ID: 969311286

View in Genome Browser
Species Human (GRCh38)
Location 4:6354220-6354242
Sequence CCTCCTCGGTGGGGTGGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 476
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 428}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969311286_969311301 30 Left 969311286 4:6354220-6354242 CCTCTCCCACCCCACCGAGGAGG 0: 1
1: 0
2: 3
3: 44
4: 428
Right 969311301 4:6354273-6354295 GCTCTTCCTCAGTCTCACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969311286 Original CRISPR CCTCCTCGGTGGGGTGGGAG AGG (reversed) Intronic
900468325 1:2836792-2836814 CCTCTGCAGTGGGCTGGGAGGGG - Intergenic
901636096 1:10670857-10670879 CCTTCTCGGAGGGGATGGAGGGG - Intronic
901788036 1:11637537-11637559 CCTCCTGGGCAGGGTGTGAGGGG - Intergenic
902809587 1:18880501-18880523 CCTCCAGGGAGGGGTGGTAGGGG - Intronic
902896819 1:19485277-19485299 CCTCCTGGGCGGGGAGGGACCGG + Intronic
902918428 1:19652501-19652523 CCTCCCCAGTGGGCTGGGAGTGG + Intronic
903006527 1:20302517-20302539 GCTCCTGGTTGGGGTGGGTGGGG + Intronic
903187088 1:21634829-21634851 AGTCCTCGGTGGGGTGGGAAGGG - Intronic
903230974 1:21922201-21922223 CCTCCTCTGTCAGGTGGGAATGG - Intronic
904002974 1:27349248-27349270 CCTCCGACGCGGGGTGGGAGTGG - Intronic
904251085 1:29224868-29224890 CACCCTGGGTGAGGTGGGAGGGG - Intronic
904731900 1:32599311-32599333 GCTCCTCGGTAGGTTGGGATGGG + Intronic
905323451 1:37133600-37133622 ACTCCACGGTAGGTTGGGAGTGG + Intergenic
905505561 1:38476526-38476548 GCTCCTGGGTGGGGGGGGCGCGG - Intergenic
906145487 1:43557986-43558008 CCTCCTAGGAGGGAGGGGAGGGG - Intronic
906238685 1:44228241-44228263 GCACCTCGGTGGGGTGGAGGGGG - Intronic
906241128 1:44242876-44242898 CCTCCTCGTTGAGGGGGGTGCGG - Intronic
906493941 1:46289955-46289977 CATCCTCAGTGGGCTGGTAGGGG + Intronic
907493453 1:54825866-54825888 GCTCCTGGGTGGTGTGTGAGTGG + Intronic
908796256 1:67833458-67833480 CCGCCTCGCTGGGGTGGGCGGGG + Exonic
910070417 1:83206990-83207012 TTTTCCCGGTGGGGTGGGAGGGG + Intergenic
912736171 1:112151372-112151394 CTAACTGGGTGGGGTGGGAGTGG + Intergenic
915701875 1:157804070-157804092 TCCCCTCTGTGGGATGGGAGGGG + Exonic
916069761 1:161163025-161163047 CCTCCTCGGCGGGGTGGAGAGGG - Exonic
916181095 1:162084490-162084512 CCTCCTTGCTGGGGTGTCAGAGG - Intronic
916683721 1:167126402-167126424 GCTCCTCGGTGGGGAGGCGGCGG + Exonic
917782546 1:178413367-178413389 CCACCTAAGTGGGGTGGGTGGGG + Intronic
918413698 1:184286301-184286323 CCTCTTGGGTTGGGTGGGATGGG + Intergenic
919739408 1:200973128-200973150 GCTCCTCGGAAGGGTGGGATGGG + Intronic
919853270 1:201688228-201688250 GCTCCTTGGTGGGGTGAGGGTGG + Intronic
919892165 1:201983180-201983202 CCTCCCGGGTGGGGTAGGTGAGG - Intronic
920061471 1:203229710-203229732 ACTCCTGGCTGGGGTGGGACAGG - Intronic
920500987 1:206485321-206485343 CCTTCTTTGTGGGGTGGGAGTGG + Intronic
920505921 1:206515388-206515410 CCTACGGGGTGAGGTGGGAGCGG - Intronic
920612402 1:207454469-207454491 GGTCCTCGGTGAGCTGGGAGGGG + Exonic
920655093 1:207868835-207868857 CCTCGCCGCGGGGGTGGGAGCGG - Intergenic
921355388 1:214280871-214280893 CCTCCTCGGTGGGAGGGAGGGGG - Intergenic
921389331 1:214603472-214603494 CCAGTTCGGTCGGGTGGGAGGGG - Intronic
922718958 1:227890668-227890690 CCCCCTGGCTGGGGTGCGAGTGG - Intergenic
1063159193 10:3407461-3407483 CCTCCTCGCTGGGGTGGAAAAGG + Intergenic
1063559453 10:7112828-7112850 CTGCCTTGGTGGGGTGGGAGAGG + Intergenic
1064998676 10:21317975-21317997 GCTCCTGGTTGGGCTGGGAGTGG - Intergenic
1065046991 10:21753921-21753943 CCTCCTCAGTGGGCAGGGTGAGG + Intergenic
1065674932 10:28164252-28164274 CCTCCTGAGAGGGGAGGGAGAGG + Intronic
1065815845 10:29481723-29481745 CCTTTTCTGTAGGGTGGGAGGGG + Exonic
1066747613 10:38616421-38616443 CCTGCTTGGGGGAGTGGGAGTGG - Intergenic
1067448872 10:46369148-46369170 CCTTCTCGGTGCGGTGGGCCAGG - Exonic
1067588500 10:47491617-47491639 CCTTCTCGGTGCGGTGGGCCAGG + Exonic
1067635627 10:47999708-47999730 CCTTCTCGGTGCGGTGGGCCAGG + Intergenic
1067715865 10:48690965-48690987 GCTCCTGGGTGGAGTGGGGGAGG - Intronic
1067762318 10:49057608-49057630 CCTCCAGGCAGGGGTGGGAGTGG - Intronic
1067877896 10:50020687-50020709 CCTTCTCGGTGCGGTGGGCCAGG - Intergenic
1068511618 10:57973003-57973025 CCTCCTCAGGGGAGTGGGTGTGG - Intergenic
1069542682 10:69307273-69307295 CCTCCCCCGGGGGGTGGGGGTGG - Intronic
1069802467 10:71090620-71090642 GCTTCTCAATGGGGTGGGAGAGG + Intergenic
1070132184 10:73663715-73663737 CCTTCTCGGTGCGGTGGGCCAGG + Intronic
1070513213 10:77179710-77179732 TCTCCTGGGAGTGGTGGGAGGGG - Intronic
1070779875 10:79131319-79131341 CCTCTTCGGTGGCGGGGGATTGG + Intronic
1071565882 10:86671054-86671076 GGTCCTGGCTGGGGTGGGAGTGG - Intronic
1071601116 10:86959195-86959217 CCTTCTCTCTGGGGAGGGAGGGG - Intronic
1071609497 10:87020360-87020382 CCTTCTCGGTGCGGTGGGCCAGG - Exonic
1072721574 10:97784284-97784306 CCTCCAGGGTGGGTTGGTAGGGG - Intergenic
1072733852 10:97866028-97866050 CCCCCTCGCAGGGTTGGGAGAGG - Exonic
1073035738 10:100563041-100563063 CCTACTGGGAGGAGTGGGAGAGG + Intergenic
1073299462 10:102461999-102462021 ACTCCTCAGTGGCTTGGGAGGGG + Intronic
1073563848 10:104519015-104519037 CCTCCTCGCTGCTCTGGGAGGGG + Intergenic
1075608718 10:123834796-123834818 CCTCCTTGGTGGGGGTGCAGGGG + Intronic
1075726328 10:124612717-124612739 CCTCCTCTGTTGGGTGGGCGTGG + Intronic
1076445249 10:130509818-130509840 CCACCTCTGTTTGGTGGGAGGGG + Intergenic
1076502156 10:130945684-130945706 CCTCCCTGGAGGGGTGGGGGTGG + Intergenic
1076727818 10:132421592-132421614 CCGCCTCTGTAGGGTGGGGGCGG - Intergenic
1076771943 10:132670557-132670579 CCTCCTTGCTGGGGGGAGAGTGG + Intronic
1076853910 10:133106057-133106079 CCTCCTAACCGGGGTGGGAGAGG - Intronic
1077051116 11:567510-567532 CCTGCTCGCTGGAGAGGGAGAGG - Intergenic
1077385649 11:2268401-2268423 CCTCCTCCGTAGGGTGGGTCTGG - Intergenic
1077390797 11:2299956-2299978 GCTCCTTGGTGGGGTAGGGGTGG + Intronic
1077546475 11:3172547-3172569 CCAGGTCTGTGGGGTGGGAGGGG + Intergenic
1077897618 11:6465484-6465506 CCTCCCCTGTGGGGAGGGTGAGG - Intronic
1078552508 11:12290253-12290275 CCCCCTAGCAGGGGTGGGAGTGG + Intronic
1081502489 11:43680529-43680551 GCGCCTCGGTGGGGTGAGACAGG + Intronic
1083276470 11:61599807-61599829 CCTCCTCTGAGGGGCAGGAGGGG + Intergenic
1083992865 11:66257712-66257734 CTACCTCGGTGGCGTCGGAGGGG - Intronic
1084144120 11:67255093-67255115 TCTCCTCGGTGGGGAGTCAGGGG - Exonic
1084353123 11:68618068-68618090 CCTCCTTGGCGGGGTAGGAAAGG - Intergenic
1084403530 11:68958419-68958441 CCTCGAGGGTGGAGTGGGAGTGG - Intergenic
1084445344 11:69200478-69200500 CCTCTCCCGTCGGGTGGGAGCGG + Intergenic
1084470744 11:69357611-69357633 CATCCATGGTGGGGTGGGATGGG + Intronic
1084489174 11:69469057-69469079 CCGCCTCGCTGTGGTGGAAGCGG + Intergenic
1084749828 11:71197278-71197300 CCTCCCGGGTGGGGTGGAGGAGG + Intronic
1085300630 11:75456264-75456286 CATCCTGGGAGCGGTGGGAGTGG + Intronic
1085346168 11:75769280-75769302 CCTCATCCGTGAGGTGGGAGCGG + Intronic
1085347563 11:75778110-75778132 CTTCCTGGGTGAGGTGGGTGGGG - Intronic
1088914941 11:114220319-114220341 CCTCCACTGTGGTGTTGGAGTGG + Intronic
1088972669 11:114787360-114787382 CCTCCTCTGTGGCGTGGGGTGGG + Intergenic
1089138702 11:116269751-116269773 CCTCTCAGGTGGGGTTGGAGAGG - Intergenic
1089303206 11:117511063-117511085 CCTACTCGTTAGGGTGGGAGAGG + Intronic
1089352006 11:117826911-117826933 GCTCCTTGGTGGGGTGGCTGGGG + Intronic
1089493573 11:118897874-118897896 CCTGCAGGGAGGGGTGGGAGAGG + Exonic
1089631496 11:119787272-119787294 CCTCCCAGGAGGGCTGGGAGCGG - Intergenic
1089792344 11:120954024-120954046 CCATCTCTGTGGGGTGGGTGGGG + Intronic
1090802389 11:130181026-130181048 CCTGCTGGGTGGGATGGCAGTGG + Intronic
1094059453 12:26298027-26298049 CCTCCTAGGTGATGTGGGGGAGG - Intronic
1094329135 12:29273363-29273385 CTTCCTCGTTGGTGGGGGAGGGG - Intronic
1094526123 12:31232400-31232422 CCTCCTCCGAGGGCTGGCAGTGG + Intergenic
1096542835 12:52317773-52317795 CATCCTGGGTGGGGTAGAAGGGG + Exonic
1097175919 12:57142914-57142936 TCTCCTAGGTGGGGGTGGAGTGG + Intronic
1099151269 12:79116882-79116904 CCTCCTCACTGGAGGGGGAGAGG - Intronic
1100571480 12:95847129-95847151 CTTGCTGGGTTGGGTGGGAGGGG + Intergenic
1101032186 12:100671539-100671561 ACTCCTTGGTGGGGTTGGAATGG + Intergenic
1101317216 12:103640366-103640388 CCTACTATGTGGGGTGGGGGTGG - Intronic
1102013035 12:109630772-109630794 CCTCCTGGGTGGTGAGGGAAGGG + Intergenic
1102054667 12:109887610-109887632 CATCCTTGCTGGGGAGGGAGTGG - Intergenic
1102136888 12:110583034-110583056 CCTCCTCGGGGGGGCGGCGGCGG - Exonic
1102201204 12:111059245-111059267 GCTTCTCGGGGAGGTGGGAGGGG + Intronic
1102939333 12:116925230-116925252 CTGCCTTAGTGGGGTGGGAGGGG + Intronic
1102945019 12:116979278-116979300 CCTCCTTAGGGAGGTGGGAGGGG + Intronic
1102966451 12:117131406-117131428 CATCCTCAGTGGGCTGAGAGGGG + Intergenic
1103236069 12:119373653-119373675 TCTCCGGGGTGGGGTGGGGGGGG + Intronic
1103364244 12:120370120-120370142 CAGCCTCGGTGTGGTGGGGGTGG - Intergenic
1103918491 12:124387889-124387911 CCTGCTGGGTGGGGTGGGCATGG + Intronic
1104013555 12:124948270-124948292 CCTCCTGGGTGGGGCTGGTGGGG - Intronic
1104591299 12:130086234-130086256 GCTCTGGGGTGGGGTGGGAGTGG - Intergenic
1104823410 12:131692209-131692231 CCTCCTCTCCGGGGTTGGAGAGG + Intergenic
1106036836 13:26051450-26051472 CCTCCTCGGGCGGGTAGAAGGGG + Intergenic
1106170523 13:27284350-27284372 ACCCCTGGGTGGGGTGGGAAAGG + Intergenic
1107460759 13:40599715-40599737 CGGCCTCGGAGGGGTGGTAGAGG + Intronic
1109010302 13:56932612-56932634 CCTGCTTGTTGGGGTAGGAGTGG - Intergenic
1111980759 13:95013016-95013038 GCTCCTCTGTGCAGTGGGAGTGG - Intergenic
1112173167 13:96994397-96994419 GGGCCTCGGAGGGGTGGGAGGGG - Intronic
1112618145 13:101026725-101026747 CCATCTGGGTGGGGTGGGATGGG - Intergenic
1112788196 13:102974757-102974779 CCTCCTCCCTGGGGAGGGAGGGG - Intergenic
1119544101 14:75459431-75459453 ACTCCCAGGTGGGGTGGGAGTGG + Intronic
1121168880 14:91836519-91836541 CCTGGTGGGTGGTGTGGGAGTGG - Intronic
1121182827 14:91942358-91942380 CCTCCTGGAGGAGGTGGGAGAGG - Intronic
1121311853 14:92939591-92939613 CCTCCGTGGTGGGGCGGGGGCGG - Exonic
1122183915 14:99974924-99974946 CCTCCTTGATGGGCAGGGAGAGG + Intronic
1122209013 14:100162932-100162954 GCTCCTGGGAGGTGTGGGAGGGG - Intergenic
1122211515 14:100177020-100177042 CCTCCAGGGCGTGGTGGGAGGGG + Intergenic
1122722974 14:103732410-103732432 GCTCACAGGTGGGGTGGGAGAGG - Intronic
1122783523 14:104153645-104153667 CATCCTGGGAGGGGTGGGCGGGG + Intronic
1122875576 14:104662849-104662871 CCTCCTTTGTGGGCTGGGCGAGG + Intergenic
1123469676 15:20541003-20541025 ACTCCTCGGTGGAGTGGTTGGGG + Intronic
1123541865 15:21300011-21300033 GCTACTCGCAGGGGTGGGAGTGG + Intergenic
1123729954 15:23135989-23136011 ACTCCTCGGTGGAGTGGTTGGGG + Intronic
1123748124 15:23333471-23333493 ACTCCTCGGTGGAGTGGTTGGGG + Intergenic
1123762885 15:23446539-23446561 ACTCCTCTGTGGGGTGGTGGAGG + Intronic
1123940226 15:25213142-25213164 CCTCCTTGGTTGGCTGGGAGCGG + Intergenic
1123944389 15:25231967-25231989 CCTCCTTGGTTGGCTGGGAGTGG + Intergenic
1124231929 15:27953358-27953380 CCTTCACGGTGGGCAGGGAGGGG - Intronic
1124280488 15:28357323-28357345 ACTCCTCGGTGGAGTGGTTGGGG + Intergenic
1124302210 15:28554289-28554311 ACTCCTCGGTGGAGTGGTTGGGG - Intergenic
1124632327 15:31344872-31344894 CCGCCTGAGTGGGGAGGGAGGGG + Intronic
1125300841 15:38252514-38252536 CCTCCTCAGGGGGGTGGAGGGGG - Exonic
1127863019 15:63010242-63010264 CCTGCTTGGTGGGGTGGGGTAGG - Intergenic
1128054556 15:64690006-64690028 CTTCCTGGGTGGGGTGTGAATGG + Intronic
1131250744 15:90828407-90828429 GCTCCTGGGAGGGCTGGGAGTGG + Intergenic
1131263903 15:90904418-90904440 CCTCCAGCGGGGGGTGGGAGGGG - Intronic
1132232471 15:100194152-100194174 CCTTCTAGGTGGGGTGACAGTGG - Intronic
1132235813 15:100220313-100220335 CATCCTAAGTGGGGTGGCAGCGG + Intronic
1132630307 16:914158-914180 CCTCCTAGGAGGGGTCGGGGTGG - Intronic
1132655667 16:1040811-1040833 CCTCCTTGGTGTGGGGTGAGGGG - Intergenic
1132696055 16:1202461-1202483 CCTCCTCCGTGGGGTGGGGCTGG - Intronic
1132716568 16:1292986-1293008 CCTGCACGGTGGGCTGGGTGTGG + Intergenic
1132803711 16:1766254-1766276 CCTCCTCTGTGGACTGGGACGGG - Exonic
1132844162 16:1992356-1992378 CCTCCCGGGTGGGCGGGGAGGGG + Intronic
1132999191 16:2840669-2840691 GCTTCAGGGTGGGGTGGGAGGGG + Intergenic
1133028506 16:2998779-2998801 CCTCCTGGGTGGCGTCGGTGAGG + Intergenic
1133425198 16:5682284-5682306 CCTTTGTGGTGGGGTGGGAGTGG + Intergenic
1134279019 16:12801863-12801885 CCTCCTTTGAGGCGTGGGAGTGG - Intronic
1134770129 16:16801061-16801083 CCCCCTTGGTGGGGAGGGACAGG - Intergenic
1135136569 16:19889260-19889282 CCTTCTCGGTAGAGTGTGAGGGG + Intergenic
1135206904 16:20492160-20492182 GGCCCTCGGTGGGGTGGGCGGGG - Intergenic
1135211981 16:20531472-20531494 GGCCCTCGGTGGGGTGGGCGGGG + Intergenic
1135927493 16:26708366-26708388 CCTCCCCAATGGGGTGGGAGAGG - Intergenic
1136403629 16:30031140-30031162 CCCCCTCGGTGGGGAGGGGGAGG + Exonic
1137005767 16:35273338-35273360 CCTCCGCTGTGGGGAGGGTGAGG + Intergenic
1137401254 16:48156008-48156030 CCTCTCAGGTGTGGTGGGAGTGG - Intronic
1137586093 16:49664659-49664681 GCCCCTGGGTGGGGTGGGTGGGG + Intronic
1138489349 16:57367063-57367085 CCTCTGGGGTGGGGTGGGGGTGG - Intergenic
1139287417 16:65827931-65827953 GCTCCTTGGGGAGGTGGGAGAGG - Intergenic
1139369570 16:66458425-66458447 CCTCCAGGGTGGGAGGGGAGGGG - Intronic
1139650819 16:68361304-68361326 CCTCCTGGGGTGAGTGGGAGAGG + Exonic
1140135098 16:72198812-72198834 TCTCCTGGTTGGGGTGGGTGGGG - Intergenic
1141672208 16:85498035-85498057 ACACCTCAGTGGGGTGGGGGTGG + Intergenic
1141694217 16:85612226-85612248 CCGCCGCGATGGGGTGGGGGCGG + Intronic
1141856435 16:86684541-86684563 CCTCCCAGGTGGGCTAGGAGAGG - Intergenic
1142191996 16:88722384-88722406 CCTCCCCAGTGGGCTGGGCGCGG - Exonic
1142338943 16:89508347-89508369 CCTGCGCGGCGGGGTGGGCGGGG - Intronic
1142593590 17:1018869-1018891 CCTCATCTGTGAGATGGGAGCGG - Intronic
1142637210 17:1265312-1265334 GCTGCTCTGTGGGCTGGGAGTGG + Intergenic
1142647184 17:1322018-1322040 CCCCCTCGCTGATGTGGGAGAGG - Intergenic
1142757853 17:2026005-2026027 CCGCCTGGGTGGGGTGGCGGCGG + Intergenic
1142840657 17:2626556-2626578 CCGCCTCGGGGGGGGGGGGGGGG - Intronic
1142871912 17:2826624-2826646 CCTCTTGGCTGGGGTTGGAGGGG + Intronic
1143104863 17:4524331-4524353 CCGCATCTGTGAGGTGGGAGGGG + Intronic
1143518926 17:7434773-7434795 CTGCCTGGGTGGGGTGGGGGGGG - Intergenic
1143626045 17:8110597-8110619 GCTCCTCTCTGGGGTGGAAGTGG - Intronic
1144075218 17:11713051-11713073 TCTACTTGGTGGGGTGGGTGAGG - Intronic
1144737600 17:17563832-17563854 ACTCCTGGGTGAGGTGGGTGGGG - Intronic
1144763425 17:17720343-17720365 CCTCCTCGCTGGGATGGTAGGGG - Intronic
1144784735 17:17825308-17825330 CTTCCTCAGTGGGATGGGAGGGG - Intronic
1145286857 17:21512359-21512381 CTTCCCCGGTGGGGAGGGTGGGG - Intergenic
1145390757 17:22453981-22454003 CTTCCCCGGTGGGGAGGGTGGGG + Intergenic
1145844147 17:28023099-28023121 CCTGTTCGGTGTGGTTGGAGAGG + Intergenic
1145984956 17:29039547-29039569 CCTGTTCCGGGGGGTGGGAGTGG + Intronic
1146439016 17:32877221-32877243 GCTCCTCAGTGGGCCGGGAGGGG - Intergenic
1146654103 17:34625247-34625269 CTTCCTTGGTGGGTAGGGAGAGG + Intronic
1147238091 17:39072291-39072313 CCTGCTGGGTGGGGAGGCAGGGG - Intronic
1148560324 17:48602370-48602392 GCGCCTTGGTGGGGTGGGGGTGG + Intronic
1148912002 17:50947800-50947822 GCTCCTCTGTGGGGCTGGAGGGG + Intergenic
1150476546 17:65480067-65480089 GCTGCTTGGTGGGGTGGGTGGGG - Intergenic
1150493084 17:65587715-65587737 TCTCCAGGGTGGGGTGGGGGTGG + Intronic
1150557615 17:66268464-66268486 GCTTCTTAGTGGGGTGGGAGTGG - Intergenic
1151071054 17:71212057-71212079 CCTCCTCAGTGGGGAGTGGGAGG - Intergenic
1151188668 17:72382034-72382056 CCTCCTCGGTGAGGTGACAGTGG + Intergenic
1151421962 17:74004663-74004685 CCTGCTTGGGAGGGTGGGAGGGG + Intergenic
1151490487 17:74430076-74430098 CCGCCTGGGTCGGGAGGGAGTGG + Intronic
1151815725 17:76470509-76470531 CATCCTCAGTGTGGTGGGTGAGG + Intergenic
1152625350 17:81385623-81385645 CCTGCGCCCTGGGGTGGGAGTGG - Intergenic
1152690855 17:81717078-81717100 CCTCCTGCGTGGGGTGGGTGTGG + Intronic
1152940834 17:83172302-83172324 CCTCCTAGGTGGGGTGGGACGGG + Intergenic
1153815730 18:8788344-8788366 GCTCCTCAGGGGTGTGGGAGGGG + Intronic
1153988004 18:10369760-10369782 ACTCCTCTGTGGGTTAGGAGTGG - Intergenic
1154125542 18:11689451-11689473 CCTCAGCGGAGGGGCGGGAGGGG - Exonic
1155175485 18:23298042-23298064 CCTGCTCGGTGCGCTTGGAGAGG - Exonic
1155491404 18:26405152-26405174 CCTCCTTGGTAGGGTTGGTGGGG + Intergenic
1157413726 18:47485187-47485209 CTGCCTTGGTGGGGTGGGAGGGG - Intergenic
1157579395 18:48764659-48764681 CCTCCACTGTGGGGGAGGAGAGG - Intronic
1157591350 18:48837913-48837935 CCTCCCTGGTGGGAAGGGAGTGG + Intronic
1157894951 18:51457086-51457108 TCTCCTCTCTGGGGTGGGTGGGG - Intergenic
1158505944 18:58045402-58045424 CCTCCAGGGTGGGTGGGGAGAGG + Intronic
1158614827 18:58977364-58977386 CCACCTCACAGGGGTGGGAGTGG + Intronic
1160044185 18:75371492-75371514 CCTCATCTGTGGGATGGGAATGG + Intergenic
1160376140 18:78414195-78414217 GCTCCTGGGTGGCCTGGGAGAGG - Intergenic
1160859207 19:1230640-1230662 CCACGTCGGTGGGATGGGAATGG - Exonic
1160864904 19:1252216-1252238 GCTCCTCGGTGGGGGCGGAGGGG - Intronic
1161273819 19:3404593-3404615 CCTCCTGGGTGGGGTGGGGGTGG - Intronic
1161284701 19:3463302-3463324 CGTCCTCGGTGGGGGCTGAGGGG - Intronic
1161316493 19:3619844-3619866 CCTCCTGGGTGGAGTGTGGGAGG + Intronic
1161320232 19:3637680-3637702 CCCCCGTGGTCGGGTGGGAGAGG + Intronic
1161555269 19:4938147-4938169 CCGTCTCGGTGGGGTGGGGGAGG + Intronic
1161748610 19:6077412-6077434 CCTCTTGGGTGGGCTGGGGGAGG - Intronic
1162033527 19:7927306-7927328 CCTGCAGGGTGGGGTGGGAAGGG + Exonic
1162066530 19:8129148-8129170 CCACGTCTGTGGGGTGGGGGTGG + Exonic
1162131121 19:8526713-8526735 CCGGGTCGGTGGGGCGGGAGAGG + Intronic
1162328144 19:10010666-10010688 CCTCCACAGTGGGGTGGGGCAGG - Intergenic
1162918016 19:13884674-13884696 CCTGTTCTGTGGGGTGGGGGAGG - Intronic
1163630928 19:18417654-18417676 CCGGCTCGGCGGGGTAGGAGGGG - Intergenic
1163848604 19:19651147-19651169 CCTCCTCTGTGGTGTGGGGAAGG + Intronic
1164671733 19:30076357-30076379 GCTCCCCTGTGGGCTGGGAGGGG - Intergenic
1164711750 19:30361807-30361829 CCTCCAGGGTGGGGTGGGTGGGG + Intronic
1165146677 19:33735244-33735266 GCTCCTCCATGGGGAGGGAGGGG + Intronic
1165163394 19:33832097-33832119 CCCCCTTGGTGGGGGAGGAGAGG - Intergenic
1165253228 19:34557134-34557156 CCTCCGCTGTGGGGAGGGTGAGG + Intergenic
1165347632 19:35258852-35258874 CCTCCTGGGTGTGCTGGGAAGGG + Intronic
1165373866 19:35427736-35427758 CCTCGGTGGTGGTGTGGGAGGGG - Intergenic
1165743576 19:38217520-38217542 CCTCCTCGGCCAGGTGGGTGTGG + Exonic
1166550937 19:43665619-43665641 GCTCCTTGTTGGGGTGGGGGTGG - Intronic
1166698290 19:44866815-44866837 CCTCCTGGCTGTGTTGGGAGGGG + Intronic
1167155911 19:47738938-47738960 CTTCTTCGGTGGGGAGGGGGTGG + Intronic
1167465906 19:49651076-49651098 CCTCGTCGGTGGGGTGGAAGGGG - Exonic
1167636654 19:50659558-50659580 CTTCCAAGGGGGGGTGGGAGGGG - Intronic
1167660833 19:50794973-50794995 CCTCTGTGTTGGGGTGGGAGTGG + Intronic
1168695111 19:58399925-58399947 TCCCCTAGGTTGGGTGGGAGAGG - Intergenic
925983309 2:9194361-9194383 CCTGTTGGGTGGGGTGGGGGTGG - Intergenic
926111935 2:10189162-10189184 CCTCCTCGGCCAGGTGGGAAGGG - Intronic
927497687 2:23561802-23561824 TTTTCACGGTGGGGTGGGAGGGG + Intronic
927640270 2:24841420-24841442 CCTCCTCAGTGAGGGAGGAGTGG + Intronic
927811999 2:26185374-26185396 CTTCCTCGGCGGGGTGGGGAAGG + Intronic
928087627 2:28355840-28355862 CATCCTCAGTGGGCTGGGTGAGG - Intergenic
928823547 2:35391853-35391875 CCTCCTGGGTGGGAAGGGAGAGG - Intergenic
930027975 2:47041082-47041104 CCTCCTGACTGGGGTGGGGGTGG - Intronic
931223622 2:60310349-60310371 CCTCCTCCATGGGGCTGGAGAGG + Intergenic
932489976 2:72114322-72114344 CCTGCTCTGTTGGGTGGGGGTGG - Intergenic
933970819 2:87468607-87468629 CCTCCCCTGTTGGGTGGGTGGGG + Intergenic
934519444 2:95010683-95010705 CCTCCTCGAGGCGGAGGGAGTGG - Intergenic
934987579 2:98899110-98899132 CTGCCTTGGTGGGGTGGGAGGGG - Intronic
935251545 2:101266253-101266275 CCACCTGGGTGGGGTGGGGCAGG + Intronic
935274327 2:101463316-101463338 CCTCTTCCCTGGTGTGGGAGGGG + Intronic
935350946 2:102151525-102151547 CCTCCTCATGGGTGTGGGAGAGG + Intronic
935382344 2:102465434-102465456 CCTCTTGGGTCAGGTGGGAGTGG - Intergenic
935500305 2:103830918-103830940 CCACCTAGGAGGAGTGGGAGTGG + Intergenic
936322911 2:111481589-111481611 CCTCCCCTGTTGGGTGGGTGGGG - Intergenic
938117455 2:128611704-128611726 GCACCAGGGTGGGGTGGGAGTGG + Intergenic
938806859 2:134814199-134814221 CCTCTTTGGTGGGCAGGGAGAGG - Intergenic
942816338 2:180058232-180058254 CCTCCTGGGTGACGGGGGAGGGG + Intergenic
944011702 2:194981542-194981564 CCTCCTCCATGGGATGGGGGTGG + Intergenic
944586596 2:201178746-201178768 CCTGCGGGATGGGGTGGGAGGGG - Intergenic
945977543 2:216282475-216282497 CCTCCTCTCTGGGGTGGTGGTGG - Intronic
946137086 2:217656381-217656403 CCTGCTCTGTGGGCTGGGAGGGG - Intronic
946396880 2:219447818-219447840 GCTCCTCGTGGGGGTGGGGGTGG + Intronic
947707589 2:232289054-232289076 CCTGCTTGGTGGCGTGGGGGAGG + Intronic
948273037 2:236688413-236688435 CCTCCAAGGGAGGGTGGGAGGGG - Intergenic
948365719 2:237453210-237453232 CCTCAGGGATGGGGTGGGAGGGG + Intergenic
1170605677 20:17873789-17873811 CTTCCAGGGAGGGGTGGGAGTGG - Intergenic
1172649653 20:36493664-36493686 CCTCCTCGCTGGGCTGGGCTGGG - Intronic
1173888682 20:46485156-46485178 CCTCCTGGTGGGGGTTGGAGGGG - Intergenic
1174130514 20:48340701-48340723 CCTGCCTCGTGGGGTGGGAGGGG + Intergenic
1174418731 20:50385417-50385439 CCTCCTCGGAGGGTGGGGGGAGG - Intergenic
1174776452 20:53347187-53347209 ATTCTTCGTTGGGGTGGGAGGGG + Intronic
1175280009 20:57797097-57797119 TGTCATCTGTGGGGTGGGAGGGG - Intergenic
1175831701 20:61968123-61968145 CTTTGTCGATGGGGTGGGAGAGG - Intronic
1175909915 20:62400256-62400278 CCTGCACAGTGGGGTGGGTGGGG + Intronic
1178513989 21:33230503-33230525 CATCCTTGGTGGGGTGGGGTGGG - Intronic
1178840572 21:36135015-36135037 CCTCCTCGGAGGGGAGGGACCGG + Exonic
1179568023 21:42261212-42261234 CTGCCTGGGTGGGGCGGGAGAGG - Intronic
1179898458 21:44376637-44376659 CCTCATAGGTGGGATGGGATGGG + Intronic
1179947698 21:44689101-44689123 CCTCCTGGCTGGGGTGAGGGTGG - Intronic
1180928645 22:19573958-19573980 CCTCCTGGGTGCTGTGGGACTGG + Intergenic
1181055298 22:20258089-20258111 TCTCCTCTGTGGGGTGGGGATGG - Intronic
1181612962 22:24031263-24031285 CTGCCTCTGTGGGGTGGCAGGGG + Intronic
1183391038 22:37545891-37545913 CCTCCACGGAGGGGTGGGGCTGG - Intergenic
1183714192 22:39524154-39524176 CCTCCTAGGTGAGCTGGGCGTGG - Intergenic
1183723396 22:39575030-39575052 CCTGCAAGGTGGGGTGGGAAAGG + Intronic
1183981744 22:41544528-41544550 CCGCCTCGGCGGGGTGGGGGTGG - Intronic
1184038529 22:41929794-41929816 CCTCCTAAATGGGGTGGGGGTGG + Intergenic
1184160567 22:42694943-42694965 CCTCATCTGTAGGGTGGGGGTGG - Exonic
1184342023 22:43891366-43891388 CCTCCTAGGTGCAGTGGGAGCGG + Intronic
1185029143 22:48432452-48432474 CCTACTGGGTGGGGTGGGTGGGG + Intergenic
1185238286 22:49727109-49727131 CCTCCTTAGCGGGGTGGGGGTGG + Intergenic
1185280121 22:49966382-49966404 GCTCCTAGGCAGGGTGGGAGGGG - Intergenic
1185281386 22:49971523-49971545 CCTCGGCGCTGGGGAGGGAGGGG - Intergenic
1185398439 22:50604175-50604197 CCTCCTCGATGGAGTTGGTGAGG - Exonic
950347210 3:12307393-12307415 TCTCTTTGGTGGGTTGGGAGAGG - Intronic
950364445 3:12473159-12473181 CTTCCTGGGTGGGCTGGAAGAGG - Intergenic
950419891 3:12892591-12892613 GGTCCTGGGTGGGGTGGGGGGGG - Intergenic
950566080 3:13770474-13770496 CCTGCACGATGGGGTGGGGGTGG + Intergenic
950766716 3:15278255-15278277 CTTCCTCGGTTGGGTTGGAAAGG - Intronic
950880173 3:16316971-16316993 CCTGCTGTGTGGGGTGGGTGTGG - Exonic
953413342 3:42702187-42702209 CCTCATCAGTTGGGTGGGGGTGG + Intronic
953771500 3:45781383-45781405 CTTCCTTTCTGGGGTGGGAGGGG + Intronic
954673841 3:52304931-52304953 CCTCCTCTGAGAGGTGAGAGTGG - Intergenic
954693170 3:52406628-52406650 GCTCCTGGGTGGGCTGGGGGAGG - Intronic
959831981 3:110875141-110875163 CCTCCTCATTGGTGTGGAAGAGG - Intergenic
960179970 3:114564340-114564362 CATCTTCGGTGGGGTGGGGAGGG + Intronic
961202803 3:125057693-125057715 TCTCCTTGGAGGGGAGGGAGTGG - Intergenic
962429311 3:135304970-135304992 CCTCCTCAGTAGGTTGGTAGTGG - Intergenic
962878129 3:139551759-139551781 CCTCCTTGGAGGTGTGGGATAGG + Intergenic
963222698 3:142828488-142828510 TCTACTCGGTGTGGTGGGAGCGG + Intronic
965592046 3:170370440-170370462 CCTGCTCGGGGGGGGGGGGGGGG - Intronic
967223526 3:187269595-187269617 CTTCCTTGGAGGGGTGAGAGTGG - Intronic
967611763 3:191514791-191514813 ACTCCACAGTGGTGTGGGAGCGG + Intergenic
967893620 3:194380769-194380791 CCTCCACGGAGGGATGGGATGGG - Intergenic
967940405 3:194761956-194761978 CCACCTTGGTGAGGTGGGACAGG - Intergenic
968020024 3:195377433-195377455 CCTCCTCTGTAGGCTGGGCGTGG - Intronic
968697730 4:2041136-2041158 GCTGCTGGGTGGGGTGGGGGGGG + Intronic
968957799 4:3728058-3728080 CCCCCACGGTGGGGAGGGACTGG - Intergenic
969311286 4:6354220-6354242 CCTCCTCGGTGGGGTGGGAGAGG - Intronic
969455222 4:7296513-7296535 AGTCCTTGGTGGGGTGGGTGGGG - Intronic
972713207 4:41619410-41619432 CCTCCCCGCTGGGTGGGGAGAGG + Exonic
972739606 4:41877823-41877845 CCTGGTAGCTGGGGTGGGAGTGG - Intergenic
972765377 4:42149192-42149214 CATACTGGGTGGGGTGGGGGGGG - Intronic
976246492 4:83010850-83010872 CCTCCCGGGTGGGGCGGGCGGGG - Intronic
977536517 4:98261224-98261246 CATGCTCGGTGGGGAGGGCGGGG + Intergenic
982271078 4:153589098-153589120 CATCTACGGTGGGGTGAGAGGGG - Intronic
984490764 4:180431759-180431781 CCTCCTCTGTGGCGGGGGAACGG + Intergenic
984952961 4:185020058-185020080 TCTCCCGGGTGGGGTGGGTGGGG + Intronic
985636087 5:1036509-1036531 CGTCCTGGGTGGGGTGGGGTGGG - Intronic
988963677 5:36393845-36393867 CATACTTGGTGGGGTGGGGGTGG - Intergenic
990214390 5:53514242-53514264 CCTCTGTGGTGGAGTGGGAGTGG + Intergenic
992170801 5:74099930-74099952 TCTCTGTGGTGGGGTGGGAGTGG - Intergenic
993020521 5:82585257-82585279 CCACCTCCCTGGGGTGGGAGAGG + Intergenic
993223750 5:85137972-85137994 TTTCTTTGGTGGGGTGGGAGGGG - Intergenic
995781790 5:115784408-115784430 CTTCCTATGTGGGGTGGGATGGG + Intergenic
995975835 5:118034006-118034028 CCTCCTCGCTGGGGAGGGCTTGG + Intergenic
996004541 5:118404968-118404990 CCTCCTCGGTGGGGGGGGGTGGG + Intergenic
996017943 5:118561833-118561855 TCTCCAGGCTGGGGTGGGAGTGG - Intergenic
997346395 5:133195457-133195479 CCTCCTGGCTGGGGGTGGAGGGG + Intergenic
997653092 5:135536307-135536329 GCCCCTCGCTGGGGTGGGACGGG + Intergenic
998049861 5:139023319-139023341 CCTTCGGGGTGGGGTGGGACAGG + Intronic
999191053 5:149747791-149747813 CCTCCCTGGTGGGGTGGGGGTGG + Intronic
999713169 5:154336687-154336709 TTTCCTCAGTGGGGTGGGACTGG - Intronic
999758430 5:154682572-154682594 CTGCCTCTGTGGGATGGGAGGGG - Intergenic
1001167673 5:169385304-169385326 CTTGATCGGTGTGGTGGGAGTGG + Intergenic
1001502215 5:172246118-172246140 GTTCCATGGTGGGGTGGGAGAGG + Intronic
1002316969 5:178349767-178349789 CCTCCTTGCAGGGGTGAGAGTGG + Intronic
1002565375 5:180110201-180110223 ACAGCTCGCTGGGGTGGGAGCGG + Intronic
1002571270 5:180140593-180140615 CCTGCAGGGAGGGGTGGGAGTGG - Intronic
1003139277 6:3457142-3457164 CCACCTCGGCGGGGGGAGAGGGG - Intergenic
1005943236 6:30577028-30577050 CCTACTTGGTGGTGGGGGAGAGG - Intronic
1006260990 6:32870238-32870260 CCTCCCTGGTTGGTTGGGAGAGG - Intergenic
1006694465 6:35920186-35920208 CCTCCTCTGTGGAGTTGGGGAGG + Intronic
1006817463 6:36862170-36862192 CATCAACTGTGGGGTGGGAGGGG - Intronic
1007122772 6:39397021-39397043 CCGCCTCGGTGGGGAGGAAGGGG + Intronic
1007225580 6:40311518-40311540 GCCCCTCCCTGGGGTGGGAGGGG - Intergenic
1007401000 6:41602274-41602296 CCTCCACGGAGGGCTGGGAGGGG - Exonic
1008386493 6:50897352-50897374 CCTGCCCAGTGTGGTGGGAGGGG - Intergenic
1008882364 6:56394149-56394171 CCTCATAGGCGGAGTGGGAGGGG + Intergenic
1010402125 6:75457973-75457995 CCTTATTGGTGGGGTGGGTGAGG - Intronic
1012166363 6:95958112-95958134 CCTCATCTGTGAGGTGGTAGTGG - Intergenic
1012550947 6:100464546-100464568 GCTCCGCGGTGGTGTGGGAGAGG - Intronic
1014104829 6:117549823-117549845 CCTGCTCGCTGGGGTGTTAGAGG + Intronic
1015092854 6:129379632-129379654 CCACGCTGGTGGGGTGGGAGTGG - Intronic
1016709281 6:147151639-147151661 TCTTCTGGGTGTGGTGGGAGAGG - Intergenic
1018901521 6:168054133-168054155 CCTGCTGGGTGGGGTGTGGGAGG - Intergenic
1019178539 6:170173499-170173521 TCTCCTCTCTGGGGTGGCAGAGG - Intergenic
1019280998 7:200217-200239 CCACCTGGGGTGGGTGGGAGGGG - Intronic
1019306093 7:336342-336364 CGTCCTCCGTGGTGGGGGAGAGG - Intergenic
1019306104 7:336371-336393 CGTCCTCCGTGGTGGGGGAGAGG - Intergenic
1019306125 7:336428-336450 CGTCCTCCGTGGTGGGGGAGAGG - Intergenic
1019306258 7:336802-336824 CGTCCTCCGTGGTGGGGGAGAGG - Intergenic
1019306320 7:336975-336997 CGTCCTCCGTGGTGGGGGAGAGG - Intergenic
1019543455 7:1561475-1561497 CCTCCTGGGTGGGCGGGGTGAGG + Intergenic
1020106002 7:5422634-5422656 CCTGCTCGGGGGGCTGGGCGCGG - Intronic
1020418117 7:7969156-7969178 CCGCCTCGGCGAGGGGGGAGGGG - Exonic
1023985172 7:45089705-45089727 CCTCCTGGGAGGTGTGGCAGAGG - Intergenic
1024634437 7:51275706-51275728 CCTCCTGGGTGGGCTGCGTGCGG - Intronic
1025208997 7:57009902-57009924 CCTCCTGGGTGGGGAGGGGCCGG - Intergenic
1025662952 7:63566954-63566976 CCTCCTGGGTGGGGAGGGGCCGG + Intergenic
1026281302 7:68924404-68924426 CCTCCGTTGTGGGGTGGGGGGGG - Intergenic
1026936571 7:74259990-74260012 CAGCCTCGGAGGGGTGGGAGTGG + Intergenic
1027288133 7:76671850-76671872 TTTTCCCGGTGGGGTGGGAGGGG + Intergenic
1028406011 7:90474727-90474749 CCACCTCTGTGGTGTGGGTGAGG - Intronic
1029746255 7:102517283-102517305 CCCCCGGGGTGGGGTTGGAGGGG - Intronic
1029764193 7:102616262-102616284 CCCCCGGGGTGGGGTTGGAGGGG - Intronic
1029971928 7:104798005-104798027 AGTCCTAGGTGGGGTGGCAGTGG + Intronic
1030371820 7:108708843-108708865 ACTCCTGGGCGGGGAGGGAGAGG - Intergenic
1031983860 7:128149715-128149737 TGTCCTGGGTGGGGTGGGAATGG + Intergenic
1032098738 7:128955153-128955175 CCTGCCCGGCGTGGTGGGAGGGG - Exonic
1032193053 7:129775314-129775336 CCTCCAGGCTGGGGAGGGAGTGG + Intergenic
1032448272 7:132003400-132003422 CCTCCTCTGTGGGGTGGAGTGGG + Intergenic
1032804875 7:135343468-135343490 CCTCTTCCCTGGGGTGGGGGTGG - Intergenic
1033042165 7:137928568-137928590 CCTCCTCCGTGGGTTGGGCTGGG + Intronic
1033051949 7:138013332-138013354 CCTCCTCGCTGCGGTGGGAAGGG - Intronic
1033742363 7:144284768-144284790 CCTCCTCTGTGGGGGAGGAGGGG + Intergenic
1033751539 7:144364846-144364868 CCTCCTCTGTGGGGGAGGAGGGG - Exonic
1035045064 7:155960166-155960188 CCTCCGGGGTGGGTTTGGAGCGG + Intergenic
1035387016 7:158479870-158479892 CATCCTCGCTGCTGTGGGAGCGG + Intronic
1035476731 7:159149226-159149248 CCACCTGCCTGGGGTGGGAGGGG - Intergenic
1035645297 8:1214241-1214263 CCACCTGGGTTGGTTGGGAGAGG - Intergenic
1036177953 8:6557023-6557045 CCACCTAGGAGGGGTGGGCGGGG + Intronic
1036701414 8:11016120-11016142 CCCCCACGGTGGGATGCGAGGGG - Intronic
1037118532 8:15254943-15254965 CCTTCTCATTGGGGTGGGAAAGG + Intergenic
1037768638 8:21786611-21786633 GCTTCTCTCTGGGGTGGGAGGGG - Intronic
1039375074 8:37024825-37024847 CCACCTAGGTGGGTTAGGAGTGG - Intergenic
1041254208 8:55965357-55965379 TCTCCTGGGTGGGGGAGGAGTGG + Intronic
1043855760 8:85262914-85262936 CAGGCTTGGTGGGGTGGGAGAGG + Intronic
1045583269 8:103500970-103500992 CCTCCTCCGTGAGGTGGCTGAGG - Intronic
1046395479 8:113633661-113633683 CACCCTCAGTGGGGTGGGTGTGG + Intergenic
1048299181 8:133238955-133238977 CCCCCTCGCTGGTGTGCGAGCGG + Exonic
1048368314 8:133757432-133757454 CCTCCTAGGTGGGATGGCGGTGG - Intergenic
1048492962 8:134911779-134911801 TTTCCTGGTTGGGGTGGGAGTGG + Intergenic
1048827109 8:138438917-138438939 CCTTGTGGGTGGGGTGGAAGAGG + Intronic
1049343073 8:142124188-142124210 CTTCGTCGGTGGGGTGTGTGGGG - Intergenic
1049677759 8:143900066-143900088 CATCTTCGGGTGGGTGGGAGGGG - Intergenic
1049695807 8:143983806-143983828 CCTCCTCTGGGGGCAGGGAGAGG + Exonic
1049776590 8:144408798-144408820 CCTTCCCGGTGGGGTAGGAAGGG + Intronic
1049795182 8:144493877-144493899 CGTGCTGGGTGGGGTGGGGGAGG + Intronic
1052865913 9:33464535-33464557 CCTCTTGGTGGGGGTGGGAGTGG - Intronic
1055315354 9:75028574-75028596 GCTCGTAGGTGGGGTGGGACTGG + Intergenic
1056472686 9:86921164-86921186 CCTCCTGGGTAGGGTGGTGGGGG - Intergenic
1056756304 9:89384098-89384120 CCTACTCGGTGGGCTCAGAGAGG + Intronic
1057294671 9:93828134-93828156 CCTCCCCAGGAGGGTGGGAGCGG - Intergenic
1060050638 9:120375994-120376016 TCTCCTAGGTGGGCTGGGAGTGG - Intergenic
1060845927 9:126837538-126837560 CCTCCTGGGTGGGCGTGGAGAGG + Exonic
1061251143 9:129427271-129427293 TCTCCTCAGGTGGGTGGGAGTGG + Intergenic
1061281098 9:129597932-129597954 CCTCTCCGGTGGGATGGGTGGGG - Intergenic
1061363349 9:130157483-130157505 CCTAGTAGGTGGGGCGGGAGGGG - Intergenic
1061662801 9:132141505-132141527 CTACCTGGCTGGGGTGGGAGGGG - Intergenic
1062011039 9:134267023-134267045 CCCCCTCTGTGGGGTGGGAATGG + Intergenic
1062122189 9:134839720-134839742 CCTCGCCGGTGGGGAGGGTGAGG + Intronic
1062399718 9:136367095-136367117 CCTGCTCGGTGGGCTGGGCTGGG - Intronic
1186670240 X:11759336-11759358 CCTCCTCGGGGCGGAGGGGGGGG + Intronic
1186819941 X:13277408-13277430 TATCCTTGGTGGTGTGGGAGTGG + Intergenic
1187362545 X:18641921-18641943 CCATCTCGGTGGTGTGTGAGGGG + Exonic
1188619387 X:32201471-32201493 CCTCCTTGTTGGGGGGGGGGGGG - Intronic
1189262751 X:39689584-39689606 GCCCCTCGGTGGGGGTGGAGGGG + Intergenic
1189307468 X:39997641-39997663 CTTCCACGGAGGGGTTGGAGTGG - Intergenic
1190759986 X:53431159-53431181 GCTCCAGGGTGGGGTGGGAAAGG - Intergenic
1193131043 X:77920154-77920176 ACTACTGGGTGGGGAGGGAGTGG - Intronic
1195113433 X:101670086-101670108 CCTCTGCTGTGGGGTGGGGGTGG + Intergenic
1196106223 X:111898865-111898887 TCTCCTTGGTGGGGGAGGAGTGG - Intronic
1196324605 X:114388723-114388745 CCTGCCTGGTGTGGTGGGAGGGG - Intergenic
1201062085 Y:10055203-10055225 CCTGCTGGGTGGTGTGGGACTGG + Intergenic
1201862329 Y:18612705-18612727 CCTGCTGGGTGGTGTGGGGGTGG - Intergenic
1201870994 Y:18707675-18707697 CCTGCTGGGTGGTGTGGGGGTGG + Intergenic