ID: 969309065

View in Genome Browser
Species Human (GRCh38)
Location 4:6341697-6341719
Sequence CTGTATAGGAGGAAGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 515
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 468}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969309060_969309065 -3 Left 969309060 4:6341677-6341699 CCCAATGTCATCACAAGGGTCTG 0: 1
1: 2
2: 46
3: 209
4: 608
Right 969309065 4:6341697-6341719 CTGTATAGGAGGAAGAAGGAAGG 0: 1
1: 0
2: 2
3: 44
4: 468
969309061_969309065 -4 Left 969309061 4:6341678-6341700 CCAATGTCATCACAAGGGTCTGT 0: 1
1: 3
2: 53
3: 194
4: 629
Right 969309065 4:6341697-6341719 CTGTATAGGAGGAAGAAGGAAGG 0: 1
1: 0
2: 2
3: 44
4: 468
969309056_969309065 17 Left 969309056 4:6341657-6341679 CCCTGGATAATCTGGATGGGCCC 0: 1
1: 2
2: 18
3: 48
4: 236
Right 969309065 4:6341697-6341719 CTGTATAGGAGGAAGAAGGAAGG 0: 1
1: 0
2: 2
3: 44
4: 468
969309057_969309065 16 Left 969309057 4:6341658-6341680 CCTGGATAATCTGGATGGGCCCA 0: 1
1: 9
2: 112
3: 368
4: 865
Right 969309065 4:6341697-6341719 CTGTATAGGAGGAAGAAGGAAGG 0: 1
1: 0
2: 2
3: 44
4: 468

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969309065 Original CRISPR CTGTATAGGAGGAAGAAGGA AGG Intronic
900732594 1:4272038-4272060 AAGAGTAGGAGGAAGAAGGAAGG - Intergenic
900991236 1:6099340-6099362 GTGTGTAGGAGGAAGACGGTGGG - Exonic
901536124 1:9883920-9883942 CAGTCAAGGAGGAAGAAGGTGGG + Intronic
901617754 1:10555342-10555364 CTGTATGTAGGGAAGAAGGAAGG - Intronic
901818096 1:11806248-11806270 CAGTAAAGGAGGAAGATGGCGGG + Exonic
901863525 1:12089517-12089539 TTGTATAGGAGGAAGTATGTGGG + Intronic
901959137 1:12810594-12810616 CTTTATTGGAGGAAAAAAGAGGG + Intergenic
902643063 1:17779082-17779104 ATGTATAGGAGGAACAGGGCTGG - Intronic
903531751 1:24036007-24036029 CTCGATAGGAAAAAGAAGGAAGG - Intergenic
904352400 1:29917299-29917321 CGGAAGGGGAGGAAGAAGGAAGG - Intergenic
904357510 1:29950189-29950211 TTGTGAAGGAGAAAGAAGGAAGG - Intergenic
904614050 1:31740321-31740343 CTGCCTAGGAGGAAGGAGGGCGG - Intronic
905096054 1:35471907-35471929 TTGTTTTGGAGGAGGAAGGAAGG - Intronic
906938648 1:50236540-50236562 CTGTATATGAGGAGGAATGGTGG - Intergenic
907723046 1:56991614-56991636 CTTCATAGAAGGAAGAAGAAAGG - Intergenic
908736367 1:67281135-67281157 CAGAAAGGGAGGAAGAAGGAAGG + Intergenic
908798893 1:67858623-67858645 CTCACTAAGAGGAAGAAGGATGG - Intergenic
910452315 1:87359840-87359862 TTATATAGGAGGAAGTTGGAGGG + Intergenic
910502467 1:87908717-87908739 CAGTTTAGGAGAAGGAAGGAGGG + Intergenic
911094987 1:94047791-94047813 GGGCATGGGAGGAAGAAGGAGGG - Intronic
911253766 1:95610539-95610561 CTGCATAGGAGGAAAAGAGAAGG + Intergenic
912063569 1:105705944-105705966 AAGAAGAGGAGGAAGAAGGAGGG + Intergenic
914449337 1:147776890-147776912 TTGTATAGAAGGAGGAGGGAAGG - Intergenic
915978457 1:160405762-160405784 CTGTAAGTGAGGAAGGAGGAAGG + Intronic
917363247 1:174200440-174200462 CTGTATATGAGGTAGAGGGATGG + Intronic
917376817 1:174357621-174357643 CTACATAGGAGCAAAAAGGAAGG + Intronic
917745922 1:178007113-178007135 TTATATAGGAAGAAGAATGAAGG + Intergenic
919322787 1:196064508-196064530 ATGTATAGGAGAAAGCTGGAGGG - Intergenic
919617240 1:199822898-199822920 CTCTTTGGCAGGAAGAAGGAAGG - Intergenic
919659431 1:200229408-200229430 GTGTATAGTAGTAAGAAAGATGG - Intergenic
920097623 1:203496848-203496870 CTGTGGAGGAGGAGGAGGGAAGG - Intronic
920644135 1:207785660-207785682 CTTCAAAGGAGGAAGAAGAAAGG + Exonic
921024696 1:211267027-211267049 CTTTTTAGGATAAAGAAGGAAGG + Intronic
921269890 1:213458146-213458168 TTGTAGAGGGGGAAGGAGGATGG - Intergenic
921418390 1:214917388-214917410 CTGTGGAGGAGTAAGAAAGAAGG - Intergenic
922023953 1:221733299-221733321 GTGTATAGGAGAAAGGAGAAGGG - Intronic
922143237 1:222911457-222911479 CTGTAAAAGAGGAAAAAGAAGGG - Intronic
923314058 1:232762298-232762320 CTGAGGAAGAGGAAGAAGGATGG - Intergenic
923456066 1:234166673-234166695 CAGGATAGGAGGGAGCAGGAAGG + Intronic
923478828 1:234363784-234363806 CTGTATAGATGGATGATGGATGG + Intergenic
923927983 1:238657902-238657924 GTGGATAGGAGGAAAGAGGAGGG + Intergenic
924293270 1:242560116-242560138 CTGTGTAGGAGGAAGAGCCAGGG + Intergenic
924637173 1:245799191-245799213 CTGTGTAGGAGGACCAGGGAAGG - Intronic
1064279753 10:13940956-13940978 CTATAAAGGAAGAAGCAGGATGG + Intronic
1064330672 10:14391291-14391313 CTGCATAGAAGGAAGAGTGATGG - Intronic
1065768287 10:29052676-29052698 CTCTAAGGGAGGAAGAAGCAAGG + Intergenic
1065847892 10:29761288-29761310 CTGGACAGGAGGAAGTAGGCAGG + Intergenic
1065971366 10:30808549-30808571 CTGTGCAGAAGGAAGCAGGATGG + Intergenic
1066206393 10:33193426-33193448 CTTTATAGGAGGACGAAAGGAGG - Intronic
1066378322 10:34879656-34879678 GTTTCTAGGAGGCAGAAGGAAGG + Intergenic
1067786529 10:49253500-49253522 CTGGGTGGGAGGAAGGAGGAGGG + Intergenic
1068878909 10:62027953-62027975 CTTTATGGGAGGAAGGAGAAAGG + Intronic
1068964215 10:62895553-62895575 CTGTAATGAAAGAAGAAGGAGGG + Intronic
1069571489 10:69497039-69497061 CTGTAAAGCAAGAATAAGGATGG - Intronic
1070504008 10:77097276-77097298 CAGTAAAGGAGGAAGTGGGAAGG - Intronic
1071130381 10:82385601-82385623 CTCTATACAAGGAATAAGGAGGG + Intronic
1071551989 10:86573329-86573351 ATGTAAAGGTGGAAAAAGGATGG - Intergenic
1071708432 10:88025009-88025031 GTGTAAAGCAGGATGAAGGATGG + Intergenic
1073785687 10:106886599-106886621 CAGGAAAGAAGGAAGAAGGATGG + Intronic
1074123741 10:110512162-110512184 CTGCGTAGGTGGAGGAAGGAAGG + Intergenic
1074145935 10:110717344-110717366 CTGGAGAGGAGGGAGGAGGAGGG - Intronic
1076490640 10:130859128-130859150 GTGCATTGGAGGAGGAAGGAAGG + Intergenic
1076676140 10:132148697-132148719 CTGCACAGGAGGAGGGAGGAGGG + Intronic
1076980847 11:203943-203965 CTGTGTGGAAGGAAGGAGGAGGG + Exonic
1077761359 11:5103140-5103162 CTGGAAGGAAGGAAGAAGGAAGG + Intergenic
1078437257 11:11335711-11335733 CTTTATAAGAGGAAAAAGAATGG + Intronic
1078490177 11:11761016-11761038 CTGTCTTGGAAGAAGGAGGAAGG - Intergenic
1079975005 11:27079987-27080009 AGCTATAGGAGGAAGAAGAAGGG - Intronic
1082059851 11:47850478-47850500 CTGGAAAGAAGGAAGGAGGAAGG + Intergenic
1083206510 11:61152917-61152939 CTCTTTGGGAGGAAGAAGCAAGG - Intronic
1083274438 11:61588642-61588664 CTGGAAAGGAGGAAGAATGAGGG + Intergenic
1083904188 11:65659603-65659625 CTGAATAGGAGGAAGGGGGTTGG - Intronic
1084096674 11:66915862-66915884 CTGTAAAGGACGAAGAAAGAAGG - Intronic
1084398798 11:68931855-68931877 TTGTGTAGGAGGGAGTAGGATGG + Intronic
1085380575 11:76113775-76113797 ATTTATAAGAGGAAGAAGGTTGG + Intronic
1088341086 11:108767914-108767936 CTGAACAGAAGGAAGAAGAAGGG - Intronic
1088442936 11:109891875-109891897 CTGGAAAGGAGGAAGAGGAAAGG - Intergenic
1088519095 11:110675494-110675516 TTGTGGAGGAGGAGGAAGGATGG + Intronic
1088597985 11:111454146-111454168 CTCTATAGGAAGAAGATGCATGG + Intronic
1089304549 11:117518212-117518234 CTGGACAGGAGGAAGGAGGAGGG + Intronic
1089341554 11:117761373-117761395 CTCTGTAGGAGGAGGAAGGGAGG - Intronic
1089440361 11:118510904-118510926 CTCTCTAGGAAGAAGAAGGGAGG + Intronic
1089487927 11:118861509-118861531 CAGGAGAGGAGGAAGAAGCAGGG + Intergenic
1089847221 11:121467712-121467734 CTGGAGAGGAGGAAAAGGGAAGG + Intronic
1091182637 11:133620581-133620603 CAGTAAAGGAGAAAGGAGGAAGG + Intergenic
1091446107 12:544993-545015 CTCTAGAGCAGGAAGAAGGATGG - Intronic
1092695511 12:11167145-11167167 CGGTATAGGAGGCAGAATAATGG - Intronic
1092756377 12:11767039-11767061 CAGGCTAGGAGAAAGAAGGATGG + Intronic
1093024666 12:14234925-14234947 CTGTATAAGAGCAGGAAGAAAGG - Intergenic
1093855359 12:24095361-24095383 TTGTATGGGATGAGGAAGGAAGG - Intergenic
1094430562 12:30365130-30365152 CTGTTTAGGAAGAAAAAGAAAGG + Intergenic
1095345373 12:41143300-41143322 CTGTATTGGAATGAGAAGGATGG + Intergenic
1095507128 12:42909711-42909733 CAGCATAGGAGGGAGAAGGAAGG - Intergenic
1097180057 12:57166697-57166719 CTGGAGAGGAGGAACAAGGCAGG + Intronic
1097984835 12:65772035-65772057 GTGAATAGGAGGAAGAAGCAGGG - Intergenic
1098095051 12:66946001-66946023 CTGTGTAGCAGGAAGAAGGAAGG - Intergenic
1098170853 12:67745426-67745448 CTGTGAAGGAAGATGAAGGAAGG - Intergenic
1098460044 12:70722320-70722342 CTATATAGGAAGATGAAGGAAGG - Intronic
1099131346 12:78836243-78836265 CTGAAAGGGAGGGAGAAGGAAGG - Intergenic
1099883848 12:88502643-88502665 TTGTTTAGGAGGAAAAAAGATGG - Intronic
1101010100 12:100440707-100440729 GAGGAAAGGAGGAAGAAGGAAGG - Intergenic
1101346978 12:103894884-103894906 CTCTTTAGAAGGAGGAAGGATGG - Intergenic
1102565543 12:113794991-113795013 CTGAATAGGGGGAAGGAGGGAGG + Intergenic
1102699909 12:114830035-114830057 CAGAATAGGATGAAGAAGGGTGG + Intergenic
1103896676 12:124277899-124277921 CAGAAGAGGAGGAAGAGGGAAGG - Intronic
1104264969 12:127223338-127223360 CTCCAAAGAAGGAAGAAGGAAGG + Intergenic
1104558182 12:129821026-129821048 TTATATAGGAGAAAGGAGGAGGG - Intronic
1107444325 13:40456986-40457008 CTTTATAGAAGGAAGAGGGATGG + Intergenic
1107650335 13:42538502-42538524 CAGAAGGGGAGGAAGAAGGAAGG + Intergenic
1107698592 13:43024258-43024280 CTGTAGAGCTGGAAAAAGGAAGG + Intronic
1107959125 13:45543254-45543276 CTGTAGTGGGGGAAGAAGGTGGG - Intronic
1108870351 13:54976855-54976877 CTTTTTAGGAGGAAGAGAGATGG + Intergenic
1110150629 13:72248718-72248740 CAGAATAAGAGGAAAAAGGATGG + Intergenic
1112409856 13:99153681-99153703 CTGAATAGCAGGAAAAAGGGGGG + Intergenic
1112757609 13:102655788-102655810 CAGTGTACGACGAAGAAGGAAGG - Intronic
1113098738 13:106694566-106694588 CTGCACAGGCAGAAGAAGGAAGG - Intergenic
1113224753 13:108147450-108147472 CTGAATAGATGGAAGATGGAGGG - Intergenic
1113247369 13:108412579-108412601 CTGCAAAGGAGGAAGACAGAGGG + Intergenic
1113905389 13:113817202-113817224 CTGGAGAGGAGGAAGGAGGTTGG - Intergenic
1115814648 14:37150414-37150436 ATGTATATGAGTAAGAAAGAGGG - Intronic
1115975269 14:38990288-38990310 GTGTGTAGGAGGAACAAGAAAGG + Intergenic
1116475136 14:45331200-45331222 GAGAAGAGGAGGAAGAAGGAAGG - Intergenic
1116861088 14:49996153-49996175 CTTTGTTGGAGGGAGAAGGAAGG + Intronic
1116877516 14:50127472-50127494 CTGGCTAGCAGGAAGATGGAGGG - Intronic
1117352614 14:54896355-54896377 CTGGATGGCAGGGAGAAGGAAGG - Intronic
1117503495 14:56377261-56377283 CTTTATAAGGGAAAGAAGGAAGG - Intergenic
1117812104 14:59558168-59558190 GTGTGTTCGAGGAAGAAGGATGG + Intronic
1118846542 14:69551603-69551625 ATGGATGGGAGGAAAAAGGAAGG - Intergenic
1118886770 14:69873845-69873867 CTTTATAGGTGGAAGAGGGAGGG + Intronic
1119235746 14:73017787-73017809 CTGTAGAGGGACAAGAAGGAAGG - Intronic
1119472604 14:74909196-74909218 GTGTGTGGGAGGAAAAAGGAGGG + Intronic
1119887694 14:78157171-78157193 ATGGAGAGGAGGAAGTAGGAGGG + Intergenic
1120145754 14:80976654-80976676 CTGATCAGGAGGAAGAAGCAGGG - Intronic
1120175698 14:81291034-81291056 CAGGATAGGAGGAAGTAGGGAGG + Intronic
1120824899 14:88946223-88946245 CTATATAGAAGGAGGAAGGGAGG + Intergenic
1120963960 14:90151007-90151029 GTGAACAGGAGGAAGAAGGGAGG - Intronic
1121583961 14:95050229-95050251 ATGGATGGAAGGAAGAAGGAAGG + Intergenic
1121612389 14:95290429-95290451 CTTTATAAGAGGAAGACAGAGGG + Intronic
1121920553 14:97876876-97876898 CTGTAAAGTAGGAATAAGAAGGG + Intergenic
1124112227 15:26801725-26801747 ATCTAAATGAGGAAGAAGGAAGG + Intronic
1124330023 15:28803486-28803508 CTGAAGAAGAGGAGGAAGGAGGG + Intergenic
1127498105 15:59531301-59531323 CCTTGTAGGAGGAAGAGGGAAGG - Intergenic
1127976530 15:64001378-64001400 CGGGGTAGGAGGAGGAAGGAAGG - Intronic
1128327981 15:66737520-66737542 TTGAATTGGAGGAAGGAGGAAGG + Intronic
1129004026 15:72357340-72357362 CTGTTTGGGAAGAGGAAGGAAGG - Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129965468 15:79731264-79731286 CTCCATGGCAGGAAGAAGGAAGG - Intergenic
1130897865 15:88184638-88184660 CTGAATAGGAAAAAGAAAGAAGG - Intronic
1131738854 15:95364523-95364545 CTCCATAGGAGAAAGAAAGACGG - Intergenic
1132140092 15:99385163-99385185 CTGAAGGGCAGGAAGAAGGAAGG - Intronic
1133389301 16:5396337-5396359 CTGAATAGATGAAAGAAGGAGGG + Intergenic
1133551887 16:6864123-6864145 CTCTTTAGCAGGAAGAAGGAGGG + Intronic
1133600416 16:7334778-7334800 CTGCAAAGGAGGAAGAAATAGGG - Intronic
1133884253 16:9810865-9810887 CTCTATGGGAGGAAGGAGGTGGG + Intronic
1133953977 16:10423748-10423770 CTGATGAGGAGGAGGAAGGAGGG - Intronic
1134010054 16:10845272-10845294 CTGTATAGAAAGCAGAATGATGG - Intergenic
1134206120 16:12239152-12239174 CTGTGATGAAGGAAGAAGGAGGG + Intronic
1135742041 16:24984270-24984292 CTGTCTAGCAGGGAGGAGGACGG - Intronic
1135807006 16:25552058-25552080 CTGAGTAGGAGGCAGGAGGATGG - Intergenic
1135886896 16:26318386-26318408 ATGTTCAGGAAGAAGAAGGAAGG + Intergenic
1137041360 16:35615818-35615840 ATGGGTAGTAGGAAGAAGGATGG + Intergenic
1138646274 16:58427361-58427383 CTGCAAAAGAGAAAGAAGGAAGG - Intergenic
1139147487 16:64341737-64341759 CTGTCAAGAAGAAAGAAGGAAGG - Intergenic
1139229542 16:65270325-65270347 CTGTATGGGTGGAAAATGGAAGG - Intergenic
1139905901 16:70365824-70365846 GATTATAGGAGGAAGAAGAAGGG + Intronic
1140682125 16:77395401-77395423 CTCTGTAGGAGGAAGAAGTATGG - Intronic
1141018710 16:80474815-80474837 CTTTATAAGTGGAAGAAGGAAGG - Intergenic
1141072774 16:80973236-80973258 CTTAATATGAGGCAGAAGGAAGG - Exonic
1141179989 16:81745994-81746016 GTGTAAAGGAGGAAGAACAAGGG + Intronic
1141782453 16:86172531-86172553 CTGCATAGGAGGCCCAAGGAGGG - Intergenic
1142614716 17:1127587-1127609 CTGGAGAGGAGGAGGGAGGAGGG - Intronic
1143993614 17:10988128-10988150 GTGTAGAAGAGGAATAAGGAAGG - Intergenic
1144335662 17:14266986-14267008 ATGCATATGAGGAGGAAGGAAGG - Intergenic
1144459729 17:15448712-15448734 CTTCAGAGGAGGAGGAAGGAAGG - Intronic
1146011666 17:29199462-29199484 AAGTTAAGGAGGAAGAAGGAAGG - Intergenic
1146052167 17:29562811-29562833 CTGAGCAGGAGGAAGAAGTAGGG + Exonic
1146734859 17:35230062-35230084 ATTTATAGTAGGAAGATGGAAGG - Intergenic
1146829478 17:36055938-36055960 CTGGATAGGGGGAAGAAGAAGGG + Intergenic
1147909743 17:43848466-43848488 CATTTTAGGAGGAAGAAGGAAGG - Intronic
1148073975 17:44925049-44925071 CAGTAGAGGAGGAATGAGGATGG - Intronic
1148691388 17:49528929-49528951 GTTTATAGGATGAAGAAGGTGGG - Intergenic
1148828651 17:50414170-50414192 CTGTATAGCAAGAGTAAGGAAGG - Intergenic
1150504037 17:65680503-65680525 ATTAATGGGAGGAAGAAGGACGG - Intronic
1151305660 17:73261356-73261378 CTGTAGAGAAGGAAGGGGGAGGG + Intronic
1151374625 17:73678272-73678294 CAGTATCAGAGGAAGAAGGGAGG + Intergenic
1151391558 17:73790848-73790870 CTCTATAGAAGGAAGAATGAGGG - Intergenic
1151578846 17:74966515-74966537 CTGTGTTGGAGAAAGCAGGAAGG - Intronic
1151887552 17:76932130-76932152 CTGTGTAAGAAGAAGAAAGAAGG - Intronic
1152037275 17:77881123-77881145 CAGGATAGGAGGATGGAGGATGG + Intergenic
1152243032 17:79170101-79170123 CAGGAAAGGAGGAGGAAGGAAGG + Intronic
1152267659 17:79305634-79305656 CTGTGTGGGAGGAAGACGCAGGG - Intronic
1152370872 17:79887865-79887887 CTGTATTGGAAGGAGCAGGATGG - Intergenic
1153060658 18:991569-991591 CAGGGAAGGAGGAAGAAGGAAGG - Intergenic
1153145533 18:2027450-2027472 CAGTAGAGGAGCAAGAATGAAGG - Intergenic
1155739668 18:29272527-29272549 CTATAGAGGAAGAAGAGGGAAGG - Intergenic
1155996379 18:32334998-32335020 CTATATTTGAGGAGGAAGGAAGG - Intronic
1156242732 18:35268994-35269016 CTGAATAGGAGGAAAGTGGAGGG + Intronic
1157583332 18:48786059-48786081 CTGCAAAGGAGGAAGAATGATGG - Intronic
1157826993 18:50821286-50821308 CTCTGGAGGAGGAAGAAAGATGG + Intronic
1158081173 18:53592515-53592537 CAGCTTAGGAAGAAGAAGGAAGG - Intergenic
1158278561 18:55795292-55795314 TTTTAGAGGTGGAAGAAGGAGGG - Intergenic
1158876993 18:61743286-61743308 CTGTAAGGGAGGAAGGAGGTGGG - Intergenic
1161152000 19:2714497-2714519 CTGTAAAGGATCAAGAAGGGTGG - Intergenic
1162648034 19:12064443-12064465 CTGTGCAGGACGAAGAAGCAGGG + Intergenic
1162777550 19:12989112-12989134 GTGTATATGTGGATGAAGGATGG + Intergenic
1163833184 19:19557530-19557552 CTAGATAGGAGGAAGCAGCAGGG - Intergenic
1164763183 19:30743568-30743590 AAGGAGAGGAGGAAGAAGGAAGG - Intergenic
1165240598 19:34463761-34463783 CCTTATAGGAGGAGGAAGGCAGG - Intronic
1165478569 19:36047420-36047442 CCTTATAGGAGGAAAAGGGAAGG - Intronic
1166382430 19:42362025-42362047 GTGTCTGGGAGGCAGAAGGAGGG + Intronic
1167696904 19:51020094-51020116 CTGTGGAAGAGGAAGGAGGAAGG + Intronic
1168229866 19:55023623-55023645 CCGTATAGGAAGCAGAAGGCTGG - Intronic
1168382533 19:55936198-55936220 CTGAAAAGGAGGAATGAGGAGGG + Intergenic
925036698 2:692562-692584 CTCTATAGGAGGAAGAGGGCTGG + Intergenic
925090837 2:1154779-1154801 ATGTGTTGGAGGTAGAAGGAAGG - Intronic
925446250 2:3929400-3929422 CTGTAAAGGAGAAAGAATAACGG - Intergenic
928115494 2:28542889-28542911 CTGAGTAGAAGGATGAAGGAAGG - Intronic
928226171 2:29450073-29450095 CTGTCAAGGAGGGAGCAGGAAGG - Intronic
928958660 2:36898858-36898880 AGGAGTAGGAGGAAGAAGGAAGG + Intronic
929624761 2:43395233-43395255 CTGTATCTGAGTTAGAAGGAAGG - Intronic
931316482 2:61137441-61137463 CTGGATAGGAAGAAAAAGGGTGG - Intronic
932288803 2:70557854-70557876 CTGTGTATGAGAAAGAAAGAGGG + Intergenic
932383871 2:71312682-71312704 CTGAAGAGGAGGAAGAAGAAAGG + Intronic
932911886 2:75814996-75815018 CTTTATAAGAGGAAGACAGAGGG - Intergenic
933239198 2:79900637-79900659 ATGCTTGGGAGGAAGAAGGAAGG + Intronic
933500760 2:83108146-83108168 CTGTCTGGGAGCAAGAAAGAAGG + Intergenic
933820088 2:86103269-86103291 TTTTACAGGAGGAAGAAGCAGGG + Intronic
934677772 2:96261806-96261828 CTGTTTAGGAGGAAAAAAGCAGG + Intronic
935348322 2:102129708-102129730 CTACATAGGAGCAAGAAGAAAGG - Intronic
937151445 2:119689119-119689141 CTGTGAAGGACAAAGAAGGAGGG - Intergenic
937639658 2:124197221-124197243 CTGCAAAGGTGGAGGAAGGAGGG - Intronic
937989705 2:127655316-127655338 GGGTATAGGAGACAGAAGGAAGG + Intronic
939397913 2:141655100-141655122 CTGGGGAGGAGGAAGAGGGACGG + Intronic
939434663 2:142159551-142159573 AGGTAGAGGAGGAAGAAGGAGGG + Intergenic
940035532 2:149309043-149309065 CTGTTTAGGTGGAAGAGGAAAGG + Intergenic
941220167 2:162768619-162768641 TTTTAAAGGAGGATGAAGGAAGG + Intronic
941827605 2:169917312-169917334 CTGGACAGGGTGAAGAAGGAGGG - Intronic
941871241 2:170388245-170388267 CGGTATATGAGGAAGCAGTAGGG + Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942901449 2:181124755-181124777 CTGTGAAGGAGGAAGTAGGGGGG - Intergenic
943269718 2:185783624-185783646 CTGTAAAAGATGCAGAAGGAAGG + Intronic
943569784 2:189559737-189559759 CTGTGTAGGAAGAAGAAGCATGG - Intergenic
943689897 2:190858898-190858920 CTCTGTAGGAGAAAGAAGAATGG + Intergenic
943865706 2:192922723-192922745 CTGTGTAGGTGCTAGAAGGAAGG - Intergenic
944903964 2:204244204-204244226 CAGTCTAGGAGTAAGAAGGCTGG + Intergenic
944912063 2:204320563-204320585 GTGTATAGGATGGAGAGGGAAGG + Intergenic
945138078 2:206651595-206651617 GAGTAGAGGATGAAGAAGGAAGG - Intergenic
945723977 2:213452377-213452399 ATGTAGAGGAGCAACAAGGATGG - Intronic
946146740 2:217736820-217736842 CCGTATGGGAGGAAGATGCAGGG + Intronic
946898733 2:224352349-224352371 CTGTACAGGAGGAAGAAGAGAGG + Intergenic
947220069 2:227783347-227783369 CTATATAGAAGGAAGAAGAAAGG - Intergenic
947228614 2:227863426-227863448 CTGGGTAGAAGGGAGAAGGAGGG + Intergenic
1169821925 20:9721345-9721367 CTATATAGGAGCAAGAATGTTGG + Intronic
1170348422 20:15413502-15413524 TAGTAGAGGAGGATGAAGGAAGG + Intronic
1172301998 20:33856887-33856909 CTGTTAACAAGGAAGAAGGAGGG + Intergenic
1172976248 20:38908068-38908090 CTGTATAGGAAGGAGTATGAGGG + Exonic
1173082303 20:39879919-39879941 CTGTATTGGAGGATGGAGGGTGG - Intergenic
1173270901 20:41533915-41533937 CTGTATAGGAGGAAGTTTTATGG + Intronic
1173925574 20:46778772-46778794 GTGCAGAGGAGGAAGAGGGAGGG - Intergenic
1174103101 20:48142201-48142223 CTGTGTATGAGGAGGGAGGAGGG - Intergenic
1174502593 20:50996638-50996660 CTGTAAAGGAGGAGGGAGGCAGG + Intergenic
1174869786 20:54172412-54172434 TTGTAAAGGTGGAATAAGGAGGG - Intronic
1175763339 20:61576011-61576033 CTGAGTAGGAGGAAAAGGGAGGG + Intronic
1177854836 21:26388896-26388918 GTGTATAACAGGAAGAAAGAAGG + Intergenic
1178417462 21:32415367-32415389 CTGTGAAGGAGGAGGGAGGATGG + Intronic
1178719815 21:34998413-34998435 CTGAGGAGGAGGATGAAGGATGG - Intronic
1179224711 21:39443459-39443481 TTGGTTAGGAGGAGGAAGGAAGG + Intronic
1180581489 22:16843360-16843382 AGGAGTAGGAGGAAGAAGGAAGG + Intergenic
1181538841 22:23562317-23562339 CTGCCAGGGAGGAAGAAGGATGG + Intergenic
1181780706 22:25190896-25190918 CTGTGTAAGGGGAAGAATGAGGG + Intronic
1181829487 22:25548350-25548372 CTCTAAAAGAGGGAGAAGGAGGG + Intergenic
1182565198 22:31193295-31193317 CTGGATGGGAGAAAGAAGGTGGG + Intronic
1182877669 22:33706385-33706407 CTGCAGAGGAGGAAACAGGAAGG + Intronic
1182923065 22:34097856-34097878 CTGCATTGGAGGCAGAAGGGAGG + Intergenic
1183291956 22:37008147-37008169 CTGTGTAGGAAAAAGGAGGAAGG + Intergenic
1184376584 22:44117328-44117350 CTGTAGAGGGTGAAGGAGGAGGG + Intronic
1185032714 22:48453124-48453146 ATGCAAAGGAGGAAGAAAGAAGG + Intergenic
949585978 3:5437629-5437651 CTGCATAAGATGAAGAAGCATGG - Intergenic
950543028 3:13623445-13623467 TTGTACAGGATGAACAAGGAGGG - Intronic
950755880 3:15172050-15172072 ATATATAGGAGAAAGGAGGAGGG - Intergenic
951486023 3:23210960-23210982 CTGAATTGGAGGAAGAGAGAGGG - Intronic
951667471 3:25143276-25143298 CAGTGTAGGATGAAGAGGGAAGG + Intergenic
952699572 3:36311809-36311831 CTATACAGTAGGAAGAGGGATGG + Intergenic
952787595 3:37171118-37171140 CTTAATAAGAGGAAGAAGCAGGG + Intronic
955601258 3:60647809-60647831 TTGCAAAGGAGGAAAAAGGATGG + Intronic
955867071 3:63396400-63396422 ATGTCTAGGGGGAGGAAGGAGGG + Intronic
956289723 3:67648750-67648772 CAGCAAATGAGGAAGAAGGAAGG - Intronic
958798900 3:98733570-98733592 CAGTTTAGGAGAAAGGAGGACGG + Intronic
960172557 3:114479095-114479117 CAGGATGGGGGGAAGAAGGAAGG + Intronic
960270932 3:115673782-115673804 CAGTGGAGGAGGGAGAAGGATGG + Intronic
960636821 3:119792618-119792640 CTGGAGTGGAGGCAGAAGGAAGG - Intronic
960884729 3:122382977-122382999 CTCTGTAGGAGGAGGGAGGAGGG - Intronic
962097696 3:132308928-132308950 CTGTATAGCAAGAGTAAGGAAGG + Intergenic
964364443 3:155934377-155934399 CTCGATAGTAGGAAGAAGCAAGG - Intronic
965797765 3:172459124-172459146 CTGTTTAGGAGAAAGATGAAAGG + Intergenic
966066383 3:175826841-175826863 CTGTACTGGAGAAAGAAGGAAGG + Intergenic
966889649 3:184397794-184397816 CTGGAAAAGGGGAAGAAGGAAGG + Intronic
967437727 3:189469219-189469241 ATGTATAGTTGGAAAAAGGAAGG - Intergenic
968162852 3:196441115-196441137 CTTTTAAGGAGAAAGAAGGAGGG + Intergenic
968498007 4:929105-929127 ATGTCAAGGAGGAAGAAGGGTGG + Intronic
968914191 4:3490029-3490051 ATGAGTAGGAGGAAGAAGGAAGG - Intronic
968914349 4:3490737-3490759 ATGAGCAGGAGGAAGAAGGAAGG - Intronic
968914441 4:3491152-3491174 ATGAGCAGGAGGAAGAAGGAAGG - Intronic
969309065 4:6341697-6341719 CTGTATAGGAGGAAGAAGGAAGG + Intronic
969846366 4:9923178-9923200 CTGGGCAGGAGGCAGAAGGATGG + Intronic
970051719 4:11922079-11922101 CTGTGTTGGAGTAAGAAGGCCGG - Intergenic
970821872 4:20226177-20226199 CTTTATAAGGGAAAGAAGGAGGG + Intergenic
972671210 4:41215023-41215045 GGGGATAGGAGGTAGAAGGAAGG - Intronic
973664992 4:53150183-53150205 AGGTAAAGGAGGGAGAAGGAAGG + Intronic
973730178 4:53815613-53815635 AGGTATAGGAGGAGGAAGGGAGG - Intronic
973778451 4:54265638-54265660 CAGTATTGCAGGAAGAAGGGAGG + Intronic
974438835 4:61891277-61891299 TAGTATATGTGGAAGAAGGAGGG + Intronic
974535877 4:63174419-63174441 ATGTATAGGATGATGAATGAGGG - Intergenic
974997144 4:69175346-69175368 CAGAATAGGAGGAAGGTGGAGGG + Intronic
975237724 4:72019727-72019749 CTGTATTGAATGAAGGAGGAAGG + Intergenic
975978464 4:80126858-80126880 CTAGAAAGGAGGAGGAAGGAAGG - Intergenic
976448191 4:85156098-85156120 CAGGAAAGGAGGAAGAAGGAAGG + Intergenic
976456067 4:85247858-85247880 TTATATAGGAAGAAGAATGAAGG - Intergenic
976842744 4:89451001-89451023 TTGCATAAGATGAAGAAGGAAGG + Intergenic
977702243 4:100033911-100033933 CTGAAAAGGAGGAAGAAGAAAGG - Intergenic
978119869 4:105065518-105065540 CTGTGAAAGATGAAGAAGGAAGG + Intergenic
978554968 4:109970181-109970203 CTGAATGGCAGGAAGCAGGAAGG + Intronic
978884090 4:113745301-113745323 GTGCATAGAAGGAAGAAAGAAGG - Intronic
979547408 4:121953205-121953227 CTGGATAGCAGGGAGAAGCAGGG - Intergenic
980755469 4:137153759-137153781 CTGTATAGAATCAACAAGGATGG - Intergenic
983093349 4:163533335-163533357 CAGTTTAGGAGGAGAAAGGAAGG + Intronic
983203569 4:164888049-164888071 CTGTTTAGGAGGCAGAGGGTTGG - Intronic
983423455 4:167550950-167550972 TTTTATAGGAGGAAGACAGAAGG + Intergenic
983521629 4:168715495-168715517 CTTAACAGGAGGAAAAAGGAGGG + Intronic
983758573 4:171375161-171375183 CTGTATAGAAGGAACAAAAAAGG + Intergenic
983822102 4:172207387-172207409 CAGTAAAGGAGCAAGAGGGATGG + Intronic
984008455 4:174342302-174342324 CTGTATAGAAAAAATAAGGAAGG + Intergenic
985099874 4:186448302-186448324 CTCTCTAGAAGGAAGAATGATGG - Intronic
985333169 4:188863389-188863411 CTGAGGAGGAGGAAGAAGAAGGG - Intergenic
985793759 5:1947068-1947090 GTGTCGGGGAGGAAGAAGGAAGG - Intergenic
986027265 5:3862965-3862987 GTGTACAGGATGAAGAGGGATGG + Intergenic
986037606 5:3955058-3955080 AAGAATAGGAAGAAGAAGGAAGG - Intergenic
986276694 5:6281418-6281440 CTGTAAGGGAGAAAGAAGTAGGG + Intergenic
986468506 5:8050689-8050711 CTGTATAAGAAGGAGAAGGAAGG + Intergenic
986485870 5:8236353-8236375 CTGTTTTGGGGGAAGGAGGAGGG - Intergenic
986612196 5:9580389-9580411 ATGAATAGCAGGAAGAATGAAGG - Intergenic
986678254 5:10208648-10208670 CTGAAGAAGAGGAAGAGGGAGGG - Intergenic
987840512 5:23217558-23217580 CTGTTCAGGAGGAAGAATCAAGG + Intergenic
989040846 5:37226970-37226992 CTGTGTAGTAGTATGAAGGAAGG - Exonic
989377675 5:40781809-40781831 ATGTATAAGAGAAAGAAGGAAGG + Intronic
990181480 5:53165199-53165221 CTATAGTGTAGGAAGAAGGAAGG - Intergenic
990200248 5:53364658-53364680 TTGTATAGAAGGAACAATGAAGG + Intergenic
990531665 5:56679989-56680011 CTGTGGAGGAGGAAGAAGAGTGG - Intergenic
992406952 5:76468472-76468494 CTGTTTAGGAGGATGATGGCTGG - Intronic
992856265 5:80864611-80864633 CTGTGGAGGAGGAAGAAGAAGGG + Intronic
993330208 5:86590326-86590348 CTATACAGGAGGATGAAGGTAGG - Intergenic
993418887 5:87674881-87674903 CTGGATAGGAGAAAGGAGAAAGG - Intergenic
993673173 5:90786541-90786563 CAGCATAGGAGCAGGAAGGATGG + Intronic
993949455 5:94155588-94155610 ATATATGAGAGGAAGAAGGAGGG + Intronic
994157280 5:96518265-96518287 CTGTAGAGGAGGAAGAGGGAAGG - Intergenic
994501402 5:100583187-100583209 CTGAAGAGAAGGAGGAAGGAGGG + Intronic
994587784 5:101732693-101732715 CATTATAGGAGAATGAAGGAAGG - Intergenic
995248084 5:109958508-109958530 CTGTATTGAAGTAGGAAGGAAGG + Intergenic
996168795 5:120262608-120262630 CTTTAAAGGAGAAGGAAGGAAGG - Intergenic
996232951 5:121088411-121088433 CTGCATAGGAAGAGGAAGCATGG + Intergenic
996261623 5:121477820-121477842 TTATACAAGAGGAAGAAGGAAGG - Intergenic
996413454 5:123183802-123183824 CTGTTTAGTAAGAAGGAGGAAGG - Intronic
996624149 5:125549660-125549682 ATGTAGAAGAGGTAGAAGGAGGG - Intergenic
996987793 5:129588224-129588246 CTTTTTAGGAGGAAGAAGAGAGG + Intronic
997233703 5:132260520-132260542 CTGGAGAGAAAGAAGAAGGAAGG - Intronic
997402794 5:133615386-133615408 CTGGATGGGAGGCACAAGGATGG + Intergenic
997945360 5:138196023-138196045 GTGAAAAGGAGAAAGAAGGATGG - Intronic
997981849 5:138472591-138472613 CTGAATAGGGGGAAGGTGGAAGG - Intergenic
998422627 5:142001464-142001486 CTGTGAAAGTGGAAGAAGGAAGG + Exonic
999243431 5:150140483-150140505 CAGAATAGGAGGAATCAGGAGGG - Intronic
1000409936 5:160927718-160927740 GTGTCTAGGAGGTAGAAGAAAGG + Intergenic
1000920674 5:167133118-167133140 CAGTAAAGGGGGAAGAAGGGAGG + Intergenic
1001128363 5:169041582-169041604 CTGCATTGGGGAAAGAAGGAAGG - Intronic
1001186041 5:169573870-169573892 TTTTATAGGAACAAGAAGGAGGG - Intergenic
1001574213 5:172751384-172751406 CGGTCTAGGAGGGAGAAGGTGGG + Intergenic
1001831059 5:174789795-174789817 GTGTATAGGAGGAATGAGAATGG + Intergenic
1001917146 5:175571281-175571303 CTGTCTAGTAGGAAGAAGATGGG - Intergenic
1002608903 5:180400932-180400954 CTGTTGAGCAGCAAGAAGGAAGG - Intergenic
1002918228 6:1546161-1546183 CAGAGCAGGAGGAAGAAGGAGGG + Intergenic
1003023743 6:2534925-2534947 CGGAAGAGGAGGAAGAAGAAGGG - Intergenic
1003511901 6:6788725-6788747 CTGGATTGGAGGAAGATGCAGGG - Intergenic
1003548202 6:7078991-7079013 ATGAATGGGAGAAAGAAGGAAGG + Intergenic
1004934063 6:20490513-20490535 CTCTCTTGGAGGAAGAAGGTAGG - Exonic
1005395682 6:25379457-25379479 TTGGATAGATGGAAGAAGGAGGG + Intronic
1005890176 6:30130976-30130998 CTGTGTAAGAGGAAGAGGGGTGG - Intergenic
1006024451 6:31138307-31138329 CTGTAAAGGAGGAAGGAGAAAGG + Intronic
1006365326 6:33611698-33611720 CTGGATAGGAGGAGGAAGCTGGG - Intergenic
1006879950 6:37330897-37330919 CTGTTTGGGAGGAAGGAGGCTGG + Intronic
1006946147 6:37785607-37785629 CTGTGTGGGAGGAAGATGGATGG - Intergenic
1008116785 6:47560054-47560076 CTGTACTGGAGTTAGAAGGATGG - Intronic
1009751461 6:67883130-67883152 CTGTATAGTAGGAGGAAGAGAGG + Intergenic
1010067358 6:71699565-71699587 CTCTATAGGAGGGTGGAGGATGG - Intergenic
1010251046 6:73707411-73707433 CTACAGAGGAGGAACAAGGAGGG + Intronic
1010865581 6:80973424-80973446 CTGTCTATGAAGATGAAGGAAGG - Intergenic
1011011842 6:82711921-82711943 CTGTTAGGAAGGAAGAAGGAGGG - Intergenic
1012603330 6:101126177-101126199 GTGAATAGAAGAAAGAAGGAAGG - Intergenic
1012665698 6:101965779-101965801 AAGTATAGGAGGTAGGAGGAAGG + Intronic
1012791367 6:103701614-103701636 GAGTAGAGGAGGAAGAAGGCGGG - Intergenic
1013295208 6:108752629-108752651 ATGTATAGGTGGAAGAGGGAAGG + Intergenic
1013760515 6:113512136-113512158 CTGGAAAAGAGGAAGAAAGAGGG - Intergenic
1013761875 6:113528277-113528299 CTGAAGAGGTGGAAGAATGAAGG + Intergenic
1014040914 6:116823845-116823867 CAGATTAGGAGGAAGAAAGAGGG + Intronic
1014104158 6:117544520-117544542 CTTGATAGGAAGAAGAAGAAAGG + Exonic
1015688838 6:135897294-135897316 GTGTGTAGGCGGAGGAAGGAGGG + Intronic
1015715350 6:136186653-136186675 AAGTAGAGGAGGGAGAAGGAAGG + Intronic
1016748216 6:147604301-147604323 CTTTATAGGAGGAACAATTAAGG - Intronic
1016988079 6:149909965-149909987 CTTAATAGGAGGAAGCAGTAGGG + Intergenic
1016991884 6:149935791-149935813 CTTAATAGGAGGAAGGAGCAGGG - Intergenic
1017362779 6:153595498-153595520 CTATAAGGGAGGAAGAGGGAGGG - Intergenic
1017737871 6:157380749-157380771 CTGGGGAGGAGGAAGAAGGGAGG + Intergenic
1017920138 6:158864695-158864717 CTGTACAGAAGGAAGAAAAAGGG - Intergenic
1017950182 6:159129600-159129622 CAGGAAAGCAGGAAGAAGGAAGG - Intergenic
1017964501 6:159252243-159252265 CTGTGTAAGAGGAAGAAGTATGG + Intronic
1018465916 6:164044847-164044869 CTGTATGGGAACAAAAAGGAAGG + Intergenic
1018634753 6:165851015-165851037 GTGTATAGGAAGAGAAAGGAAGG + Intronic
1019397533 7:830093-830115 CTGTTAAGGGGGAAGGAGGAAGG + Intronic
1019465697 7:1187317-1187339 CTGTTTAGCAAGAAGGAGGAAGG + Intergenic
1019515234 7:1436947-1436969 CTCTTTTGGAGGAAGAAGGTGGG + Intronic
1020456321 7:8377329-8377351 CTGTGTAGGATGAATTAGGAAGG - Intergenic
1020878685 7:13730648-13730670 GTGTATAAGAAAAAGAAGGAGGG - Intergenic
1021927006 7:25543531-25543553 CTTTGCAGGAGGAAGATGGAAGG - Intergenic
1022787567 7:33653475-33653497 CTTCAGAGGAGGAAGAGGGATGG + Intergenic
1023214654 7:37848805-37848827 CTGTCTGGGAAGAAGAAGGGGGG - Exonic
1023548793 7:41346744-41346766 CAGGGTAGGAGGAAAAAGGAAGG - Intergenic
1025033209 7:55573358-55573380 CAGTACAGGAGGTGGAAGGAGGG + Intergenic
1026132194 7:67629936-67629958 TTGTATGGGAGGAGGGAGGAAGG - Intergenic
1026659257 7:72284928-72284950 CTGTAGAGGAAAAAAAAGGAAGG - Intronic
1027624032 7:80526489-80526511 CTGTATAGAATGAAAAAGGCAGG + Intronic
1027737508 7:81952714-81952736 GTGTAAAGGAAGAAGAAGAAAGG - Intronic
1027831909 7:83187575-83187597 CTTTAGAGAAGGCAGAAGGAAGG - Intergenic
1028365973 7:90032726-90032748 GTGTATAGGAACATGAAGGAGGG - Intergenic
1028519323 7:91712312-91712334 ATGGGAAGGAGGAAGAAGGAAGG + Intronic
1028534781 7:91880537-91880559 CTTTGGAGGAGGAAGAGGGATGG - Intronic
1028804757 7:95012293-95012315 CAGAATAGGAGGAACAGGGAGGG + Intronic
1029037680 7:97539413-97539435 CTGCTTAGGAGGAAGATGGATGG + Intergenic
1029186702 7:98744236-98744258 CTGAACAGGAGGAAGCAGAAAGG - Intergenic
1029746983 7:102521442-102521464 CTGGATAGGAGGCAGGAGCAGGG + Intergenic
1029764936 7:102620531-102620553 CTGGATAGGAGGCAGGAGCAGGG + Intronic
1030860944 7:114627634-114627656 ATATAAAGGAGAAAGAAGGAAGG - Intronic
1030877020 7:114826180-114826202 CTGGATAGGGTGAAGAAAGATGG + Intergenic
1031056223 7:116995636-116995658 CTGAATAGCAGGAATGAGGAAGG - Intronic
1032450332 7:132025072-132025094 GAGTAGAGGAGGAAAAAGGAGGG + Intergenic
1032752991 7:134861071-134861093 CTGGGAAGGAGGAAGAAGCATGG + Intronic
1033483223 7:141762224-141762246 TTGGTCAGGAGGAAGAAGGAGGG + Intronic
1033638905 7:143241606-143241628 CTGTGTAGGAAGTAAAAGGAAGG - Intergenic
1034328542 7:150260841-150260863 CTTTAAAGGTGGAAGAAGAAAGG - Intronic
1034764671 7:153708547-153708569 CTTTAAAGGTGGAAGAAGAAAGG + Intergenic
1034932500 7:155173699-155173721 CTGCACAGCAGGAAGAAGGCAGG + Intergenic
1035067117 7:156114338-156114360 AAGAATAGAAGGAAGAAGGAAGG + Intergenic
1036494109 8:9253737-9253759 CTGGAGAGGAGGAAGAAGAGGGG + Intergenic
1036620714 8:10423187-10423209 CTGGAGAGGAGGAAGAGGGTGGG - Intronic
1036908916 8:12735489-12735511 ATTTAAAGGAGGAAGAAGGAGGG + Intronic
1037563613 8:20097389-20097411 CTGAATAAGAAGAATAAGGAGGG - Intergenic
1038375227 8:27033539-27033561 CTGGGTAAGAGGAAGCAGGATGG - Intergenic
1038542070 8:28398256-28398278 CAGTATAAGAGGGAGAAGGCTGG - Intronic
1038943538 8:32331977-32331999 CAGTAAAGGATAAAGAAGGATGG + Intronic
1039436786 8:37564939-37564961 CTTTAGAGGAGGAAGATGGAAGG - Intergenic
1041237958 8:55823779-55823801 CTGGGGAGGAGGAGGAAGGAAGG + Intronic
1041643650 8:60229458-60229480 CAGTAAGGGAGAAAGAAGGAGGG - Intronic
1041657781 8:60371036-60371058 CTTTATAAGTGGATGAAGGAGGG + Intergenic
1042164510 8:65932863-65932885 GTGGATAGGAGGTAGATGGATGG + Intergenic
1042323645 8:67504884-67504906 CTGTGCAGGAGGGAGGAGGATGG + Intronic
1043084454 8:75810918-75810940 ATGAAGAGGAAGAAGAAGGAAGG - Intergenic
1045361534 8:101437828-101437850 CTTTCGAGGAGGGAGAAGGAGGG + Intergenic
1045497848 8:102723241-102723263 CTGTAAAAGAGGAAGAATAATGG - Intergenic
1047782738 8:128123227-128123249 CTCCATAGGGGGAGGAAGGAGGG - Intergenic
1047794736 8:128242932-128242954 CTGAAAGGAAGGAAGAAGGAAGG - Intergenic
1048232174 8:132653210-132653232 ATGGATAGATGGAAGAAGGAAGG + Intronic
1048766227 8:137847393-137847415 CAGTGTAGTAGGGAGAAGGAAGG - Intergenic
1049050875 8:140194218-140194240 CTGGATAGGAGGAGTTAGGAAGG - Intronic
1049391448 8:142373631-142373653 CTGTGTCAGAGGTAGAAGGAGGG - Intronic
1050025938 9:1334691-1334713 CTGTATATTATGAGGAAGGAAGG - Intergenic
1050119263 9:2291595-2291617 GTATTTAGGAGGAAGGAGGAGGG - Intergenic
1050250424 9:3737776-3737798 CAGGATGGCAGGAAGAAGGAAGG + Intergenic
1051823769 9:21196375-21196397 CTGTAATGGAGGAGAAAGGATGG - Intergenic
1052336764 9:27328219-27328241 CAGGTTAGGAAGAAGAAGGAGGG + Exonic
1052350501 9:27453925-27453947 CAGCATAGGAGGAAGAAGGCAGG - Intronic
1052416495 9:28184554-28184576 ATGTAAAGGGGGAGGAAGGAGGG + Intronic
1053406785 9:37883924-37883946 CTTTACAGCTGGAAGAAGGATGG + Intronic
1054885661 9:70195591-70195613 CTGGGTAGGATGGAGAAGGATGG - Intronic
1054932596 9:70651670-70651692 CTATGCAGGAGGAAGGAGGAAGG - Intronic
1055475058 9:76654812-76654834 CAGTGTGGTAGGAAGAAGGAAGG - Intronic
1056368415 9:85929515-85929537 TTGGAGAGGAGGAAGAAGGTTGG - Intergenic
1057111188 9:92472713-92472735 CTATATGGGAAGAAGAAGGGGGG + Intronic
1057825911 9:98371931-98371953 CTGGGCAGCAGGAAGAAGGAAGG - Intronic
1059111170 9:111559558-111559580 CTGGTGAGCAGGAAGAAGGAGGG - Intronic
1059543681 9:115155253-115155275 CTTTTTAGGAGGTAGAAAGATGG + Intronic
1060816951 9:126640077-126640099 ATGTATAGAAAGAAGAAGGGAGG + Intronic
1060900561 9:127253814-127253836 CTGTTTAACAGGAAGAAGGGAGG + Intronic
1062521965 9:136961671-136961693 TTCTGCAGGAGGAAGAAGGAGGG + Intergenic
1203779366 EBV:92348-92370 CTGAACAGGATGGAGAAGGAAGG - Intergenic
1186249116 X:7646987-7647009 CTGTCTGGGAAGAAGAAGAAGGG - Intergenic
1186699205 X:12071238-12071260 ACATATAGGAGGAAGAAGGAAGG - Intergenic
1188519288 X:31020108-31020130 CTGAAGAGGAGGAATAAGGAGGG + Intergenic
1188705685 X:33326768-33326790 CTGGAGAGAAGCAAGAAGGAAGG + Intronic
1189025009 X:37385329-37385351 CTGGACAGGAAGCAGAAGGAGGG + Intronic
1189638370 X:43037945-43037967 CTGTATAGGAGGAAGGACAATGG - Intergenic
1190053503 X:47169294-47169316 CACTAGTGGAGGAAGAAGGATGG - Exonic
1190908379 X:54750197-54750219 ATTTAAAGGAGGAAGAAGGAGGG + Intronic
1192018194 X:67354855-67354877 CTGGATAGGAGTAAGTAGGCTGG - Intergenic
1192799903 X:74455976-74455998 CTGAAGAGAAGGAAGAAGCAAGG + Intronic
1193478318 X:81995254-81995276 CTGTATTGGGGGCAGAAGGAGGG - Intergenic
1193601538 X:83512572-83512594 ATGGAGAGGAAGAAGAAGGATGG - Intergenic
1193642950 X:84034295-84034317 CTGAATAGGAGGAAAAAACAAGG - Intergenic
1193742981 X:85241271-85241293 CTGGAGAGGAGAGAGAAGGAGGG + Intergenic
1194801310 X:98276838-98276860 CTGGATGGGGGGAGGAAGGAGGG + Intergenic
1195486687 X:105416488-105416510 CTGTAAAGCAGGAAAAATGATGG + Intronic
1195575108 X:106440622-106440644 CTGTGTAGGAGGAATAGGGGAGG + Intergenic
1195938585 X:110147898-110147920 CTGAATAGGAAGAAGAGGAAAGG - Intronic
1195997449 X:110745436-110745458 CTGTGTAGGAGGGAGGAGGCTGG - Intronic
1196151084 X:112375215-112375237 CTGGCTAGGAGGAAGAGGGATGG + Intergenic
1196937217 X:120741957-120741979 GAGTTCAGGAGGAAGAAGGAGGG - Intergenic
1197126925 X:122957794-122957816 CTCTATGGGGGGAAAAAGGAGGG + Intergenic
1199837866 X:151611490-151611512 CTGTGTAGGAGGCAGAATAATGG + Intronic
1199916840 X:152351873-152351895 CTGTATCTCAGGGAGAAGGAAGG + Intronic