ID: 969310233

View in Genome Browser
Species Human (GRCh38)
Location 4:6348650-6348672
Sequence GAAAAGGCTGGGATGCAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969310221_969310233 27 Left 969310221 4:6348600-6348622 CCCACCTCGGCTCTGATCTGTGC 0: 1
1: 0
2: 0
3: 12
4: 164
Right 969310233 4:6348650-6348672 GAAAAGGCTGGGATGCAGCTTGG No data
969310228_969310233 -5 Left 969310228 4:6348632-6348654 CCCAGGACTTGGAATACTGAAAA 0: 1
1: 0
2: 2
3: 26
4: 251
Right 969310233 4:6348650-6348672 GAAAAGGCTGGGATGCAGCTTGG No data
969310220_969310233 28 Left 969310220 4:6348599-6348621 CCCCACCTCGGCTCTGATCTGTG 0: 1
1: 0
2: 1
3: 17
4: 170
Right 969310233 4:6348650-6348672 GAAAAGGCTGGGATGCAGCTTGG No data
969310226_969310233 1 Left 969310226 4:6348626-6348648 CCAGACCCCAGGACTTGGAATAC 0: 1
1: 0
2: 1
3: 6
4: 168
Right 969310233 4:6348650-6348672 GAAAAGGCTGGGATGCAGCTTGG No data
969310223_969310233 23 Left 969310223 4:6348604-6348626 CCTCGGCTCTGATCTGTGCTCTC 0: 1
1: 0
2: 0
3: 17
4: 224
Right 969310233 4:6348650-6348672 GAAAAGGCTGGGATGCAGCTTGG No data
969310222_969310233 26 Left 969310222 4:6348601-6348623 CCACCTCGGCTCTGATCTGTGCT 0: 1
1: 0
2: 0
3: 15
4: 182
Right 969310233 4:6348650-6348672 GAAAAGGCTGGGATGCAGCTTGG No data
969310229_969310233 -6 Left 969310229 4:6348633-6348655 CCAGGACTTGGAATACTGAAAAG 0: 1
1: 0
2: 0
3: 13
4: 163
Right 969310233 4:6348650-6348672 GAAAAGGCTGGGATGCAGCTTGG No data
969310227_969310233 -4 Left 969310227 4:6348631-6348653 CCCCAGGACTTGGAATACTGAAA 0: 1
1: 1
2: 4
3: 16
4: 201
Right 969310233 4:6348650-6348672 GAAAAGGCTGGGATGCAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969310233 Original CRISPR GAAAAGGCTGGGATGCAGCT TGG Intronic
No off target data available for this crispr