ID: 969306445

View in Genome Browser
Species Human (GRCh38)
Location 4:6328692-6328714
Sequence GTCTCTCAACCCCACCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 233}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969306445_969306448 -9 Left 969306445 4:6328692-6328714 CCAGGCAGGTGGGGTTGAGAGAC 0: 1
1: 0
2: 3
3: 20
4: 233
Right 969306448 4:6328706-6328728 TTGAGAGACGGCTGGACTTGTGG 0: 1
1: 0
2: 2
3: 13
4: 104
969306445_969306450 11 Left 969306445 4:6328692-6328714 CCAGGCAGGTGGGGTTGAGAGAC 0: 1
1: 0
2: 3
3: 20
4: 233
Right 969306450 4:6328726-6328748 TGGATTGTGACAAGCCCTGGAGG 0: 1
1: 0
2: 0
3: 12
4: 162
969306445_969306452 18 Left 969306445 4:6328692-6328714 CCAGGCAGGTGGGGTTGAGAGAC 0: 1
1: 0
2: 3
3: 20
4: 233
Right 969306452 4:6328733-6328755 TGACAAGCCCTGGAGGGTGTAGG 0: 1
1: 0
2: 2
3: 16
4: 192
969306445_969306451 12 Left 969306445 4:6328692-6328714 CCAGGCAGGTGGGGTTGAGAGAC 0: 1
1: 0
2: 3
3: 20
4: 233
Right 969306451 4:6328727-6328749 GGATTGTGACAAGCCCTGGAGGG 0: 1
1: 0
2: 0
3: 13
4: 155
969306445_969306449 8 Left 969306445 4:6328692-6328714 CCAGGCAGGTGGGGTTGAGAGAC 0: 1
1: 0
2: 3
3: 20
4: 233
Right 969306449 4:6328723-6328745 TTGTGGATTGTGACAAGCCCTGG 0: 1
1: 0
2: 1
3: 4
4: 81
969306445_969306455 28 Left 969306445 4:6328692-6328714 CCAGGCAGGTGGGGTTGAGAGAC 0: 1
1: 0
2: 3
3: 20
4: 233
Right 969306455 4:6328743-6328765 TGGAGGGTGTAGGAGCTCCAAGG 0: 1
1: 0
2: 2
3: 22
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969306445 Original CRISPR GTCTCTCAACCCCACCTGCC TGG (reversed) Intronic
902931399 1:19734198-19734220 CTCTCTCCACCTCACATGCCGGG - Intronic
902943275 1:19815486-19815508 CTCTCTCACCCCCACTTCCCAGG + Intergenic
903012350 1:20340117-20340139 TTCTCTCGCCCCCTCCTGCCTGG + Intronic
904261557 1:29290585-29290607 GTCTCTCACCTCCTCCTCCCTGG + Intronic
904292883 1:29498991-29499013 GTCTCTCACCTCCTCCTCCCTGG - Intergenic
904334007 1:29785306-29785328 GTCTCTCACCTCCTCCTCCCTGG - Intergenic
904412381 1:30332270-30332292 GTCTCTCACCTCCTCCTCCCTGG + Intergenic
905441306 1:37997928-37997950 CTCACTCACCCCCACCTGGCTGG + Intronic
906203079 1:43972236-43972258 ATCTCCGACCCCCACCTGCCTGG + Exonic
906301820 1:44688015-44688037 GTGTCTCAACCCCACCTCCCTGG + Intronic
906829093 1:49012981-49013003 CTCTCACAAGCCCTCCTGCCTGG + Intronic
907281318 1:53349086-53349108 CCCTCCCAGCCCCACCTGCCAGG - Intergenic
907289552 1:53404230-53404252 CTCTCCCCACTCCACCTGCCTGG + Intergenic
907592448 1:55688293-55688315 GTCTGTCTGCCCCATCTGCCTGG + Intergenic
907722327 1:56983653-56983675 ATCTCCAAACCCCACCTGCTAGG + Intergenic
907722648 1:56986600-56986622 ATCTCCAAACCCCACCTGCTGGG - Intergenic
908396327 1:63728779-63728801 GTGTCTCCGCCCCACCTCCCAGG - Intergenic
908449310 1:64235892-64235914 GTATATCAACCCTACGTGCCAGG + Intronic
910288338 1:85577773-85577795 GTCTCTCAACCGCTGCTGCCAGG - Intronic
910802647 1:91161159-91161181 GTCTCTCAGCTCCACATCCCAGG - Intergenic
912475158 1:109930141-109930163 GCATCTCAGCCCCACCTGCATGG + Exonic
913669709 1:121085105-121085127 CTCTCCCAACCCCACCCGACTGG + Intergenic
914913682 1:151805332-151805354 GTGCCTCAACCCCCGCTGCCTGG + Exonic
915015017 1:152724815-152724837 GAATCCCAACCCCACTTGCCTGG + Intergenic
915366881 1:155321705-155321727 GTCTCTCACATCCACCTACCTGG - Exonic
915528464 1:156490176-156490198 TTCTCACAACCCCTCCTGCGAGG + Intronic
915622066 1:157092107-157092129 GTCTCCCCACCCCACTTGCCTGG + Exonic
919931741 1:202225563-202225585 TTCTCTCCACCCCACCTCCTGGG - Intronic
922868526 1:228881435-228881457 GTCTCTCATCTCCACATCCCTGG + Intergenic
923295411 1:232590200-232590222 GTCTCTCACCTCCACCTCCAGGG + Intergenic
1064222677 10:13455346-13455368 CTCTCCCCACCCCTCCTGCCTGG - Intronic
1066417862 10:35237887-35237909 TTGTCTCAACCCCTGCTGCCTGG - Intergenic
1067087904 10:43252537-43252559 GTCTTCCAAACCCAACTGCCTGG + Intronic
1067582183 10:47452765-47452787 GTCTCCCTCCCCCACCGGCCAGG + Intergenic
1069829722 10:71275397-71275419 GTCTCTCAGCCCTGCCTCCCTGG - Intronic
1070386981 10:75934616-75934638 GTCTCTCTTCCCCACTAGCCAGG - Intronic
1070675621 10:78409593-78409615 GGCTCTGGACCCCAACTGCCTGG - Intergenic
1071462965 10:85915988-85916010 TTCTCTCGTTCCCACCTGCCAGG + Intronic
1072303931 10:94088395-94088417 GTCTGTCAACAGCACCTGCTTGG - Intronic
1072987526 10:100154474-100154496 GTATCTCAACCCCAAATGCCAGG + Intronic
1073324575 10:102634894-102634916 GTGACTCAACCCAGCCTGCCAGG + Intergenic
1073465150 10:103690847-103690869 GACTCTCAACTCCAGCTGTCTGG + Intronic
1074985095 10:118651702-118651724 GTCTGTCAACCCCAGCTGGGAGG + Intergenic
1075774099 10:124968441-124968463 GTCTCTCAAGCCCCCCACCCCGG - Intronic
1076550746 10:131276707-131276729 TTTTCTCTACACCACCTGCCAGG + Intronic
1076988492 11:256797-256819 GGCTTTCCACCCCACCTTCCGGG + Intergenic
1080265213 11:30393156-30393178 GCCTCTCCACCACACCTGCTGGG + Intronic
1080935811 11:36862233-36862255 CCCTCTCAACCCCACCTTTCAGG - Intergenic
1082803017 11:57427969-57427991 GACTCCCAACCCCAGCTACCTGG + Intergenic
1083053820 11:59800756-59800778 GTCTTTCCTCCCCACCTTCCAGG + Intronic
1083856553 11:65396008-65396030 GTCCCTGACCCCCACCTGCGAGG - Intronic
1084467460 11:69334354-69334376 GTCTCTCAACCTCTCCAGCTTGG - Intronic
1086033585 11:82389252-82389274 GCCGCTCACCACCACCTGCCTGG - Intergenic
1089555904 11:119315936-119315958 GTCACTCGACACCATCTGCCTGG + Intronic
1090642290 11:128739981-128740003 GTCTCTCATCCCCACGTGTGAGG + Intronic
1091668174 12:2434188-2434210 GTTTGTCAAGCCCACCTGTCAGG + Intronic
1094492745 12:30971137-30971159 GCCTCTCATCCCAACCTGCCTGG + Intronic
1096039630 12:48502141-48502163 GTCTCTGCACCCAGCCTGCCAGG + Intergenic
1096616529 12:52836191-52836213 GCCTCTCACTCCCACCAGCCTGG - Intergenic
1096747746 12:53739421-53739443 GGCTCTCACCCTCACCTTCCTGG - Intergenic
1099413882 12:82363172-82363194 ATCTCTTAACTCCACATGCCTGG + Intronic
1099914772 12:88878535-88878557 GTCTCACAGCCCCCTCTGCCTGG + Intergenic
1101441393 12:104706689-104706711 GGCTCTCAACACCACCTGCCTGG + Intronic
1102583628 12:113908098-113908120 CTCACTCAACCCATCCTGCCTGG + Intronic
1102723726 12:115039855-115039877 GTCACTCCACCACTCCTGCCAGG + Intergenic
1103255575 12:119539121-119539143 GTCTGTCAACCCCTCCTGGGAGG + Intronic
1103339519 12:120214069-120214091 GTCTCCCACCCCCACCTCCCCGG + Intronic
1104732992 12:131118900-131118922 GACCCTCAAGACCACCTGCCTGG - Intronic
1105020175 12:132811014-132811036 CTCTCTCTACCTCAGCTGCCAGG + Intronic
1105511214 13:21053259-21053281 CCAACTCAACCCCACCTGCCTGG + Intronic
1108383876 13:49880089-49880111 GTCTCTCAACCCCTGCTGGGAGG - Intergenic
1113212809 13:108002512-108002534 GACTCACAATTCCACCTGCCTGG - Intergenic
1113450297 13:110404635-110404657 GTTTCTCAGACCCACCTCCCTGG - Intronic
1113468095 13:110525985-110526007 TGCTCCCAACCACACCTGCCGGG + Intronic
1113812837 13:113152996-113153018 GTCTCTCCTCCCCACTGGCCCGG - Intergenic
1116385919 14:44329817-44329839 CTCTATCTACCCCACCTACCTGG + Intergenic
1116457291 14:45134305-45134327 GTCCCTCAGCCGCACCAGCCCGG + Intronic
1117032959 14:51694068-51694090 TTCTATCAACCACACCTGTCAGG - Intronic
1119659567 14:76440597-76440619 CTCTCTCAACCCATCCTGTCTGG + Intronic
1119897581 14:78232851-78232873 TTCTCTCACCCCCTCCTCCCTGG - Intergenic
1122799847 14:104224030-104224052 GGGCCTCAACCCCACCTACCCGG + Intergenic
1122835466 14:104428625-104428647 GTCTCACCACCCAACCAGCCAGG + Intergenic
1123043036 14:105498283-105498305 GTCACTCCTCCACACCTGCCTGG + Intronic
1125187215 15:36944836-36944858 TTATCTCGACCCCACCTCCCTGG + Intronic
1125903987 15:43373616-43373638 GTCTCTGGAGCCCAACTGCCTGG - Intronic
1127555989 15:60088264-60088286 GTCTCTCATCACCACCTGTTTGG - Intergenic
1128052398 15:64675581-64675603 GGCTCTGAACCCCAGCAGCCAGG + Exonic
1128688079 15:69701982-69702004 GACTGTCTCCCCCACCTGCCTGG - Intergenic
1129205198 15:74033306-74033328 GTCTCACCACCCCACCTGGATGG + Exonic
1130538415 15:84803143-84803165 GTGCCCCAACCCCACCTGTCAGG - Exonic
1131117910 15:89805753-89805775 GTCCCTCATCCCCAGCTCCCTGG + Intronic
1131310238 15:91284052-91284074 GTTTATCAACTCCACCTTCCTGG + Exonic
1131562475 15:93456612-93456634 GCCACTCAGCCCCACCTTCCTGG - Intergenic
1131958901 15:97767289-97767311 GTCACTCTACCACAACTGCCTGG - Intergenic
1132702910 16:1229649-1229671 GACTCTCAGGCTCACCTGCCAGG + Exonic
1132705413 16:1241219-1241241 GACTCTCAGGCTCACCTGCCAGG - Exonic
1132708543 16:1256582-1256604 GACTCTCAGGCTCACCTGCCAGG - Exonic
1132753020 16:1467561-1467583 GCCTCTGACCCCCACCTCCCAGG + Intronic
1132908594 16:2297159-2297181 CTCTCACAAGCCCCCCTGCCTGG + Intronic
1133108175 16:3527808-3527830 GTCTCTCTGCCTCAGCTGCCAGG + Intronic
1134605081 16:15563944-15563966 CTCACTCACCCCCACCTCCCAGG - Intronic
1135025826 16:18998342-18998364 GTTTCCCAACCCACCCTGCCTGG - Intronic
1135238322 16:20779512-20779534 CATTCTCAACCCCACATGCCTGG + Intronic
1135324854 16:21519870-21519892 GCCGCTCTTCCCCACCTGCCCGG - Intergenic
1135422409 16:22314005-22314027 TTCTCTCAACCCCACCCGCCAGG - Intronic
1135767417 16:25189618-25189640 GGCTCTAAAGCCAACCTGCCTGG - Intergenic
1136403551 16:30030880-30030902 GCCTCCCCTCCCCACCTGCCTGG - Exonic
1137627692 16:49920019-49920041 CTCTCTGAAGCCCACCTTCCTGG - Intergenic
1137732154 16:50697122-50697144 GTCTACCAACCCCACCTTCAAGG - Exonic
1138049328 16:53759982-53760004 TTCTCTCAATCCCAACAGCCAGG - Intronic
1139259634 16:65579243-65579265 GTCTTTCAACTCCCCCTGCCCGG + Intergenic
1142009814 16:87708131-87708153 TTCTCTCTACCCCTCCTGCACGG - Intronic
1142037059 16:87868927-87868949 GCCGCTCTTCCCCACCTGCCCGG - Exonic
1142208088 16:88793453-88793475 CTCTCTCAACCCCGAATGCCCGG - Intergenic
1142858709 17:2748727-2748749 GTCCCTCAACCCCACATCCTTGG + Intergenic
1142957305 17:3530649-3530671 GTCTCTCGTCACCACCTGCCTGG - Intronic
1143216860 17:5231665-5231687 GTCTCTAAACCCCATCTTCGAGG + Intronic
1143269035 17:5662019-5662041 GTGACTCTACCCCTCCTGCCTGG - Intergenic
1143275987 17:5711176-5711198 GTCACTGACTCCCACCTGCCTGG - Intergenic
1143328834 17:6119468-6119490 TTCTCTCACCCCACCCTGCCTGG - Intronic
1143444325 17:6998499-6998521 GTCTCCCCAGCCCGCCTGCCAGG + Exonic
1144380135 17:14686840-14686862 GACACTGAACCCCAGCTGCCTGG - Intergenic
1146467000 17:33094250-33094272 GTCTCTCAACTCCATTTGCTGGG + Intronic
1147237629 17:39069487-39069509 GTCTCTCATGCCCAAATGCCAGG - Intronic
1147705509 17:42422548-42422570 GTCTCCCCACCCCAACTCCCAGG + Intronic
1148163168 17:45463323-45463345 CTCTCTGCTCCCCACCTGCCTGG - Intronic
1150648887 17:66997147-66997169 TTCCCTCAAAACCACCTGCCAGG - Intronic
1152091349 17:78249478-78249500 GTCTCTCCTCTCCACCTCCCAGG - Intergenic
1152361488 17:79835083-79835105 GGCGCCCAGCCCCACCTGCCCGG - Exonic
1153299651 18:3581508-3581530 GTGCCCCAACCCCACCTGTCAGG - Intronic
1153323084 18:3792554-3792576 TTCTCTCAACCCCTTCTGCATGG + Intronic
1154343325 18:13522946-13522968 GCCTCACATCCCCACCTTCCCGG + Intronic
1157959640 18:52138356-52138378 GCCTCTCAGCCACACTTGCCAGG + Intergenic
1158941172 18:62406769-62406791 GTGTCGCAGCCCCACCTGCTTGG - Intergenic
1159013583 18:63082729-63082751 TGCCCTCACCCCCACCTGCCAGG + Intergenic
1160671846 19:368862-368884 GTCTCTCTACCTCAGCAGCCCGG - Intronic
1160700017 19:501718-501740 GTCTCCCGACACCACCTCCCCGG + Exonic
1160700025 19:501742-501764 GTCTCCCGACACCACCTCCCAGG + Exonic
1162966506 19:14158692-14158714 CTCCCTGACCCCCACCTGCCTGG - Intronic
1164464913 19:28479499-28479521 GACTCTCCACCCCACCTGGTTGG - Intergenic
1166453741 19:42922904-42922926 CTCTCTCTGCCTCACCTGCCAGG - Intronic
1167241822 19:48348376-48348398 CTCTCTCCTCCCCACCCGCCTGG + Intronic
1167818387 19:51904473-51904495 GCCTCTGAGCCCCACATGCCTGG + Intronic
925190191 2:1876323-1876345 GTCTGTCAACACCTACTGCCTGG + Intronic
925253580 2:2463304-2463326 GTGTCTCAAACACACCCGCCAGG + Intergenic
927915439 2:26933130-26933152 GTCACTCAACCCCACCCTCAAGG - Intronic
929832275 2:45356742-45356764 GCCAGCCAACCCCACCTGCCTGG + Intergenic
932094991 2:68839499-68839521 GTCTCTCATCCCCTCGTCCCAGG - Intergenic
937137136 2:119563506-119563528 ATCCCTCCACCCCACCTACCTGG + Intronic
938981907 2:136534989-136535011 GTCACTCAACCCCACTGCCCTGG - Intergenic
939884280 2:147664378-147664400 CTCTCCCTACCCCACCTCCCTGG - Intergenic
940408014 2:153328231-153328253 GTCTCTCAACCCCTTCTGGGAGG + Intergenic
941478117 2:165972487-165972509 GTCTGTCAACCCCTCCTGGGAGG - Intergenic
943814077 2:192229006-192229028 ATCTCTCAGCCTCACCTGTCTGG - Intergenic
946437248 2:219665453-219665475 GTCTCTCTGCCCCTCCTGGCTGG - Intergenic
947105468 2:226663732-226663754 GTCTCTTTCCCCCAGCTGCCAGG - Intergenic
947372601 2:229463923-229463945 GTCTTTCAACCCTTCCTGCCAGG - Intronic
947447455 2:230174915-230174937 GCCTCTCAGTCCCACCTTCCAGG - Intronic
947592679 2:231394498-231394520 GGCTCTGAACCCTTCCTGCCTGG - Intergenic
947746201 2:232508490-232508512 GCCCCTCCTCCCCACCTGCCAGG - Intergenic
948464825 2:238147452-238147474 GTCTCGCAACCCGCCCTCCCAGG + Intronic
948616943 2:239205078-239205100 GTCTCCCCACCCCACGTGGCTGG + Intronic
1168816961 20:744370-744392 GTCTCCCAGCCACACCTACCTGG - Intergenic
1169081071 20:2798058-2798080 CTCTCTCCACCTCTCCTGCCAGG - Exonic
1169677547 20:8171482-8171504 TACTCTGAACCCCATCTGCCTGG + Intronic
1169690785 20:8329254-8329276 GTCTCTCAACTAGAACTGCCAGG + Intronic
1172693196 20:36804406-36804428 CTCCCTCAGCCCCAACTGCCTGG - Intronic
1172878665 20:38182516-38182538 GTCTCTAAACCCTAGCTGCAAGG - Intergenic
1172971397 20:38875478-38875500 GCCTTGCAGCCCCACCTGCCTGG - Intronic
1173151218 20:40567986-40568008 GTCTGAGAGCCCCACCTGCCAGG - Intergenic
1173589122 20:44210565-44210587 GTCTCCCGACGCCTCCTGCCTGG - Intronic
1173806034 20:45925894-45925916 GTCTCCCTTCCCCAGCTGCCAGG + Intergenic
1175891744 20:62318805-62318827 CTCTCCCCACCCCGCCTGCCAGG + Intronic
1179457454 21:41508722-41508744 GTCTCTCGGCACCACCGGCCAGG + Intronic
1179842637 21:44087299-44087321 GGCTCTCAACAGCACCTGCAAGG - Intronic
1179995643 21:44972818-44972840 GCGTCTCCACCCCACCTGCCTGG - Intronic
1180136099 21:45863013-45863035 GCCTTTCCACCCCACCTACCTGG + Intronic
1180935581 22:19622986-19623008 CTCTGGCAGCCCCACCTGCCAGG + Intergenic
1182420000 22:30244429-30244451 GCCTCTCAACCGCATCTCCCTGG + Intronic
1184731964 22:46375459-46375481 GGGTCTCCACCCCACCTCCCAGG + Intronic
1184877826 22:47286629-47286651 GGCACTCCACCCCACCTCCCCGG - Intergenic
1184980301 22:48090842-48090864 CTCTCTCATCCCCACCAGCTGGG - Intergenic
1185221780 22:49632691-49632713 GTGGCTCAGCGCCACCTGCCGGG + Intronic
1185251520 22:49804148-49804170 GTCTCTCACCCCCACCCTCCAGG - Intronic
949510345 3:4761606-4761628 TTCACTCCACCCCACCTGGCAGG - Intronic
950189448 3:10966457-10966479 GAGCCTCCACCCCACCTGCCAGG - Intergenic
950799572 3:15539247-15539269 GTCTCTCAGGCCCATCTGCCTGG - Intergenic
960968125 3:123119641-123119663 GTCACTCAACCCCTCCAGCCAGG - Intronic
961853049 3:129840785-129840807 GACTCTCAGCCCCACATGGCTGG - Intronic
964041755 3:152269243-152269265 GTCCCTCAGCACCTCCTGCCCGG + Intronic
964533851 3:157698078-157698100 GGCTCTCTACCTCAACTGCCAGG + Intergenic
966685778 3:182692970-182692992 GTTTCTCAAGCCCAAATGCCTGG - Intergenic
967835644 3:193960267-193960289 GTCTATCACCTCCACCTGGCAGG + Intergenic
968067150 3:195764961-195764983 TGATCTCAACCCCACCTTCCCGG - Intronic
968550056 4:1217459-1217481 GTCTGTCAACGCCCCCTGCCAGG + Intronic
969306445 4:6328692-6328714 GTCTCTCAACCCCACCTGCCTGG - Intronic
972699897 4:41483633-41483655 CCTTCTCATCCCCACCTGCCGGG + Intronic
973198708 4:47475922-47475944 GCCTCTCAACTCTGCCTGCCTGG + Intergenic
981078607 4:140616250-140616272 CTCTCTCAACTCAATCTGCCTGG - Intergenic
983573372 4:169234148-169234170 TTTGCTCATCCCCACCTGCCAGG + Intronic
984839143 4:184051985-184052007 GTCTCCCTGCCCCACCTGCCAGG - Intergenic
985580339 5:692729-692751 GTCTGACAGCCCCACCTGCCAGG + Intronic
985594997 5:784110-784132 GTCTGACAGCCCCACCTGCCAGG + Intergenic
987081535 5:14429736-14429758 TTCCCACAACCCCACGTGCCAGG + Intronic
987732234 5:21789315-21789337 GTCTTTTTACCACACCTGCCAGG + Intronic
990776455 5:59310578-59310600 GTCTCTCATCCCAAACTCCCTGG + Intronic
997630005 5:135360282-135360304 GTCTCCCTTCCCCAGCTGCCAGG + Intronic
997947307 5:138213847-138213869 TGCTCTCACCCCCACCTCCCCGG - Intergenic
1001510652 5:172318870-172318892 GTCTGTCTACCCCACCAGACTGG - Intergenic
1004092322 6:12516315-12516337 GTCTATAAACCCCAGCTGCAAGG - Intergenic
1004373774 6:15074779-15074801 GTCTCTCACCCCCACCAGATGGG - Intergenic
1006299525 6:33186151-33186173 GTCTCTGGCCCCCACCTACCTGG - Intronic
1009785336 6:68330340-68330362 TTCTCCCAATCCCACATGCCAGG - Intergenic
1012223916 6:96684025-96684047 GTCTCTCAGCCCCAGCTGGCAGG + Intergenic
1013353345 6:109325792-109325814 CTCTCTTAACCCCACTTACCTGG - Intergenic
1013602636 6:111719500-111719522 GACTCTCAGCCTCACCTGGCTGG - Intronic
1014009405 6:116459038-116459060 GTCTCTAAACACCACCTCCTGGG - Intergenic
1014384382 6:120782075-120782097 ATCTGGCAACCCTACCTGCCGGG - Intergenic
1014387001 6:120815622-120815644 GTCTGTCAACCCCTGCTGCAAGG + Intergenic
1014776138 6:125511885-125511907 GCCTCTAAACTCCACCTTCCTGG + Intergenic
1017905848 6:158757127-158757149 ATCTCTGGACCCCACCTTCCAGG - Intronic
1018951779 6:168382974-168382996 GTGTCTAAACCCCATCTGCTGGG - Intergenic
1019291346 7:252117-252139 GTCTCCCAACCACAGATGCCAGG + Intronic
1019307345 7:342080-342102 GACTCACACCCCCACCGGCCAGG - Intergenic
1019430708 7:997668-997690 GGCTCTGATCCCCCCCTGCCGGG - Exonic
1021674489 7:23066515-23066537 ATCTGCCAACCCCAGCTGCCAGG + Intergenic
1024664831 7:51536189-51536211 GTCTGTCAACCCCTCCTGGGAGG + Intergenic
1025872361 7:65446887-65446909 CTCTCTCTACCTCAGCTGCCAGG - Intergenic
1030605311 7:111633442-111633464 GAGTCTGAACCCCACCTTCCTGG - Intergenic
1031949194 7:127874173-127874195 GTGTCTCTGCCCCACCTGCCAGG + Intronic
1032162860 7:129524003-129524025 GGCTCTCAACCCCAGCACCCTGG + Intergenic
1034272021 7:149807983-149808005 GTCTCTAAATCCCTCCTACCTGG + Intergenic
1035246823 7:157567966-157567988 TCCTCTCAAGCTCACCTGCCTGG + Intronic
1035376400 7:158409684-158409706 GGCTTTCAACCTCACCTGCCAGG + Intronic
1035472614 7:159119870-159119892 TTCTTCCAACCCCACCTACCAGG - Intronic
1035476741 7:159149237-159149259 CTCTGTGAGCCCCACCTGCCTGG - Intergenic
1035946858 8:3973233-3973255 AGCTCTCACTCCCACCTGCCAGG - Intronic
1036183885 8:6607808-6607830 GTCTCACAGTTCCACCTGCCTGG - Intronic
1037822759 8:22142998-22143020 GTGTTTCCACCCCACATGCCCGG - Intergenic
1038662289 8:29507549-29507571 CTCTCTCCTCCCCACCTGCTTGG - Intergenic
1051325038 9:15957336-15957358 GTCTCTCAGCCACACTTGACTGG - Intronic
1055044475 9:71910662-71910684 CTCTCTCGACCCCTTCTGCCCGG - Exonic
1056648432 9:88435789-88435811 GTCTCTCACTCCCACCTGTATGG + Intronic
1056940345 9:90950097-90950119 GTCTCTGATCCCTGCCTGCCTGG + Intergenic
1057690128 9:97276517-97276539 GTGGCTCGGCCCCACCTGCCTGG + Intergenic
1059507368 9:114812171-114812193 GTCTGGCAACATCACCTGCCTGG - Intergenic
1060220336 9:121761128-121761150 GTGCCTCAGCCCCACCTACCCGG + Intronic
1061599527 9:131658275-131658297 GTCTGGCAACCCCAGGTGCCGGG - Intronic
1062400392 9:136370195-136370217 GTCTCCACACCCCACCTTCCAGG + Intronic
1186449104 X:9657265-9657287 AACACTCAACCCCACCTTCCAGG + Intronic
1188996200 X:36888467-36888489 GTCACCCAACCCCACGTTCCAGG + Intergenic
1189104182 X:38220161-38220183 ATCTCTTAACCCCCCCTGCTGGG - Intronic
1192245760 X:69370268-69370290 GTCTCTCAACGCCTCCAGCCTGG - Intergenic
1192797279 X:74434470-74434492 GCCCCTCCACCCCACCTGCTGGG - Intronic
1194433062 X:93835861-93835883 GTCTCTTCACCCCTCATGCCTGG + Intergenic
1196467130 X:115983698-115983720 GTCTCTCAACCCCTGCTGGGAGG - Intergenic
1200074691 X:153545127-153545149 GGATCCCAACCCCAACTGCCTGG + Intronic