ID: 969308352

View in Genome Browser
Species Human (GRCh38)
Location 4:6338356-6338378
Sequence CACAACACCGTGCAACACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 111}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969308352_969308355 10 Left 969308352 4:6338356-6338378 CCTGGGTGTTGCACGGTGTTGTG 0: 1
1: 0
2: 0
3: 8
4: 111
Right 969308355 4:6338389-6338411 GCCTTCCCCACCCCCATCCCTGG 0: 1
1: 1
2: 20
3: 158
4: 1093
969308352_969308370 29 Left 969308352 4:6338356-6338378 CCTGGGTGTTGCACGGTGTTGTG 0: 1
1: 0
2: 0
3: 8
4: 111
Right 969308370 4:6338408-6338430 CTGGCTCAGGCCAAGGTGGAGGG 0: 1
1: 0
2: 4
3: 33
4: 442
969308352_969308371 30 Left 969308352 4:6338356-6338378 CCTGGGTGTTGCACGGTGTTGTG 0: 1
1: 0
2: 0
3: 8
4: 111
Right 969308371 4:6338409-6338431 TGGCTCAGGCCAAGGTGGAGGGG 0: 1
1: 1
2: 4
3: 67
4: 599
969308352_969308364 22 Left 969308352 4:6338356-6338378 CCTGGGTGTTGCACGGTGTTGTG 0: 1
1: 0
2: 0
3: 8
4: 111
Right 969308364 4:6338401-6338423 CCCATCCCTGGCTCAGGCCAAGG 0: 1
1: 0
2: 7
3: 60
4: 440
969308352_969308369 28 Left 969308352 4:6338356-6338378 CCTGGGTGTTGCACGGTGTTGTG 0: 1
1: 0
2: 0
3: 8
4: 111
Right 969308369 4:6338407-6338429 CCTGGCTCAGGCCAAGGTGGAGG 0: 1
1: 0
2: 6
3: 61
4: 349
969308352_969308359 16 Left 969308352 4:6338356-6338378 CCTGGGTGTTGCACGGTGTTGTG 0: 1
1: 0
2: 0
3: 8
4: 111
Right 969308359 4:6338395-6338417 CCCACCCCCATCCCTGGCTCAGG 0: 1
1: 0
2: 16
3: 117
4: 912
969308352_969308366 25 Left 969308352 4:6338356-6338378 CCTGGGTGTTGCACGGTGTTGTG 0: 1
1: 0
2: 0
3: 8
4: 111
Right 969308366 4:6338404-6338426 ATCCCTGGCTCAGGCCAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969308352 Original CRISPR CACAACACCGTGCAACACCC AGG (reversed) Intronic
902203219 1:14849176-14849198 CCAGACACTGTGCAACACCCTGG - Intronic
902673983 1:17995623-17995645 CATAACAAAGTGCCACACCCTGG + Intergenic
905259847 1:36709534-36709556 CACAACACCGAGCAGACCCCGGG - Intergenic
921119304 1:212123149-212123171 CACACCACCGTACTACAGCCCGG - Intergenic
921562259 1:216672821-216672843 CACATCACTGTACAACAGCCTGG + Intronic
921937435 1:220808094-220808116 CCCCACACCGAGCAACACACAGG - Intronic
922509409 1:226151073-226151095 TACCATACCATGCAACACCCTGG - Intronic
923569235 1:235099376-235099398 CACAACACTGTACTACAGCCTGG + Intergenic
923692431 1:236207881-236207903 CACAAAACCATGCTACACACAGG - Intronic
1063159350 10:3408344-3408366 CAGAACCCCCTGCAAGACCCAGG - Intergenic
1066689643 10:38013469-38013491 CACACCACTGTGCTACAGCCTGG - Intronic
1068814680 10:61296188-61296210 CACACCACCCTTCAAAACCCAGG - Intergenic
1069451747 10:68523546-68523568 CACAACAACCTCCACCACCCAGG + Intronic
1069971146 10:72170545-72170567 CACAGCACCGCACTACACCCTGG + Intronic
1071569654 10:86690016-86690038 CACAACCCCGTGCAAAGACCAGG - Intronic
1072729057 10:97832548-97832570 CACTACACCCTGGAACTCCCAGG - Intergenic
1072925201 10:99611067-99611089 CAAAACACTGCTCAACACCCAGG - Exonic
1078083789 11:8221698-8221720 CACAACACCCAGGAACACCCAGG - Intergenic
1080935246 11:36856717-36856739 GAGAACACTGTGCATCACCCAGG - Intergenic
1082046363 11:47732266-47732288 CCCTACTCCGTGCAACACTCTGG + Intronic
1091793329 12:3283798-3283820 CAGACCACCGTGCGACACCCAGG + Exonic
1096374602 12:51097969-51097991 CACACCACCGCACAACAGCCTGG + Intronic
1097039075 12:56143612-56143634 CTCACCACCGGGCTACACCCTGG - Exonic
1100224734 12:92544711-92544733 CATAACACCTTGCAAGCCCCTGG - Intergenic
1101777662 12:107808406-107808428 CACAGCAACATGCAACACCCAGG - Intergenic
1104426545 12:128682736-128682758 CATAACACAGTGCCACACACTGG + Intronic
1106078515 13:26481659-26481681 CATAACACAGTGCCACAGCCTGG + Intergenic
1112288500 13:98124791-98124813 CACACCACTGCGCTACACCCTGG - Intergenic
1115273482 14:31580568-31580590 CACACCACTGTGCTACAGCCTGG + Intronic
1117113665 14:52486703-52486725 CACAACACCATACAACATTCTGG + Intronic
1122422472 14:101586398-101586420 CACAGCACAGGGCAACACCTTGG + Intergenic
1125137558 15:36361817-36361839 CACAACACAGTGCAATATCATGG + Intergenic
1133123396 16:3626913-3626935 CACATCACCGTGCTCCAGCCTGG - Intronic
1133611349 16:7436486-7436508 CACAACCCAGTGCAACAGCATGG + Intronic
1135275358 16:21107904-21107926 CACACCACTGTGCACCAGCCTGG - Intronic
1137633645 16:49966659-49966681 TACAATACTGTGCATCACCCAGG - Intergenic
1137998588 16:53248567-53248589 CACACCACTGCACAACACCCTGG - Intronic
1140112632 16:72016845-72016867 CAGAACACCATCCAATACCCAGG - Intronic
1142318323 16:89363982-89364004 CACCACACCCTCCAACTCCCGGG - Intronic
1142541173 17:660653-660675 CACCACACCCAGCAGCACCCAGG - Intronic
1142541186 17:660700-660722 CACCACACCCAGCAGCACCCAGG - Intronic
1143192653 17:5051541-5051563 CACACCACCGTGCTCCAGCCTGG + Intronic
1145828582 17:27896905-27896927 CAAAACTCCATGCAAGACCCTGG + Intergenic
1148401213 17:47363113-47363135 CACAACACCGCACTACAGCCTGG - Intronic
1150100584 17:62420274-62420296 CACTACAACCTCCAACACCCAGG + Intergenic
1150698019 17:67422589-67422611 CACACCACCGTGCTCCAGCCTGG - Intronic
1152020540 17:77778035-77778057 CACAGCAACATGGAACACCCAGG + Intergenic
1152381649 17:79945326-79945348 CACAACACTCTGCCTCACCCTGG - Intronic
1153737929 18:8091980-8092002 CACAATACTGTGCAAAATCCAGG - Intronic
1154347721 18:13557252-13557274 CACAACACTGTGCTCCAGCCTGG + Intronic
1156299838 18:35826750-35826772 CACCATACCGTGCAGCACTCAGG + Intergenic
1161312017 19:3600096-3600118 CGCTACACCGTGCAATACCCGGG - Exonic
1161475048 19:4480064-4480086 CTCAACACCCTGCAATGCCCAGG - Intronic
1164137095 19:22425950-22425972 CACAACATAGAGCAACCCCCAGG + Intronic
1165774996 19:38399132-38399154 CACAGCACCGTACAGCACTCTGG - Intergenic
1167258482 19:48444283-48444305 CACATCACTGTGCAGCTCCCCGG + Exonic
926185800 2:10689869-10689891 CACAACACTGTTCAAGTCCCGGG + Exonic
926772209 2:16388435-16388457 CACACCACTGTGCTACAGCCTGG + Intergenic
926845849 2:17138424-17138446 CACAACACAGTGGAAGACCCAGG + Intergenic
927244397 2:20945369-20945391 CACAGCAGCATGCAGCACCCTGG - Intergenic
930793449 2:55359781-55359803 CACAAGACCTTGCAAAAACCAGG + Intronic
935949662 2:108317133-108317155 CACCACTGCCTGCAACACCCTGG + Intergenic
938390256 2:130899371-130899393 CACAGCACTGTGCAGCACTCAGG + Intronic
939944821 2:148396795-148396817 CACAACTCCTGTCAACACCCAGG + Intronic
943811705 2:192195572-192195594 CACAAGAGCGTGCAACCCCAAGG + Exonic
946982547 2:225233295-225233317 CACAACACCCAGCTGCACCCAGG - Intergenic
948319236 2:237056396-237056418 CACAACACCACACAACACCTAGG - Intergenic
949008035 2:241661347-241661369 CACAACACCACGCCACACTCAGG - Intronic
1169852917 20:10072426-10072448 AACAACAACGTGTTACACCCTGG + Intergenic
1172693398 20:36805513-36805535 CAGAACACCTTGCCACACCTTGG + Intronic
1179119259 21:38527915-38527937 CATAACAAAGTGCCACACCCTGG + Intronic
1180161110 21:45999108-45999130 CAACAGACCGTGCACCACCCGGG - Intronic
1182133033 22:27872595-27872617 CACAAAACAGTCTAACACCCAGG + Intronic
1184748460 22:46470430-46470452 CACAGCACAGAGAAACACCCCGG + Intronic
1184890005 22:47373794-47373816 CCCAACCCCGGGCCACACCCCGG - Intergenic
1185279556 22:49964269-49964291 CACTACCCCGTGCTGCACCCAGG + Intergenic
949708813 3:6850583-6850605 CACAACACCGCACACCAGCCTGG - Intronic
951166683 3:19490581-19490603 GACAACCCGGTGCCACACCCTGG - Intronic
952670025 3:35955259-35955281 CACAAAACCATAAAACACCCTGG + Intergenic
961634686 3:128325572-128325594 CACAACACCGAGCTACAACCTGG + Intronic
961726770 3:128935956-128935978 CACAACATCTTTCAACACCTGGG + Intronic
962530352 3:136274868-136274890 CACAACACTGTACTACAGCCTGG - Intronic
965935434 3:174104449-174104471 CTCAACACTGTGAAACACACTGG + Intronic
967530878 3:190547908-190547930 CATCAGACCCTGCAACACCCAGG - Intronic
969306914 4:6331010-6331032 CCCAACACAGTGCTAGACCCTGG - Intronic
969308352 4:6338356-6338378 CACAACACCGTGCAACACCCAGG - Intronic
983648157 4:170012576-170012598 CACAACACCCTCCATCAGCCAGG - Intronic
984707031 4:182855099-182855121 GACAGCCCCGTGCCACACCCTGG - Intergenic
985514679 5:335444-335466 CACAACACAGTCCACCACCTGGG - Intronic
987960213 5:24797255-24797277 CACACCACCGTACTCCACCCTGG - Intergenic
988533308 5:32043669-32043691 CACACCACCGTGCTCCAGCCTGG - Intronic
991414664 5:66379769-66379791 CACCACTGCCTGCAACACCCTGG + Intergenic
995473140 5:112524002-112524024 GACAGCCCGGTGCAACACCCTGG + Intergenic
995474280 5:112532291-112532313 GACAACCCGGTGCCACACCCTGG + Intergenic
997232181 5:132253271-132253293 CCCAACACCTTTCTACACCCAGG + Intronic
999032739 5:148312321-148312343 CAAAGCACGGTGCCACACCCTGG - Intergenic
1009412911 6:63387055-63387077 CACACCACCGTGCTCCAGCCTGG + Intergenic
1013152785 6:107462125-107462147 CTCAACACCGTACAATACTCAGG - Intergenic
1014420949 6:121245086-121245108 CACCACTGCCTGCAACACCCTGG + Intronic
1014531969 6:122569442-122569464 CACCACTGCGTACAACACCCTGG + Intronic
1014547453 6:122749144-122749166 GACAACCCAGTGCCACACCCTGG - Intergenic
1018465455 6:164040166-164040188 CGCAACACCGAGCAGCACCAAGG + Intergenic
1018808403 6:167279025-167279047 CACAGCAACCTGCAACACACAGG + Intronic
1019596888 7:1862218-1862240 CAGCACACCGAGCAGCACCCCGG + Intronic
1025079889 7:55972506-55972528 CACTACACCCTGCACCTCCCGGG + Intronic
1025751539 7:64298122-64298144 CATAACACGGTCCAACACGCAGG - Intergenic
1027368265 7:77481000-77481022 CACTACAACCTGCAACTCCCGGG - Intergenic
1032029725 7:128473110-128473132 CACTACAACCTCCAACACCCAGG + Intergenic
1032703575 7:134403371-134403393 CACCACACCTAGCCACACCCTGG - Intergenic
1034785766 7:153924759-153924781 CACAACGTCCTGCAACACCTGGG - Intronic
1037435408 8:18857422-18857444 CTCAACACCTTGCTACTCCCAGG - Intronic
1044826062 8:96198299-96198321 CACAGCACTGTGCTACAGCCTGG + Intergenic
1047977531 8:130145883-130145905 CACACCACCGTACCCCACCCTGG - Intronic
1049806054 8:144540350-144540372 CACAGCACTGTGCACCACCCTGG + Intronic
1062724313 9:138062753-138062775 CACAAAACCCAGCAACCCCCAGG - Intronic
1188732315 X:33665012-33665034 GACAACACCATCCAACAACCTGG - Intergenic
1192981666 X:76350774-76350796 CACCACAGCCTGCAACACACTGG + Intergenic
1196599451 X:117585064-117585086 CACCACTGCCTGCAACACCCTGG - Intergenic
1197603776 X:128560928-128560950 CACCACAGCCTGCAACACCCTGG + Intergenic
1202049090 Y:20762441-20762463 CACAACAGGATCCAACACCCTGG - Intronic