ID: 969309044

View in Genome Browser
Species Human (GRCh38)
Location 4:6341587-6341609
Sequence CTGTTATCTCACATGGCAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2212
Summary {0: 1, 1: 2, 2: 71, 3: 423, 4: 1715}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969309039_969309044 -3 Left 969309039 4:6341567-6341589 CCACCCTAGAATCTGTGCACCTG 0: 1
1: 0
2: 0
3: 13
4: 261
Right 969309044 4:6341587-6341609 CTGTTATCTCACATGGCAAAAGG 0: 1
1: 2
2: 71
3: 423
4: 1715
969309036_969309044 22 Left 969309036 4:6341542-6341564 CCCTAAAGGCGTCTATCTACATC 0: 1
1: 0
2: 0
3: 1
4: 45
Right 969309044 4:6341587-6341609 CTGTTATCTCACATGGCAAAAGG 0: 1
1: 2
2: 71
3: 423
4: 1715
969309038_969309044 0 Left 969309038 4:6341564-6341586 CCTCCACCCTAGAATCTGTGCAC 0: 1
1: 0
2: 1
3: 15
4: 155
Right 969309044 4:6341587-6341609 CTGTTATCTCACATGGCAAAAGG 0: 1
1: 2
2: 71
3: 423
4: 1715
969309035_969309044 23 Left 969309035 4:6341541-6341563 CCCCTAAAGGCGTCTATCTACAT 0: 1
1: 0
2: 0
3: 4
4: 38
Right 969309044 4:6341587-6341609 CTGTTATCTCACATGGCAAAAGG 0: 1
1: 2
2: 71
3: 423
4: 1715
969309037_969309044 21 Left 969309037 4:6341543-6341565 CCTAAAGGCGTCTATCTACATCC 0: 1
1: 0
2: 0
3: 3
4: 41
Right 969309044 4:6341587-6341609 CTGTTATCTCACATGGCAAAAGG 0: 1
1: 2
2: 71
3: 423
4: 1715
969309041_969309044 -7 Left 969309041 4:6341571-6341593 CCTAGAATCTGTGCACCTGTTAT 0: 1
1: 0
2: 2
3: 30
4: 318
Right 969309044 4:6341587-6341609 CTGTTATCTCACATGGCAAAAGG 0: 1
1: 2
2: 71
3: 423
4: 1715
969309040_969309044 -6 Left 969309040 4:6341570-6341592 CCCTAGAATCTGTGCACCTGTTA 0: 1
1: 0
2: 1
3: 27
4: 262
Right 969309044 4:6341587-6341609 CTGTTATCTCACATGGCAAAAGG 0: 1
1: 2
2: 71
3: 423
4: 1715

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969309044 Original CRISPR CTGTTATCTCACATGGCAAA AGG Intronic
Too many off-targets to display for this crispr