ID: 969308352

View in Genome Browser
Species Human (GRCh38)
Location 4:6338356-6338378
Sequence CACAACACCGTGCAACACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 111}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969308352_969308366 25 Left 969308352 4:6338356-6338378 CCTGGGTGTTGCACGGTGTTGTG 0: 1
1: 0
2: 0
3: 8
4: 111
Right 969308366 4:6338404-6338426 ATCCCTGGCTCAGGCCAAGGTGG No data
969308352_969308369 28 Left 969308352 4:6338356-6338378 CCTGGGTGTTGCACGGTGTTGTG 0: 1
1: 0
2: 0
3: 8
4: 111
Right 969308369 4:6338407-6338429 CCTGGCTCAGGCCAAGGTGGAGG 0: 1
1: 0
2: 6
3: 61
4: 349
969308352_969308371 30 Left 969308352 4:6338356-6338378 CCTGGGTGTTGCACGGTGTTGTG 0: 1
1: 0
2: 0
3: 8
4: 111
Right 969308371 4:6338409-6338431 TGGCTCAGGCCAAGGTGGAGGGG 0: 1
1: 1
2: 4
3: 67
4: 599
969308352_969308355 10 Left 969308352 4:6338356-6338378 CCTGGGTGTTGCACGGTGTTGTG 0: 1
1: 0
2: 0
3: 8
4: 111
Right 969308355 4:6338389-6338411 GCCTTCCCCACCCCCATCCCTGG 0: 1
1: 1
2: 20
3: 158
4: 1093
969308352_969308370 29 Left 969308352 4:6338356-6338378 CCTGGGTGTTGCACGGTGTTGTG 0: 1
1: 0
2: 0
3: 8
4: 111
Right 969308370 4:6338408-6338430 CTGGCTCAGGCCAAGGTGGAGGG 0: 1
1: 0
2: 4
3: 33
4: 442
969308352_969308364 22 Left 969308352 4:6338356-6338378 CCTGGGTGTTGCACGGTGTTGTG 0: 1
1: 0
2: 0
3: 8
4: 111
Right 969308364 4:6338401-6338423 CCCATCCCTGGCTCAGGCCAAGG 0: 1
1: 0
2: 7
3: 60
4: 440
969308352_969308359 16 Left 969308352 4:6338356-6338378 CCTGGGTGTTGCACGGTGTTGTG 0: 1
1: 0
2: 0
3: 8
4: 111
Right 969308359 4:6338395-6338417 CCCACCCCCATCCCTGGCTCAGG 0: 1
1: 0
2: 16
3: 117
4: 912

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969308352 Original CRISPR CACAACACCGTGCAACACCC AGG (reversed) Intronic