ID: 969311254

View in Genome Browser
Species Human (GRCh38)
Location 4:6354085-6354107
Sequence CAGAGCGCAAGGGGTTCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 115}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969311254_969311266 16 Left 969311254 4:6354085-6354107 CCATCTGAACCCCTTGCGCTCTG 0: 1
1: 0
2: 0
3: 5
4: 115
Right 969311266 4:6354124-6354146 ATCAGCATCTCTGTCCCCATGGG 0: 1
1: 0
2: 0
3: 16
4: 187
969311254_969311258 -9 Left 969311254 4:6354085-6354107 CCATCTGAACCCCTTGCGCTCTG 0: 1
1: 0
2: 0
3: 5
4: 115
Right 969311258 4:6354099-6354121 TGCGCTCTGCCCCTCAGCCCAGG No data
969311254_969311268 18 Left 969311254 4:6354085-6354107 CCATCTGAACCCCTTGCGCTCTG 0: 1
1: 0
2: 0
3: 5
4: 115
Right 969311268 4:6354126-6354148 CAGCATCTCTGTCCCCATGGGGG 0: 1
1: 0
2: 1
3: 21
4: 266
969311254_969311267 17 Left 969311254 4:6354085-6354107 CCATCTGAACCCCTTGCGCTCTG 0: 1
1: 0
2: 0
3: 5
4: 115
Right 969311267 4:6354125-6354147 TCAGCATCTCTGTCCCCATGGGG 0: 1
1: 0
2: 3
3: 28
4: 234
969311254_969311265 15 Left 969311254 4:6354085-6354107 CCATCTGAACCCCTTGCGCTCTG 0: 1
1: 0
2: 0
3: 5
4: 115
Right 969311265 4:6354123-6354145 CATCAGCATCTCTGTCCCCATGG 0: 1
1: 0
2: 3
3: 34
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969311254 Original CRISPR CAGAGCGCAAGGGGTTCAGA TGG (reversed) Intronic
901636134 1:10670978-10671000 CAGGGCCCGAGGGGTTCAGCCGG + Intronic
901925852 1:12565538-12565560 CAGAGCCCCAGGGGCTCAGAAGG - Intergenic
903336364 1:22627211-22627233 CAGAGCGCAGGGGGTTGCGGAGG - Intergenic
914748007 1:150513475-150513497 CAGAGCCCTAGAGGGTCAGATGG + Exonic
914885728 1:151582854-151582876 TATGGAGCAAGGGGTTCAGAAGG - Exonic
919840093 1:201602725-201602747 CAGCTCTCAAGGGGTGCAGAAGG - Intergenic
923422766 1:233835407-233835429 CAGAGGCAAAGTGGTTCAGATGG + Intergenic
923443806 1:234048768-234048790 TAGAGCCCAGTGGGTTCAGAAGG + Intronic
923569951 1:235104414-235104436 CACAGCGCACGCGGTACAGACGG + Intergenic
1065902962 10:30224540-30224562 CAGAGGGCCAGGAGTTCAGCGGG - Intergenic
1071780181 10:88835938-88835960 CAGAGCTTAAGGGGTTAAAAGGG - Intronic
1075495518 10:122915737-122915759 AAGAGAGAGAGGGGTTCAGAGGG + Intergenic
1085384445 11:76149111-76149133 CAGAGGGCAGGATGTTCAGATGG - Intergenic
1089120630 11:116132187-116132209 CAGAGCCCAAGGCATGCAGAGGG + Intergenic
1103235541 12:119369447-119369469 CAGAGTGCCAGAGATTCAGAGGG + Intronic
1105636570 13:22221140-22221162 GGGAGCGCAAGAGGTTCTGAAGG - Intergenic
1106961241 13:35000684-35000706 TAGAGGGGAAGGGGTTGAGATGG + Intronic
1111069852 13:83151194-83151216 CAGATCACAAGGTGTCCAGATGG - Intergenic
1112333099 13:98492122-98492144 CAGATCGCAAGAGGCTCAAATGG + Intronic
1121821388 14:96970695-96970717 CAGAGCCCAAAGGGTTCAACAGG - Intergenic
1126387599 15:48109955-48109977 CTGAGGGCAAGAGGTTCACAGGG - Intergenic
1128002640 15:64207667-64207689 CAGAGCCGAAGGGTTTCTGAAGG - Intronic
1128861764 15:71080158-71080180 CAGAAGGCAAGGGGTTGAGGGGG + Intergenic
1129265185 15:74389511-74389533 GGGAGGGCAAGGGGTTGAGAAGG + Intergenic
1131250171 15:90825288-90825310 CAGACAGCAAGGGGTTCAGGAGG + Intergenic
1131724523 15:95207126-95207148 CAGAGGGCCAGAGGTTTAGAAGG + Intergenic
1132604969 16:789819-789841 CAGAGCCCCAGGGGTGCAGAGGG + Intronic
1132729421 16:1353963-1353985 CAGAGATAAAGGGGATCAGATGG + Intronic
1141291127 16:82718894-82718916 CAGAGTGAAAGGAGTTGAGATGG + Intronic
1142000188 16:87659961-87659983 CAGAGCTCAACGGGCCCAGAAGG - Intronic
1142852840 17:2712406-2712428 CAGAGAGCAAGGGGTAGAGCCGG + Intronic
1147110395 17:38257222-38257244 CGGAGCGCTAGGGGTTGGGAAGG + Intergenic
1147444673 17:40467540-40467562 CAGAGAGCAAGGGGGTGTGAGGG - Intergenic
1148437367 17:47694513-47694535 CCGAGCGAAAGGGGTTTAAAGGG + Intronic
1148475823 17:47927987-47928009 CAGAGCCAAGGGGCTTCAGAAGG - Exonic
1151401209 17:73857224-73857246 CAGTGGGCAAGGGGTTCAAGAGG - Intergenic
1157474482 18:48012541-48012563 CAGGGAGGAAGGGGCTCAGAGGG - Intergenic
1161859200 19:6785011-6785033 CAGAGAGCAATGGGTAGAGAGGG - Intronic
1162003727 19:7764084-7764106 CAGAGATCAAGGGGTTGAGGAGG + Intronic
1162331423 19:10032229-10032251 CCTAGCTCAAGGGCTTCAGAAGG - Intergenic
1163783220 19:19261311-19261333 GAGAGGGCGAGGGGCTCAGATGG + Intronic
924986744 2:277950-277972 CAGAGGCAAAGTGGTTCAGATGG - Exonic
925907548 2:8548209-8548231 CAGGGCCCAGGGTGTTCAGAGGG - Intergenic
926761587 2:16283210-16283232 CAGAGCTCATGGGGTTGGGATGG - Intergenic
926776423 2:16427986-16428008 CACAGGGCCAGGGGTGCAGAAGG + Intergenic
926777969 2:16440710-16440732 AAGAGGGGAAGGGGTGCAGAAGG + Intergenic
929929012 2:46237864-46237886 CAGAGAACATGGGGTTCAGTTGG - Intergenic
934480576 2:94638242-94638264 CAGAGAGAAAGAGTTTCAGACGG + Intergenic
936078251 2:109415519-109415541 CAGAGGGCAAGGGAGTCAGGAGG - Intronic
936428189 2:112436722-112436744 CAGGGGGCAAGGGCTTAAGACGG + Intergenic
939508470 2:143076903-143076925 CAGAGTGCATGTGGTGCAGAAGG + Intergenic
942561637 2:177226137-177226159 CAGAGCGCACGGGATTAAAAAGG - Intergenic
1170449721 20:16470202-16470224 CAGAGCGCAAGGTGTTTTTAGGG + Intronic
1172276497 20:33682550-33682572 GAGAAGGCAAGGGGTGCAGATGG - Intronic
1173189217 20:40863388-40863410 CATAGGGAAAGGGGTTAAGAGGG - Intergenic
1174327671 20:49792172-49792194 CAGAGAACAAGGGGAACAGAGGG + Intergenic
1175415454 20:58797681-58797703 CAGAGGACAAGAGCTTCAGAGGG + Intergenic
1176002957 20:62841894-62841916 CAGAGCTCCAGGGTTGCAGAAGG + Exonic
1176374062 21:6078489-6078511 CAGGGGGCAAGGGCTTAAGACGG - Intergenic
1177048704 21:16203977-16203999 CAGGGTGCATGGGTTTCAGATGG + Intergenic
1179288850 21:40000994-40001016 CAACGGGCAAGGGGCTCAGAAGG + Intergenic
1179749415 21:43459754-43459776 CAGGGGGCAAGGGCTTAAGACGG + Intergenic
1180175152 21:46083702-46083724 CAGAGCGGGAGGGGCCCAGAGGG + Intergenic
1181659987 22:24339328-24339350 CAGAGTGGAAGGGGTGCACAAGG + Intronic
1182076731 22:27500033-27500055 CAGAGGGCAAGGGGTGGAGCAGG - Intergenic
1183025408 22:35062250-35062272 CAAAGCGGAAGTGGTTCAGGAGG - Intergenic
1183831939 22:40422884-40422906 CAGAGCACAAAGGGTGCAGGTGG + Intronic
1184899526 22:47436063-47436085 CAGAGTGCATGCAGTTCAGAGGG - Intergenic
950106043 3:10389335-10389357 CAGCAAGCAAGGGCTTCAGAGGG + Intronic
952978192 3:38713997-38714019 CAGAGCGCGAAGGGTTCGAAGGG + Exonic
954005658 3:47588468-47588490 CAGTGCCCTAGAGGTTCAGAAGG - Intronic
955233954 3:57123392-57123414 CAGTGCCCAAAGGGTTTAGAAGG - Intronic
955811442 3:62794961-62794983 CAGAGCGCTATGGGTTCTCAGGG + Intronic
962752708 3:138445508-138445530 CACAGTGCAAGTGGTTGAGATGG - Intronic
966336098 3:178870005-178870027 CAGACCACAAGGGGTTGAGAAGG - Intergenic
968827571 4:2910783-2910805 CAGTGAGCATGGTGTTCAGAAGG - Intronic
969311254 4:6354085-6354107 CAGAGCGCAAGGGGTTCAGATGG - Intronic
969453908 4:7290298-7290320 CACAGCTGAAGGGGTCCAGATGG - Intronic
971756599 4:30716975-30716997 CTGAGAGGAAAGGGTTCAGAAGG - Intergenic
982741039 4:159057214-159057236 TAGAGGGCAAGGGGCCCAGATGG + Intergenic
983511005 4:168609610-168609632 CAGAGCACAAGAGGTGCTGAGGG + Intronic
997283605 5:132663386-132663408 CAGAGAGAAGGGGGTTGAGAAGG + Intergenic
997633501 5:135387645-135387667 CAGCCTGCAAGGGGTTGAGAAGG - Intronic
998869354 5:146537054-146537076 CAGAGCGCAGGGGATCCAGATGG + Intergenic
1003162995 6:3651881-3651903 CAAAGAGGAAGGGGTGCAGAGGG + Intergenic
1006854583 6:37124087-37124109 CAGAGGGGAAGGGGAGCAGAGGG + Intergenic
1006854589 6:37124103-37124125 CAGAGGGGAAGGGGAGCAGAGGG + Intergenic
1007761547 6:44136254-44136276 CAGAGCTCCAGGGCTACAGAAGG - Intronic
1012494576 6:99820045-99820067 CAGAGTGGAATGGGTGCAGAGGG - Intergenic
1013195413 6:107840794-107840816 CAGAGCAGCATGGGTTCAGATGG - Intergenic
1015499185 6:133913625-133913647 CAGAGCTCAAGGGGATAAAAAGG + Intergenic
1019660148 7:2219636-2219658 CAGAGCGGTAGGGGGGCAGATGG + Intronic
1020120291 7:5499328-5499350 CAGAGAGCAGTCGGTTCAGAGGG - Intronic
1024107398 7:46107388-46107410 CAGAGAGCAATGGGTGCAGCTGG + Intergenic
1024208842 7:47186589-47186611 CAGAGAGCTAGGTGTACAGAAGG - Intergenic
1024466052 7:49712156-49712178 CAGTGCGGAAGGGGATCCGAGGG - Intergenic
1025753442 7:64312717-64312739 AAGAGCTCCAGGGATTCAGAGGG - Intronic
1029597973 7:101547573-101547595 CAGAAACCAAGGGGTTCAAAGGG + Intronic
1038396260 8:27247721-27247743 CAGAGTGCCAGGGATTCAGGTGG + Intronic
1038612996 8:29071315-29071337 CAGAGCCCAGGGAGTGCAGAGGG + Intronic
1039921368 8:41896507-41896529 CTGAGCGCTAGGGGTCCAGGAGG - Exonic
1041632484 8:60103616-60103638 CAGTGCACAAGGGGTGCACATGG + Intergenic
1042075457 8:64988914-64988936 CAGAGGCCAAGGAGTTCAAATGG - Intergenic
1044264065 8:90162147-90162169 CAGTGAGAGAGGGGTTCAGAGGG - Intergenic
1044895847 8:96890683-96890705 CAGAGCCCAAAGTGTCCAGATGG + Intronic
1051552405 9:18344847-18344869 CAGAACCCATGGGGTTCTGAAGG + Intergenic
1053677258 9:40445697-40445719 CAGAGAGAAAGAGTTTCAGACGG - Intergenic
1053927016 9:43071853-43071875 CAGAGAGAAAGAGTTTCAGACGG - Intergenic
1054286461 9:63179223-63179245 CAGAGAGAAAGAGTTTCAGACGG + Intergenic
1054290331 9:63281224-63281246 CAGAGAGAAAGAGTTTCAGACGG - Intergenic
1054388354 9:64585760-64585782 CAGAGAGAAAGAGTTTCAGACGG - Intergenic
1054507364 9:65930598-65930620 CAGAGAGAAAGAGTTTCAGACGG + Intergenic
1056708526 9:88971560-88971582 CAGAGCTCCAGGGGCCCAGAGGG + Intergenic
1060963610 9:127699223-127699245 CAGAGCGCCAGGGGTTCCTTGGG - Intronic
1192736283 X:73852192-73852214 CAGAGTGTTGGGGGTTCAGAGGG + Intergenic
1193399101 X:81021113-81021135 CAGGGCGTCAGGGGTTCACAGGG + Intergenic
1195051541 X:101101551-101101573 CAGAGCCAAAGGGGTAGAGAGGG - Intronic
1198962612 X:142198478-142198500 CAAAGAGCAAGGCGTTCACAAGG + Intergenic
1199616309 X:149658881-149658903 CAGGGCCCAAAGGGTGCAGATGG - Intergenic
1199626332 X:149744367-149744389 CAGGGCCCAAAGGGTGCAGATGG + Intergenic
1199654499 X:149981121-149981143 CACAGGGCAAGGGGTATAGAGGG - Intergenic