCTCTCCCTGACCCTAGAGGG + Intergenic
986052519 5:4103448-4103470 GGGCTGTCCTGGACCTCGGAGGG - Intergenic
986804203 5:11292833-11292855 GGTCTCTTCCAGGCCTCTGCTGG - Intronic
989169046 5:38457318-38457340 GGGCTCTCTCACAGTTCTGAAGG + Intronic
990639168 5:57762309-57762331 GGGCTTTTACAGACCTCAGAGGG - Intergenic
990680732 5:58241507-58241529 GGGCTCTGCCTGACCAGTGAAGG + Intergenic
991527238 5:67574171-67574193 TGCCTCACCCAGACCACTGAAGG - Intergenic
991653831 5:68883231-68883253 CGGAACTCCCAGGCCTCTGAGGG - Intergenic
992782565 5:80141517-80141539 GGGCTCTGCTAGACCTCAGCAGG + Exonic
993095254 5:83472800-83472822 GGGGCCTCCCAGACCTCCGCGGG - Intronic
994548680 5:101204776-101204798 GGGCTCATGAAGACCTCTGACGG - Intergenic
998523562 5:142821957-142821979 GGGCTGACCCAGCCCTTTGAGGG + Intronic
999202873 5:149828737-149828759 GGGCCCTTCCAGATCTCTGTCGG - Intronic
1004297778 6:14429607-14429629 GTGCACTCCCAGACCTCCAAGGG - Intergenic
1006147779 6:31969533-31969555 GGGCTCTCAGGGACCCCTGAGGG + Exonic
1007322426 6:41037375-41037397 GGGGCCTCCCAGGGCTCTGAAGG - Intronic
1007449314 6:41931082-41931104 GGGCAGTCACAGACTTCTGAGGG - Intronic
1007461992 6:42025731-42025753 TGGCTCTCTCAGAGCTGTGATGG + Intronic
1007687072 6:43673355-43673377 GGCCTCTCCCAGGCTTCAGAGGG + Intronic
1008425742 6:51353995-51354017 AGGTTCTCACAGACCACTGAGGG + Intergenic
1008508922 6:52258130-52258152 GAGCACTCCCAGCCCTTTGAAGG + Intergenic
1011941119 6:92844670-92844692 GGGCTCTGCCACAGCTCAGATGG - Intergenic
1012872135 6:104685000-104685022 GGGCTTTCCAAGGCTTCTGATGG - Intergenic
1015455636 6:133424204-133424226 GGGCTTTTACAGACCTCAGAGGG + Intronic
1016846220 6:148570940-148570962 TCTCTCTCCCAGCCCTCTGAAGG - Intergenic
1018763246 6:166908722-166908744 GGCTTTTCCCAGTCCTCTGAAGG + Intronic
1019303511 7:321631-321653 GGGCGATCCCAGAGCTCTGTGGG - Intergenic
1019900848 7:4019748-4019770 GGGCCCTCCGAGACCCATGAGGG - Intronic
1023322576 7:39013976-39013998 GGACTCTCTCATTCCTCTGAAGG - Intronic
1023705067 7:42932494-42932516 GGGCTTTCCCAGTCCTCCGTGGG + Exonic
1025093723 7:56082238-56082260 GGGGTCCCGCAGACCTCTGCAGG + Exonic
1033545969 7:142400459-142400481 GGGCTCTCCGACTCCTGTGAAGG - Intergenic
1034151045 7:148915575-148915597 GGGCTCTCAGTGACCTTTGACGG + Intergenic
1034241594 7:149615440-149615462 TAGGTCTCCCAGACCTCTGTAGG - Intergenic
1034544380 7:151780357-151780379 GAACTATCCCAGGCCTCTGATGG + Intronic
1035045049 7:155960116-155960138 GGCCTTTCCCAGACCTCAGCAGG + Intergenic
1035493037 7:159296359-159296381 GGACCCTCCCAGAACTCTGGAGG - Intergenic
1036739489 8:11347802-11347824 GGGCTCGCCCCGACCTCGGCCGG - Intergenic
1037690800 8:21179869-21179891 GGGCACACCCACAGCTCTGAAGG - Intergenic
1038535464 8:28350000-28350022 GGGCTCTCCCACACATCCCAGGG - Intronic
1044259193 8:90098218-90098240 GGGCTCTTATAGACCTCAGAGGG + Intergenic
1049216243 8:141409661-141409683 CTGCTCTCCCAGGCATCTGAAGG - Intronic
1050455872 9:5833264-5833286 GGGCTTTTCCAGCCCTCTGTAGG + Intergenic
1053173569 9:35907303-35907325 GGGCTCTGTCTGAGCTCTGAGGG + Intergenic
1053363794 9:37508656-37508678 GGGCTCTCCCAGACCTACCCAGG + Intergenic
1057389322 9:94629684-94629706 GGGCTCTCCCGGTCCTCTCTTGG - Intronic
1061012445 9:127963627-127963649 GAGCTCTCCCAGCCCTGGGAAGG + Intronic
1061140658 9:128764257-128764279 GGCCTCGTGCAGACCTCTGATGG - Intronic
1061141887 9:128772126-128772148 GGGCTCTCCCTGGCCTCCGAGGG + Intronic
1203458022 Un_GL000220v1:8251-8273 GGGCGCGCCCAGACCTTTGCAGG + Intergenic
1186889662 X:13947798-13947820 GGGCTCTTCCAGTCATCTGCAGG + Intergenic
1187338768 X:18403053-18403075 AGGCTCTCACAGCCCTCAGAAGG + Intergenic
1189124212 X:38428757-38428779 GGCCTCTCTTAGATCTCTGAAGG - Intronic
1189446527 X:41085807-41085829 GGGCTCTCGCTGAGCTCAGACGG - Exonic
1192057412 X:67786661-67786683 GGCCTCTCTCAGACCTTTCAAGG + Intergenic
1192128334 X:68523768-68523790 TGGCTCTCTCAGACCTTTGTTGG - Intronic
1192939786 X:75900659-75900681 GGGCTCTCCCTGAACCCTGGGGG + Intergenic
1194571544 X:95559680-95559702 GGGTTCCACCAGTCCTCTGATGG - Intergenic
1195063536 X:101219201-101219223 GGCTTCTCCCAGGTCTCTGAGGG + Intergenic
1195569796 X:106385399-106385421 TGCCCCTCCCAGAACTCTGAGGG - Intergenic
1196768789 X:119273068-119273090 GGGCTCACCCAGGCCGCTGTTGG - Intergenic
1197309269 X:124883975-124883997 GGGTGATCCCAGACCTCTGGTGG + Intronic
1199763675 X:150925117-150925139 GGGCTCTACCATACATATGAAGG + Intergenic
1200906013 Y:8483989-8484011 GGGCTTTCTGAGACCTCTGCAGG - Intergenic
1201439562 Y:13993352-13993374 GGTTTCTCCCATACCTCAGAGGG - Intergenic
1201445011 Y:14049356-14049378 GGTTTCTCCCATACCTCAGAGGG + Intergenic