ID: 969315465

View in Genome Browser
Species Human (GRCh38)
Location 4:6379008-6379030
Sequence CCTTGGCGTCAGGCAGGCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 572
Summary {0: 1, 1: 0, 2: 16, 3: 83, 4: 472}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969315465_969315477 25 Left 969315465 4:6379008-6379030 CCGAGGCCTGCCTGACGCCAAGG 0: 1
1: 0
2: 16
3: 83
4: 472
Right 969315477 4:6379056-6379078 CTTGGGCCCTGACTTGCTCCTGG No data
969315465_969315472 7 Left 969315465 4:6379008-6379030 CCGAGGCCTGCCTGACGCCAAGG 0: 1
1: 0
2: 16
3: 83
4: 472
Right 969315472 4:6379038-6379060 CTCTGGCCACCCTCGTGTCTTGG 0: 1
1: 0
2: 2
3: 22
4: 257
969315465_969315473 8 Left 969315465 4:6379008-6379030 CCGAGGCCTGCCTGACGCCAAGG 0: 1
1: 0
2: 16
3: 83
4: 472
Right 969315473 4:6379039-6379061 TCTGGCCACCCTCGTGTCTTGGG 0: 1
1: 0
2: 2
3: 4
4: 106
969315465_969315470 -10 Left 969315465 4:6379008-6379030 CCGAGGCCTGCCTGACGCCAAGG 0: 1
1: 0
2: 16
3: 83
4: 472
Right 969315470 4:6379021-6379043 GACGCCAAGGCTTGAGGCTCTGG 0: 1
1: 0
2: 1
3: 10
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969315465 Original CRISPR CCTTGGCGTCAGGCAGGCCT CGG (reversed) Intronic
900356357 1:2266665-2266687 CCTTGGCTGCAGGCGGGCCCTGG + Intronic
900589088 1:3451792-3451814 CTTTGGCGTCAGACAGACCTGGG + Intergenic
900617345 1:3571387-3571409 CCTTTGGGGCAGGCTGGCCTTGG - Intronic
900876086 1:5343555-5343577 CTTTGGCATCAGGCAGCCTTGGG + Intergenic
900876151 1:5343851-5343873 CCTGGGTGTTAGGGAGGCCTTGG + Intergenic
900990190 1:6095149-6095171 CCTGGGAGCCAGGCAGGCCCTGG - Intronic
901008382 1:6183049-6183071 AAATGGCCTCAGGCAGGCCTTGG - Intronic
901024922 1:6274101-6274123 CCTGGGGGTCAGGCAGGTCCTGG + Intronic
901804468 1:11729446-11729468 TTTTGGAGTCAGGCAGACCTGGG - Intergenic
901844626 1:11974150-11974172 CCTTGGAGTCAGGCAGCCCTGGG - Intronic
902220274 1:14960175-14960197 CTGTGGAGTCAGCCAGGCCTTGG + Intronic
902441481 1:16433010-16433032 CATGGGAGTCAGACAGGCCTGGG - Intronic
902503327 1:16924576-16924598 CCCTGGAGTCAGGTTGGCCTGGG + Intronic
902530096 1:17085422-17085444 CCTGGGGGTCAGGCTGCCCTGGG + Intronic
902699407 1:18161388-18161410 TGTTGGAATCAGGCAGGCCTGGG - Intronic
902742051 1:18445656-18445678 CCCTGGAGTCAGGGAGGTCTGGG - Intergenic
902748549 1:18490183-18490205 ATTTGGAGTCAGGCAGACCTGGG - Intergenic
902820039 1:18938113-18938135 CTTTGACGTCAGGCAGAGCTGGG + Intronic
902839380 1:19065599-19065621 CTTTGGTGTCAGACAGTCCTGGG - Intergenic
903185958 1:21629195-21629217 CCTGGGGGTCAGGAAGTCCTGGG + Intronic
903461995 1:23526718-23526740 CTTTGCAGTCAGACAGGCCTGGG - Intronic
903590540 1:24452611-24452633 CTTTGGAGTCAGGGAGACCTGGG - Intronic
903593368 1:24474491-24474513 TTTTGGAGTCAGGCAGTCCTGGG - Intergenic
903670581 1:25033244-25033266 ACGTGGAGCCAGGCAGGCCTGGG - Intergenic
904327388 1:29736154-29736176 CCTTGGCTTCAGGCAGAGCTGGG - Intergenic
904330480 1:29755155-29755177 AGCTGGCATCAGGCAGGCCTGGG + Intergenic
904416199 1:30362439-30362461 AGCTGGCATCAGGCAGGCCTGGG - Intergenic
904455613 1:30646409-30646431 CCTTGGAGTCAGACAGACCCAGG - Intergenic
904615801 1:31748959-31748981 CTCTGGAGTCAGGCAGGCCTGGG - Intronic
904679318 1:32217859-32217881 CTTTGGAGTCAGGCAAGCCTTGG - Intronic
904703846 1:32375857-32375879 GCTTGGAGTCAGACAGCCCTGGG + Intronic
905269071 1:36774868-36774890 CTTTGGAGTCAGACAGACCTGGG + Intergenic
905512856 1:38536528-38536550 CTTTGGAGTCAGGCAAACCTAGG - Intergenic
905879415 1:41453951-41453973 GCCTGGAGTCAGGCAGGCCTGGG + Intergenic
906258775 1:44370292-44370314 CCTTGGAGTCAGACAGTCCTGGG + Intergenic
906733481 1:48102910-48102932 CTTTGGAGTCAGGCAAACCTGGG + Intergenic
907246867 1:53114324-53114346 CCTTGGAGTCAGACAGGACTAGG + Intronic
907746277 1:57216844-57216866 ACTTGACGTAAGGCAGGACTGGG + Intronic
907758489 1:57334292-57334314 CCTTGGGGTCAGGCTGCCCTGGG + Intronic
907792409 1:57680005-57680027 CCTTGGAGTCAGGAAGAACTGGG - Intronic
907840252 1:58150207-58150229 CCTTGGGGCCAGGCATACCTGGG - Intronic
908049563 1:60213579-60213601 CCTTGGAGTCAGGCAGACCTAGG + Intergenic
909674376 1:78222968-78222990 CATTGGAGTTAGGCAGACCTGGG + Intergenic
910089756 1:83448430-83448452 CTTTGGGGTCAGGCAGGTCTGGG + Intergenic
911084379 1:93964434-93964456 CTTTGGCATCAGTCAGACCTGGG - Intergenic
912158956 1:106957418-106957440 CCTTGGAGATAGGCAGGCATGGG - Intergenic
912569758 1:110612884-110612906 ACTTGAAGTCAGACAGGCCTGGG + Intronic
913083458 1:115411985-115412007 CTTTGGAGTCAAGCAGACCTTGG + Intergenic
915033516 1:152903890-152903912 CTTTGCTGTCAGACAGGCCTGGG - Intergenic
915728440 1:158035664-158035686 ATTTGGGGTCAGACAGGCCTGGG - Intronic
915945197 1:160144986-160145008 CCCTGGAGTCAGACTGGCCTAGG - Intergenic
917655466 1:177121404-177121426 CCTTGACATCAGACAGACCTGGG + Intronic
918109906 1:181446326-181446348 CCTTGGCACCAAGCAAGCCTGGG - Intronic
918444106 1:184599008-184599030 CTTTGGAGTCAGACAGACCTGGG - Intronic
920136235 1:203771456-203771478 CCTTGGCGACAGGAAGACCTGGG + Exonic
920439505 1:205969930-205969952 GCTTGGAGTCAGGCAGGCCTGGG - Intergenic
920554557 1:206895229-206895251 CTTTGGAGGCAGGCAGACCTGGG - Intergenic
920740917 1:208580469-208580491 CTTTGGAGTCAAACAGGCCTGGG + Intergenic
920930434 1:210382905-210382927 CCTTGGCTTCAGACAGGCCTAGG + Intronic
922344173 1:224682352-224682374 CTTTGGAGACAGGCAAGCCTGGG - Intronic
1063842490 10:10088354-10088376 CCATGGCGGCAGGCAGGCCTGGG - Intergenic
1064155625 10:12901040-12901062 CCCTGGTGTCAGCCAGTCCTTGG - Intronic
1064225083 10:13475810-13475832 CTTTGGAGTCAGACAGGCCTTGG + Intronic
1064424874 10:15221825-15221847 CCTTGAGGTCAGGCAGCCCCAGG - Intronic
1065983841 10:30930206-30930228 CCTTCCCGCCAGGCAGGGCTCGG - Intronic
1066054809 10:31670877-31670899 GCTTGGCTTCTGGGAGGCCTTGG - Intergenic
1067434022 10:46264793-46264815 CCTTGAAGTGAGGCAGGCCTGGG - Intergenic
1067439671 10:46301527-46301549 CCTTGGAGTGAGGTGGGCCTCGG + Intronic
1067441235 10:46310210-46310232 CCTAGGGGTCAGCCAGGCCAGGG - Intronic
1067692567 10:48511356-48511378 CCTTGGGGTCAGGCCACCCTGGG - Intronic
1067954361 10:50776112-50776134 CTTAGAAGTCAGGCAGGCCTGGG - Intronic
1068860517 10:61843050-61843072 CTTTGGCAACAAGCAGGCCTGGG - Intergenic
1069846031 10:71372365-71372387 TCTTGGAGTCAGGCAGACCTGGG - Intergenic
1070461304 10:76673197-76673219 CTTTGGAGTCAGGCAGACCTGGG + Intergenic
1070652569 10:78248422-78248444 ACTTGGACTCAGGCAGACCTCGG - Intergenic
1070779481 10:79129381-79129403 CAGTGGACTCAGGCAGGCCTTGG - Intronic
1071366946 10:84909191-84909213 CTCTGGCGTCAGACAGCCCTGGG - Intergenic
1072173085 10:92886598-92886620 CTTTGGAGTCAGGTAGACCTGGG + Intronic
1072425202 10:95324234-95324256 CCCTGGAGTCAGGCAGGACAGGG + Intronic
1072705859 10:97680455-97680477 CCTTAGCATCAGAGAGGCCTGGG - Intronic
1072808673 10:98443484-98443506 CCTTGGCATCAAACAGGTCTGGG - Intronic
1073079392 10:100849017-100849039 CTTTAGGGTCAGGCAGACCTGGG - Intergenic
1074118925 10:110478824-110478846 GTTTGGGGTCAGGCAAGCCTAGG + Intergenic
1075223332 10:120603000-120603022 CCCTGGCCCCAGGCAGCCCTAGG + Intergenic
1075516877 10:123116505-123116527 CCTTGTAGTCAGGCTGACCTGGG + Intergenic
1075635539 10:124027830-124027852 CTTTGGGGTCAGGCAGGCCTGGG - Intronic
1075710134 10:124526456-124526478 CCTTGGAGTCAGGCAGAGGTGGG - Intronic
1075875549 10:125803106-125803128 CTTTGGAGTCAGCCAGTCCTAGG + Intronic
1076875000 10:133211470-133211492 CCTCTGCGTCCTGCAGGCCTGGG + Exonic
1077158967 11:1104019-1104041 TCGTGGCCACAGGCAGGCCTGGG - Intergenic
1077221591 11:1420426-1420448 CCCTGGAGACAGGCAGGCCCAGG + Intronic
1077535578 11:3122487-3122509 CCTTGGCATCAGGCCAACCTGGG - Intronic
1077872912 11:6278625-6278647 CTTTGGGATCAGGCAGACCTGGG - Intergenic
1077970760 11:7187623-7187645 CCTTGGCCACTGACAGGCCTTGG + Intergenic
1079131696 11:17750459-17750481 GCTTGGTGACAGCCAGGCCTCGG - Intronic
1079314461 11:19395975-19395997 AGTTGGCCTCAGGCAGGACTTGG + Intronic
1079341258 11:19613406-19613428 CCACTGCATCAGGCAGGCCTTGG + Intronic
1079940392 11:26673033-26673055 CTTTAGCGTCAGACAGTCCTGGG - Intronic
1080418110 11:32088575-32088597 CTTTGGCCACAGGCTGGCCTGGG - Intronic
1080847178 11:36036619-36036641 CTCTGGTGTCAGGCAGCCCTGGG - Intronic
1081619913 11:44613321-44613343 CCTCGGCGATAAGCAGGCCTGGG - Intronic
1081737337 11:45413129-45413151 CCTTGGAGTCACACAGACCTGGG + Intergenic
1083177708 11:60961969-60961991 CCTTGGCGCCAGGCTGGGCACGG + Intergenic
1083413320 11:62508699-62508721 CCGTGGCGTCAGGCAGCCGCTGG - Intronic
1083610327 11:64001190-64001212 GCGCGGCCTCAGGCAGGCCTGGG + Intronic
1083814493 11:65124966-65124988 GCTTGGAGTCAGGCAGTTCTGGG + Intronic
1083897584 11:65627826-65627848 TCGTGGGGTCAGACAGGCCTGGG - Intronic
1084424194 11:69075711-69075733 CCTGGGCGTCAGCCTGGCCGTGG + Intronic
1084563745 11:69918349-69918371 CCTTGGTGCCAGGTAGGCCGTGG + Intergenic
1084771403 11:71344884-71344906 CCTATGCGTGGGGCAGGCCTGGG - Intergenic
1084961538 11:72719412-72719434 GCTTGGAGCCAGGCAGACCTGGG + Intronic
1085101016 11:73799970-73799992 CTTTGGATTCAGGCAGACCTGGG + Intronic
1085191676 11:74631259-74631281 CTTTGGAGTCAGGCAGACCTGGG + Intronic
1085442991 11:76580048-76580070 ACTTGGCGTCATGCTGGCATTGG + Intergenic
1085551089 11:77372927-77372949 CCTTGGCATCTGGCAAGTCTTGG - Intronic
1085764751 11:79273054-79273076 CTTTGGAGTCAGTCAGGCCTTGG + Intronic
1086372654 11:86170644-86170666 ATTTGGTGTCAGGCAGTCCTAGG - Intergenic
1087014189 11:93540397-93540419 CTTGGGAGTCTGGCAGGCCTGGG - Intronic
1087137709 11:94737604-94737626 CCTTGGGATCAGCCAGACCTGGG - Intronic
1087822082 11:102723846-102723868 CTTTGGAATCAGACAGGCCTGGG + Intronic
1088748209 11:112822314-112822336 CTTTGGAGTCAGGCAGACCAGGG + Intergenic
1089009900 11:115123732-115123754 CTTTGGAGTCAGGCAGGCCTGGG - Intergenic
1089090771 11:115872996-115873018 CCTTGGAGTGAGGCAGGCTTTGG + Intergenic
1089271299 11:117303247-117303269 CCCTGGGGTCAGGCAGACCCAGG + Intronic
1090240399 11:125177440-125177462 CTTTGGGGTCAGGCAGGCAGGGG + Intronic
1090250157 11:125245442-125245464 CTTTGGCGTCATGCAGACCCAGG - Intronic
1090709008 11:129369303-129369325 CCTTGGCCTCAAGCAGTCCTTGG - Intergenic
1091390257 12:121949-121971 CTTTGGTGTCAGGGAGACCTGGG - Intronic
1093727640 12:22533221-22533243 CTTTGGAGTCAGGCAGTCTTCGG + Intronic
1094080353 12:26528017-26528039 TCTTGGGGTCAGGCAGAACTTGG - Intronic
1096052984 12:48627637-48627659 CCTTAGAGTCAGGCAAACCTGGG + Intergenic
1096094600 12:48925869-48925891 CGTTGGACTCAGGCAGTCCTGGG - Intronic
1096473716 12:51895513-51895535 CTTTGGAGTCAGACAGACCTGGG + Intergenic
1099303184 12:80922918-80922940 CCTTGGCTTCAGGCAGCCCCCGG + Intronic
1100578310 12:95913839-95913861 CTTTGGAATCAGACAGGCCTTGG + Intronic
1100784088 12:98060837-98060859 CCTTGGAGGCAGACTGGCCTAGG - Intergenic
1101654706 12:106709683-106709705 CTTTGGTGTCAGACAGACCTGGG - Intronic
1101744746 12:107531013-107531035 CCTTAGAGTCAGACAGACCTAGG + Intronic
1101759224 12:107645481-107645503 TCTGGGAGTCAGCCAGGCCTGGG - Intronic
1102043637 12:109816289-109816311 CTTTGGAGTCATTCAGGCCTGGG + Intronic
1102226813 12:111234638-111234660 TCTTGGCATCAGGCAGACCTGGG + Intronic
1102359233 12:112269354-112269376 CTTTGGCAACAGGCAGACCTGGG - Intronic
1102484761 12:113248169-113248191 CCGTGGGGCCTGGCAGGCCTCGG - Intronic
1102756991 12:115349572-115349594 GTTTGGAGTCAGGCAGGCCTGGG - Intergenic
1102952509 12:117040129-117040151 CCCAGGCGACAGGGAGGCCTTGG + Intronic
1103448859 12:121013804-121013826 CTTGGGAGTCAGGTAGGCCTGGG + Intronic
1106407569 13:29487298-29487320 CTTTGGAGTCAGACAGACCTGGG + Intronic
1107561177 13:41558913-41558935 CCTGGGCTCCAGGCAGGCCTGGG + Intergenic
1107836139 13:44413803-44413825 CCTTGGCGCAGGGCAGGCCTCGG + Intergenic
1108751513 13:53452526-53452548 CCTTCCCGCCAGGCAGGGCTCGG - Intergenic
1110927471 13:81173072-81173094 CTTTGGAGTCAGAGAGGCCTGGG + Intergenic
1111213221 13:85108424-85108446 CCTGGGCCTCAGTCAGCCCTGGG + Intergenic
1111997856 13:95182774-95182796 CCTTGGGGTCAGACAGCTCTGGG - Intronic
1112335727 13:98513912-98513934 CCTTGGCTTCAGGCATACTTAGG - Intronic
1112734296 13:102400226-102400248 CCAGGGCGTCAGGGAGGCCGTGG + Intronic
1113769566 13:112899382-112899404 CCTTGTGGTCAGGCCGGTCTTGG + Intronic
1114655920 14:24315575-24315597 CCATGGCGTCAGGAAACCCTTGG + Intronic
1115786659 14:36834350-36834372 CTTTGGAGTCAGACAGACCTGGG + Intronic
1116390549 14:44384971-44384993 CCTTCCCGTGAGGCAGGGCTTGG + Intergenic
1118492742 14:66277466-66277488 CTATGGATTCAGGCAGGCCTGGG + Intergenic
1119167335 14:72505656-72505678 CTTTGGAGACAGGCAGTCCTGGG + Intronic
1119522775 14:75298309-75298331 CTTTGGGGTCAGGCAGGTCTGGG + Intergenic
1120406320 14:84097722-84097744 CCTTGGCCTCAGGAAGTGCTGGG - Intergenic
1120473804 14:84961246-84961268 TCTAGGAGTCAGGAAGGCCTGGG - Intergenic
1120692112 14:87604228-87604250 CCTTGGAGTCAGACAGTCCAGGG + Intergenic
1121020197 14:90575368-90575390 CCCTGGAGCCAGGCTGGCCTGGG - Intronic
1121046997 14:90795528-90795550 CTTTGGCCTCTGGCAGCCCTGGG + Intronic
1121737542 14:96228859-96228881 ACTTGGCCTCAGGCAGACCCAGG + Intronic
1122379264 14:101289876-101289898 CCTTGTCATCAGGCTGCCCTTGG + Intergenic
1122772071 14:104101967-104101989 CCCTGGCCTCTAGCAGGCCTGGG + Intronic
1122978022 14:105178970-105178992 GCTGGGTGTCAGGCAGGCCTGGG - Intronic
1123626435 15:22229944-22229966 CTTTGGAATCAGACAGGCCTGGG - Intergenic
1123812778 15:23945686-23945708 CCTTGCTGTCAGGTAGGCCCTGG + Intergenic
1124353509 15:28977932-28977954 CTGTGGACTCAGGCAGGCCTCGG + Intronic
1124635047 15:31360011-31360033 CCTTGGCATCAGGCAGACCTAGG + Intronic
1126572630 15:50168551-50168573 CTTTGGTGTCAGGCAGGAATGGG - Intronic
1128325345 15:66720492-66720514 GCATGGAGTCAGGCAGGCCCGGG - Intronic
1128327088 15:66730867-66730889 CTCTGGAGGCAGGCAGGCCTGGG - Intronic
1128369604 15:67030852-67030874 TCTTGGAATCAGGCAGGCCTGGG - Intergenic
1128499878 15:68220548-68220570 CCTTGGCTGTAGGCAGTCCTGGG - Intronic
1129671408 15:77609882-77609904 CTTTGGAGTCAGGCTGACCTTGG - Intergenic
1130024248 15:80257586-80257608 ACTTGGAGTCAGACAGGTCTGGG + Intergenic
1130558994 15:84944300-84944322 GTTTGGAGTCAGGCAGACCTGGG - Intronic
1130563142 15:84974372-84974394 CTTTGGTGTCAGGCAGGCCACGG + Intergenic
1130575569 15:85090162-85090184 CTTTGGTGTCAGACGGGCCTGGG + Intronic
1131035618 15:89220136-89220158 ACTTGGTGTCAGGCAGGCATAGG - Intronic
1131397615 15:92098963-92098985 CTTTGAGGTCAGACAGGCCTGGG - Intronic
1131433261 15:92403250-92403272 CCATGGAGTCAGGCAAACCTGGG - Intronic
1132460464 16:51348-51370 CCTTGGAGTCATACAGGCCCGGG - Intronic
1132877441 16:2146647-2146669 TCTTGGCTTCCAGCAGGCCTCGG - Intronic
1133738030 16:8630446-8630468 CTGTGGCGTCAGACAGACCTAGG - Intronic
1135325092 16:21520812-21520834 CCTTGGCCTCAGGCCAGCCCTGG - Intergenic
1135924513 16:26680856-26680878 CCTCAGCTTCAGGCAGGCCCAGG + Intergenic
1135931917 16:26745586-26745608 ATTTTGAGTCAGGCAGGCCTGGG - Intergenic
1136097340 16:27966636-27966658 CCGTGGCATCAGGGAGGCCTGGG - Intronic
1136170775 16:28487852-28487874 CTCTGGAGTCAGGCACGCCTGGG + Intronic
1136336575 16:29614080-29614102 CCTTGGCCTCAGGCCAGCCCTGG - Intergenic
1136374083 16:29854830-29854852 CATGGGAGTCAGGCAGGCCAAGG + Intergenic
1137347088 16:47673939-47673961 CACTGGAGTCAGGCAGACCTGGG - Intronic
1137404233 16:48177212-48177234 CCTTGGCGCAAGGCAGGCTGGGG - Intronic
1137555494 16:49467865-49467887 CTTTGGGGTCAGGCAGACGTGGG + Intergenic
1137670525 16:50275764-50275786 CCTTGGAGAGGGGCAGGCCTGGG + Intronic
1138186406 16:54981113-54981135 CTTTGGGGTCAGGCCAGCCTGGG + Intergenic
1138342452 16:56299158-56299180 CTTTGGAGTTAGGCAAGCCTGGG - Intronic
1138599966 16:58048272-58048294 GTTAGGCCTCAGGCAGGCCTGGG - Intergenic
1138693902 16:58793342-58793364 GCTTGGAATCAGGCAGACCTGGG + Intergenic
1139631497 16:68234493-68234515 TCTGGGCCTCAGGCAGGCCTGGG - Intronic
1141865192 16:86745433-86745455 CCTGGGCTGCAGGCAGTCCTTGG + Intergenic
1141977541 16:87527440-87527462 CTTTGGAATCAGACAGGCCTGGG + Intergenic
1142037301 16:87869864-87869886 CCTTGGCCTCAGGCCAGCCCTGG - Intergenic
1142744001 17:1946092-1946114 CCTGGGCCTCTGGCTGGCCTGGG - Intronic
1142772298 17:2107230-2107252 CCTTTGGGTCAGGCAGGGCAGGG + Intronic
1143613453 17:8034663-8034685 CCTTGGTGTGAGGCAGGGATGGG + Intergenic
1143869148 17:9945458-9945480 CTTTGGCATCAGACAGACCTGGG - Intronic
1144707791 17:17380864-17380886 CCTGGGCGTCAGGCAGGACAGGG + Intergenic
1144802784 17:17942314-17942336 CCTTGGGGTCAGGCAGACCTGGG + Intronic
1146401079 17:32500509-32500531 GCTGGGAGTCAGGCAGGCCAGGG - Intronic
1146633740 17:34488973-34488995 CCTTGGAGTCAGCTAGTCCTAGG - Intergenic
1147567174 17:41544874-41544896 CCTTGGAGCCAGGGTGGCCTGGG + Intergenic
1147632278 17:41939816-41939838 CTGTGGAGTCAGGCAGACCTAGG + Intronic
1148158006 17:45434292-45434314 GCTTGGCGGCTGGTAGGCCTTGG + Intronic
1149250933 17:54768414-54768436 CTTTGGAATCAGGCAGGTCTAGG + Intergenic
1149681646 17:58511805-58511827 CTTTGGAGTCAGGCAAACCTGGG - Intronic
1150144389 17:62755436-62755458 TCTTGACAGCAGGCAGGCCTTGG + Intronic
1150389607 17:64782561-64782583 GCTTGGCGGCTGGTAGGCCTTGG + Intergenic
1151698754 17:75731458-75731480 CCCTGGAGTCAGGCAGGCCTGGG + Intronic
1151892663 17:76959829-76959851 CCATGGAGTCAGACAGCCCTGGG + Intergenic
1152185729 17:78855401-78855423 CCTTGGGTGCAGGCAGGGCTGGG - Exonic
1152622831 17:81373778-81373800 CCAGGCCGACAGGCAGGCCTCGG - Intergenic
1152783719 17:82237535-82237557 CCTTGGTGTCGGGCACGCCCAGG - Exonic
1153126634 18:1800223-1800245 CTTTGGCCTCAGGCAGACATAGG + Intergenic
1155343426 18:24835812-24835834 CCTTGGAGGGAGGCAGGACTGGG + Intergenic
1157270540 18:46272422-46272444 CCTTGGCTTCAGTCAGTGCTGGG + Intergenic
1157467448 18:47959350-47959372 CCTTGGCTTCTGGGAGACCTGGG + Intergenic
1158613905 18:58968506-58968528 CCTTGGCTTCTGGCAGACCCAGG + Intronic
1159604189 18:70457989-70458011 CTTTGGAGTCAGGCAGCCCTGGG - Intergenic
1160130060 18:76217740-76217762 CCATGGCCACAGGCAGGTCTTGG + Intergenic
1160198580 18:76777474-76777496 CCTTCCCGCCGGGCAGGCCTCGG + Intergenic
1160256387 18:77251306-77251328 CCTTGGCGGCAGCCTGGCCCCGG + Intronic
1161390064 19:4016115-4016137 CCTTGCCGACAGGCAGGACAGGG - Intronic
1161455503 19:4367853-4367875 CCTTGGCGCCAGGCACACATGGG - Intronic
1161746457 19:6063254-6063276 CCTGGGGGTCTGGCAGGCGTAGG - Intronic
1161978531 19:7619129-7619151 TCTTGGAGTCAGGCAGGCTCTGG - Intergenic
1162031612 19:7919976-7919998 CTCTGGGGTCAGACAGGCCTGGG - Intergenic
1162157221 19:8686695-8686717 CATTGGAGTCAGACAGGCCTGGG - Intergenic
1163007474 19:14405968-14405990 CTCTGGGGTCAGGGAGGCCTGGG + Intronic
1163033682 19:14560059-14560081 CTTGGGCCTCAGGCTGGCCTGGG + Intronic
1163236899 19:16035207-16035229 CTGTGGCCTCAGCCAGGCCTTGG - Intergenic
1163700976 19:18786369-18786391 CCTTGGGGTCAGGAGGACCTTGG - Intronic
1165124377 19:33583442-33583464 GCTAGGCCTCAGCCAGGCCTGGG - Intergenic
1165721899 19:38085033-38085055 ACTTGGAGTCAGACAGCCCTCGG + Intronic
1166534264 19:43562319-43562341 ACTTGGGGTGAGGTAGGCCTGGG + Intronic
1166558705 19:43718316-43718338 CTTTGGGGTCTGGCAGGCCCAGG - Intronic
1168205171 19:54845179-54845201 CCTTGGCCTCCTGCAGGGCTGGG - Intronic
1168269080 19:55239967-55239989 CCTAGCCCTCAGGCCGGCCTGGG + Intronic
1168612856 19:57814876-57814898 CATTGGCGTTAGGGAGTCCTTGG - Exonic
1202649967 1_KI270706v1_random:171025-171047 CTTCGGCCTCAGCCAGGCCTTGG + Intergenic
926147457 2:10405355-10405377 CCCTGGAGTCAGGCAAGGCTGGG - Intronic
926198330 2:10776750-10776772 CCCGGGGGTCTGGCAGGCCTGGG - Intronic
926989692 2:18664644-18664666 CCTCGTCATCAGGGAGGCCTGGG + Intergenic
927054738 2:19357946-19357968 CCTGGGCGTCAGCCAGAGCTAGG + Intronic
927149399 2:20187093-20187115 CTTTGAAGTCAGGCAGTCCTGGG + Intergenic
927292519 2:21419250-21419272 ACTTGGGGTCAGGCAGACCTGGG - Intergenic
927784162 2:25960981-25961003 CTTTGGAGCCAGGCAGGCCTAGG - Intronic
927914278 2:26924973-26924995 CCTTGGGGTCGGCCAGACCTCGG - Exonic
928065253 2:28157932-28157954 CTGTGGGGTCAGGCAGGCCTGGG + Intronic
929552719 2:42904607-42904629 CCTTGGAGTCAGTCAGGCCTAGG + Intergenic
929790071 2:45015685-45015707 CTTTGGTGTCAGACAGGCCTGGG + Intergenic
931717686 2:65042220-65042242 CCTTGGCCTCCCACAGGCCTGGG - Intergenic
932229130 2:70068072-70068094 CCTTGGCTCCAGGCAAGCCCTGG + Intergenic
932277196 2:70460521-70460543 CCTTTGCCTCAGGTAGGCGTTGG + Intronic
932448455 2:71794801-71794823 CCATGGAGCCAGGCAGGCCTGGG + Intergenic
932468370 2:71938388-71938410 CTCTGGAGTTAGGCAGGCCTGGG + Intergenic
933782468 2:85811844-85811866 CTTGGGAGTTAGGCAGGCCTGGG + Intergenic
933900518 2:86846474-86846496 CCCTGGAGTCAGGCAAACCTGGG - Intronic
934856930 2:97735370-97735392 CATTGGCGTCTGCCAGGCCGAGG + Exonic
935780031 2:106502751-106502773 CCCTGGAGTCAGGCAAACCTGGG + Intergenic
935939272 2:108221347-108221369 GCATGGCCACAGGCAGGCCTTGG + Intergenic
936067226 2:109341840-109341862 CCTTGCCTGCAGGCAGCCCTGGG - Intronic
936675801 2:114712491-114712513 CTTTGGAGTCAGGTAGCCCTGGG - Intronic
937044761 2:118845346-118845368 CCGGGGCGTCAGGCAGGCCTTGG + Intronic
937135077 2:119544887-119544909 CCTGTGCTTCAGGCAGGCCCAGG - Intronic
937295031 2:120804893-120804915 GCTTGGGGTCAGGCAGATCTGGG + Intronic
939064503 2:137466404-137466426 CCTGGGCCACAGGCAGGCCATGG - Intronic
939116579 2:138068284-138068306 CCTTGGCCTCACGAAGTCCTGGG + Intergenic
939612846 2:144331908-144331930 GCTTTCCGTCAGGAAGGCCTGGG + Intronic
940326677 2:152432960-152432982 CTTTGGAGTCAGGCAGACCCGGG + Intronic
941953299 2:171178299-171178321 ACTTGGCCTCAAGCAGACCTGGG - Intronic
942045555 2:172097330-172097352 CCTTGGCATGAGCCAAGCCTGGG - Intergenic
942948271 2:181693900-181693922 CACTAGCTTCAGGCAGGCCTAGG - Intergenic
944535397 2:200704719-200704741 CCCTGGCCTCAGCCTGGCCTAGG + Intergenic
945471309 2:210230453-210230475 CCCTGGGGCCAGGAAGGCCTTGG - Intergenic
946099012 2:217302814-217302836 CTTTGGGGTCAGACAGGCCTGGG + Intronic
946126311 2:217566147-217566169 GCTTGGCTTCGGGGAGGCCTTGG + Intronic
946926460 2:224631873-224631895 CCTTGGAGTCAGGCCGGGCGCGG - Intergenic
947493605 2:230616672-230616694 CCTTGGAGTCAGGCAGCCATTGG + Intergenic
947885520 2:233566565-233566587 CCGCGTCCTCAGGCAGGCCTGGG + Intronic
948087561 2:235264317-235264339 CTTTGGAGTCAGACAGGACTGGG - Intergenic
949069188 2:242013244-242013266 CGGTGGGGTCGGGCAGGCCTGGG + Intergenic
1168788782 20:562179-562201 CCTTGAAGTCAGGCAGACATGGG - Intergenic
1170443327 20:16400045-16400067 CCTTGGCTACAGGCACTCCTTGG + Intronic
1172228374 20:33320446-33320468 CCTTGGAGTCTGGCACTCCTGGG + Intergenic
1172595333 20:36147457-36147479 CCTTGGAGTCAGGCATGCCTGGG + Intronic
1172657771 20:36547530-36547552 CTTTGCTGTCAGACAGGCCTGGG - Intronic
1172836973 20:37879285-37879307 CCTGGGCCCCAGGAAGGCCTGGG - Intergenic
1172859521 20:38036299-38036321 TTTTGGCATCAGGCAGCCCTGGG - Intronic
1172964459 20:38824507-38824529 CTTTGGAGTTAGGCAGACCTGGG + Intronic
1173006447 20:39143073-39143095 CCTGGGCATTAGGCATGCCTTGG - Intergenic
1173174159 20:40751713-40751735 CCTTGGTGGGAGCCAGGCCTGGG - Intergenic
1173348137 20:42219768-42219790 CCCTGGCCTCAGGCAGCCCCGGG - Intronic
1173430672 20:42984759-42984781 CTTTGGTGTCAGACAAGCCTAGG - Intronic
1173564529 20:44029415-44029437 CTTTGGGGTCAGACAGACCTGGG + Intronic
1173585780 20:44182149-44182171 GCTGGGAGTCAGGCAGCCCTGGG - Intronic
1173952702 20:47005990-47006012 CACTGGCTTCAGGCAGGCCTGGG + Intronic
1174116045 20:48226944-48226966 GCCTGGCATCAGGCAGGCCTTGG - Intergenic
1174179822 20:48667830-48667852 CTTTGGCCTCAGCCTGGCCTAGG - Intronic
1174191628 20:48744659-48744681 ACTTGGCATCAGACAGACCTGGG - Intronic
1174507656 20:51027065-51027087 CTTTTGGGTTAGGCAGGCCTGGG - Intergenic
1174764995 20:53245286-53245308 CCTTAGGATCAGGCAGACCTTGG - Intronic
1174860472 20:54086502-54086524 CCCTGGAATCAGACAGGCCTGGG + Intergenic
1176194122 20:63829396-63829418 CCTTGCCTTCAGGCCAGCCTGGG - Intronic
1176271471 20:64237235-64237257 TTTGGGCCTCAGGCAGGCCTGGG - Intronic
1176302024 21:5102972-5102994 CCTTAGAGACAGACAGGCCTGGG + Intergenic
1176388361 21:6150978-6151000 GCTTTGGGGCAGGCAGGCCTGGG + Intergenic
1176601851 21:8801522-8801544 CTTCGGCCTCAGCCAGGCCTTGG - Intergenic
1176910938 21:14564525-14564547 CAGTGGTGTCAGACAGGCCTGGG - Intronic
1177814172 21:25958134-25958156 CCATGGCCCCAGGCTGGCCTTGG + Intronic
1178594346 21:33939454-33939476 ACTTGGCTTCAGTCATGCCTGGG + Intergenic
1179017617 21:37606688-37606710 CCTTGGCTTCCTGCACGCCTCGG + Intergenic
1179033228 21:37738137-37738159 CCATGGAGACAGGCAGCCCTGGG + Intronic
1179369039 21:40786976-40786998 CTTTGGAATCAGGCAGGGCTGGG - Intronic
1179642386 21:42756252-42756274 CCTTGGCCTCTGGCAGATCTAGG + Intronic
1179735111 21:43387270-43387292 GCTTTGGGGCAGGCAGGCCTGGG - Intergenic
1179855005 21:44158928-44158950 CCTTAGAGACAGACAGGCCTGGG - Intergenic
1180159021 21:45990787-45990809 CCTTGCAGCCTGGCAGGCCTGGG - Exonic
1180344136 22:11693073-11693095 CTTCGGCCTCAGCCAGGCCTTGG - Intergenic
1180960043 22:19758465-19758487 CCTTGGCGTCTGGGATGCCTGGG + Intronic
1181775128 22:25153880-25153902 CCTTGGGGTGAGGCAGACCCGGG - Intronic
1181801644 22:25351668-25351690 TCTCGGCGTCAAGGAGGCCTCGG - Exonic
1181980016 22:26759654-26759676 CTTTGGAGCCATGCAGGCCTGGG + Intergenic
1182031214 22:27160880-27160902 CTTTGGAGTCAGACAGACCTGGG - Intergenic
1182318879 22:29465714-29465736 CCTTGGGGCCAGGAAGGCCTCGG - Intergenic
1182342117 22:29631629-29631651 CCTTGGTGTGAAGCAGGGCTGGG + Intronic
1182421941 22:30252824-30252846 TCTTGGCCTCAGGCTGCCCTGGG - Intergenic
1182471503 22:30551220-30551242 CCTTGGTGTCAGACCTGCCTGGG + Intergenic
1182787102 22:32917240-32917262 CATTGGTGTCTGGCAGTCCTGGG - Intronic
1182793248 22:32970916-32970938 CCTTGGAGTTAGCCAGACCTGGG + Intronic
1182865596 22:33601515-33601537 TCATGGAGTCAGACAGGCCTGGG + Intronic
1183033049 22:35119819-35119841 TCTTGGAGTCAGACAGCCCTGGG + Intergenic
1183493066 22:38127046-38127068 GGTGGACGTCAGGCAGGCCTTGG - Intronic
1183899091 22:40991577-40991599 CCTTGGCAGCAGGGAGGTCTGGG - Intergenic
1183958148 22:41394802-41394824 CTTTGGAGTCAGGCACACCTGGG + Intronic
1184328190 22:43807919-43807941 CTTTGACGTCAAGCAGGCATAGG + Intronic
1184412526 22:44333177-44333199 CCTGGACGTCAGGCAGACCTGGG - Intergenic
1184446072 22:44547646-44547668 CCTGGGAGCCAGGCAGGGCTGGG - Intergenic
1184631071 22:45780470-45780492 CTCTGGAGTCAGGCAGACCTAGG + Intronic
949938679 3:9136737-9136759 CTCTGGCATCAGGCAGGCCCAGG - Intronic
950185662 3:10943907-10943929 CCTTGGCGCCAGACACACCTGGG - Intergenic
950206757 3:11086870-11086892 CTTTGGTGTCAGACAGACCTGGG - Intergenic
951473664 3:23082240-23082262 CTTTGGGGTCAGGGAGGCCTAGG - Intergenic
952746738 3:36788571-36788593 ATTTGGAGTCAGACAGGCCTGGG + Intergenic
953696439 3:45163657-45163679 TCTTGGCATCGGGTAGGCCTGGG + Intergenic
954614329 3:51961839-51961861 CCTTGAAGGCAGGGAGGCCTCGG + Intronic
954921082 3:54191677-54191699 GCTTGGTGTTAGGCAGGGCTGGG + Intronic
955012543 3:55032569-55032591 CTTTGGCGTCATGAAGACCTGGG + Intronic
955277288 3:57558378-57558400 CTTTGGAGTCAGGCAGACCTGGG - Intronic
956385017 3:68707539-68707561 CCTTGGCGTCACGAAGTGCTGGG - Intergenic
959664541 3:108906083-108906105 CTTGGGAGTCAGGCAAGCCTGGG - Intergenic
960621140 3:119637864-119637886 CCTAGGCCCCAGGAAGGCCTTGG + Intronic
961673853 3:128553075-128553097 CCTTGGCATCAGGCATGCAAGGG + Intergenic
961779511 3:129313530-129313552 CCTAGGAGGCAGGTAGGCCTAGG - Intergenic
961866458 3:129956877-129956899 CCTTGGCAACAGGCTGGCCAGGG + Intergenic
962192548 3:133326751-133326773 CCTTGGTGTCAGAAAGTCCTGGG + Intronic
962247781 3:133811324-133811346 CCTTGGGGTCAGCCAGTTCTGGG + Intronic
963087210 3:141449152-141449174 CTTTGGAGTCAGGCAGACCTAGG - Exonic
963264779 3:143229081-143229103 CTTTGGGGTCAGACAGCCCTGGG + Intergenic
965245216 3:166258599-166258621 CCTTCCCGTCGGGCAGGGCTCGG - Intergenic
965622550 3:170655728-170655750 ACCTGGAGTCAGGCTGGCCTGGG - Intronic
966730611 3:183147965-183147987 CCTTGGCTTCTGACAGTCCTGGG + Intronic
967015558 3:185478558-185478580 CCTGGGCATCAGCCAGGCCTAGG + Intronic
967149838 3:186638498-186638520 CTTTGGTGTCAGGCAGTCTTGGG - Intronic
969073661 4:4559720-4559742 CTTTGGAGTCAGGCAGCACTGGG + Intergenic
969081030 4:4618222-4618244 CTTTGGAGTTAGACAGGCCTGGG + Intergenic
969084909 4:4649052-4649074 CTTTGGAGTCAGACAGACCTGGG - Intergenic
969094339 4:4720504-4720526 GCTTGGAGACAGGCAGACCTGGG - Intergenic
969315465 4:6379008-6379030 CCTTGGCGTCAGGCAGGCCTCGG - Intronic
969375515 4:6760974-6760996 CCTTGGCGTCTGGGAGGGGTAGG - Intergenic
969386639 4:6854360-6854382 GCTTGGAGTCATGCTGGCCTGGG - Intronic
969433317 4:7168712-7168734 ATTTGGAGTCAGGCAGGCGTGGG + Intergenic
969704921 4:8786391-8786413 CCTTGGCCTCAGGGTGGGCTGGG - Intergenic
970413794 4:15836641-15836663 CTTTGGAATCAGGGAGGCCTAGG - Intronic
971172901 4:24251754-24251776 CTGTGGAGTCAGACAGGCCTGGG - Intergenic
971326743 4:25650676-25650698 CCTTGGCCTCCGGAAGGGCTGGG - Intergenic
971459098 4:26874394-26874416 ACTTGGCGTCGGGCAGACGTTGG - Intronic
971843818 4:31892773-31892795 CCTTGGCCTCAGGAGGGCGTTGG - Intergenic
972561583 4:40233500-40233522 ACCTGGGGTCAGGCAGGCTTGGG - Intronic
973330612 4:48907175-48907197 CCTGGGAGCCAAGCAGGCCTGGG - Intergenic
974027724 4:56748691-56748713 CTTTGGAGCCAGGCAAGCCTGGG - Intergenic
975422013 4:74176339-74176361 CCTTCGCTTCATGCGGGCCTAGG + Intronic
977267353 4:94871180-94871202 TCTTGGAGTCAGGCAGTCCTTGG - Intronic
977916454 4:102599641-102599663 CTTTGGAGTAAGACAGGCCTGGG + Intronic
980051905 4:128047689-128047711 CCTTCCCGTGGGGCAGGCCTCGG - Intergenic
981766693 4:148258767-148258789 GCTTGGCTTCAGGCAAGCCATGG - Intronic
983280859 4:165679381-165679403 CTTTGGAGTCAGACAGACCTGGG + Intergenic
984534636 4:180958700-180958722 CTTGGGCATCAGACAGGCCTGGG + Intergenic
984814361 4:183822921-183822943 CCGTGGAGTCAGGCAGACCTGGG - Intergenic
985530875 5:433304-433326 CCTGGGTGGCAGGCAGGCCCTGG - Intronic
985555531 5:556141-556163 ACTGGGCTCCAGGCAGGCCTGGG + Intergenic
985688431 5:1294252-1294274 CCATAGCGTCAGGGAGGCCGGGG - Exonic
985879163 5:2625486-2625508 CCTCTGCCTCAGGCAGCCCTGGG - Intergenic
985925860 5:3017935-3017957 CCTGGGCGGCATGCAGCCCTCGG - Intergenic
986193544 5:5517853-5517875 CCTGGGCTTCAGGCATTCCTTGG - Intergenic
986319381 5:6615646-6615668 CCTTGGCGGCTGGCTGGTCTGGG - Intronic
986612909 5:9587899-9587921 CTTTAGAGTCAGGCAGACCTAGG + Intergenic
987045985 5:14108716-14108738 CCTGGGCTTCAGAAAGGCCTCGG - Intergenic
988445492 5:31281830-31281852 CTTTGGAGTCAGGCAGGCCTTGG + Intronic
988834274 5:35015970-35015992 CCTGGGAGTCAGACAGACCTGGG + Intronic
989425591 5:41291887-41291909 CTTTGGCATCAGGCAGTCCTGGG + Intergenic
991291133 5:65034994-65035016 ACTGGGCGTCCGGCAGCCCTGGG - Intergenic
991627454 5:68618680-68618702 CCCTGGCTTCAGGAAGGCTTTGG + Intergenic
992069775 5:73137831-73137853 CCTTGGCATCAGGCAGACCTCGG - Intergenic
992228918 5:74644197-74644219 CCATGGCGTCAGCCAAGGCTTGG - Intronic
992498564 5:77318433-77318455 CCCTGGGGTCAGGCCAGCCTCGG + Intronic
993996727 5:94732240-94732262 CCTTGGCTGCATGCAGGCCATGG - Intronic
994229990 5:97301378-97301400 CCTTCCCGTGAGGCAGGGCTCGG + Intergenic
994950310 5:106453243-106453265 TCTTGGCTGCAGGCAGTCCTTGG - Intergenic
995855443 5:116586584-116586606 CATTGGCGTAATTCAGGCCTGGG + Intergenic
996727677 5:126686922-126686944 CTCTGGTCTCAGGCAGGCCTAGG - Intergenic
997198093 5:131993012-131993034 CTTTGGTGTCTGGCAGTCCTGGG - Intronic
997202818 5:132023022-132023044 CCTGGGCCTCAGCCATGCCTGGG - Intergenic
997379742 5:133427098-133427120 CTCTGGAGTCAGGCAGCCCTGGG + Intronic
997890923 5:137676086-137676108 CCTTAGGCTCAGGGAGGCCTTGG - Intronic
997897243 5:137730195-137730217 CCTTGGAGTCAGATAGACCTGGG - Intronic
998094631 5:139390353-139390375 CCTTGGGGTCAATCAGGCTTGGG - Intergenic
998387262 5:141764598-141764620 TTATGGGGTCAGGCAGGCCTAGG + Intergenic
998613125 5:143710913-143710935 CTTTGGTGTTAGGCAGTCCTGGG + Intergenic
999078852 5:148824725-148824747 TCTTGGACTCAGGCAGACCTGGG + Intergenic
999303087 5:150502981-150503003 GCTTGGGGTCAGGCAGGCATGGG + Intronic
999377495 5:151096991-151097013 CTGTGGAGGCAGGCAGGCCTGGG - Intergenic
1000200346 5:159003886-159003908 CTTTGCAGTCAGGCAGGGCTGGG - Intronic
1000690301 5:164309996-164310018 CTTTGGAGTCAGGCTGACCTAGG - Intergenic
1001051824 5:168419936-168419958 CTTTGGTGTCAGGCATGCCTGGG + Intronic
1001753083 5:174146385-174146407 CCCTGGAATCAGACAGGCCTAGG - Intronic
1001924300 5:175625268-175625290 CCATGGAGTCGGGCAGACCTGGG - Intergenic
1001931896 5:175679049-175679071 CTGTGGCATCAGGCAGACCTGGG + Intronic
1003815421 6:9834970-9834992 CTTTGGCATCAGGCCGGGCTAGG - Intronic
1004170859 6:13294576-13294598 CCTTAGAGTCAGGCAGACCTGGG - Intronic
1004570293 6:16838316-16838338 CTTTGGAGTCAGGTAGGCCTGGG + Intergenic
1004850425 6:19693017-19693039 ACTTGGCCTCAGGCAGACCTGGG + Intergenic
1005687697 6:28271079-28271101 CCTGGGCCTTAGACAGGCCTGGG - Intronic
1005783004 6:29212875-29212897 CCATGGTGTCAGACAAGCCTTGG + Intergenic
1006419691 6:33925380-33925402 CCTTGAAGTCAGGAAGGCCCTGG + Intergenic
1006425689 6:33961674-33961696 CCTGGGCACCAGTCAGGCCTGGG + Intergenic
1006910829 6:37562473-37562495 GCTGGGGGTCAGGCAGGCCTGGG + Intergenic
1007817321 6:44533818-44533840 GTTTGACTTCAGGCAGGCCTGGG - Intergenic
1010002325 6:70959583-70959605 TCTTGGAGTCAGGCAGACCTGGG + Intergenic
1010148346 6:72698907-72698929 CCTTGGCGTCCGACAGTGCTGGG + Intronic
1012417855 6:99029005-99029027 CCTTGGAGTCAGACAGAACTGGG - Intergenic
1012650103 6:101741974-101741996 CCTTGGAGTCAGGTAAACCTGGG - Intronic
1012868987 6:104651714-104651736 CTTTGGAGTCAGACAGACCTAGG - Intergenic
1014018967 6:116566108-116566130 CCTAGGCTTCAGGCTGTCCTTGG + Intergenic
1014952526 6:127573982-127574004 CTTTGACATCAGGCAGGCCTGGG + Intronic
1015068651 6:129061774-129061796 CTTTGGAGTCAGGTAGACCTGGG - Intronic
1016858320 6:148694390-148694412 CCTAGGCGTAAGGCAGCACTTGG + Intergenic
1017920355 6:158867267-158867289 CCTTGGAGCCAGGCAGGCTTGGG - Intergenic
1018170490 6:161139883-161139905 CCCTGGCGCCAGGCCAGCCTGGG + Intronic
1018203812 6:161417986-161418008 CCATGGAGTCAGCCAGGCCTGGG - Intronic
1019139783 6:169936057-169936079 GCCTGGGGGCAGGCAGGCCTGGG - Intergenic
1019276207 7:177303-177325 CCGTGATGTCAGCCAGGCCTCGG - Intergenic
1019407037 7:889281-889303 CCTTGCCGTGGAGCAGGCCTGGG - Intronic
1019492311 7:1321244-1321266 CCTGGGGGTCAGGCAGAGCTGGG + Intergenic
1019790048 7:3005868-3005890 CTTTGGAGGGAGGCAGGCCTGGG + Intronic
1020806951 7:12801719-12801741 CTTTAGAATCAGGCAGGCCTGGG + Intergenic
1022473910 7:30698167-30698189 CTTTGGCGTCAGAAAGGCCGAGG + Intronic
1022854700 7:34303305-34303327 CCTGGGCTTCAGGCATTCCTTGG + Intergenic
1023455211 7:40331394-40331416 CTTTGGAGTCAGACAGACCTTGG + Intronic
1023499315 7:40831109-40831131 CCGTGGCATGAGGCAGGCCTGGG - Intronic
1023781553 7:43660614-43660636 CCCTGGAGTCAGGCAGACCTGGG - Intronic
1023834682 7:44061173-44061195 GCTTGGCCACAGGCAGGGCTTGG - Exonic
1024018937 7:45347880-45347902 CCTTGGCCTGAGACAGGACTGGG - Intergenic
1024205257 7:47153768-47153790 CCTTGGAGCCAGGCAGACCTGGG + Intergenic
1024335612 7:48203043-48203065 CCTTCCCGTGGGGCAGGCCTCGG - Intronic
1025839787 7:65135318-65135340 CTTTGGCATGAGGCAGGCCTGGG + Intergenic
1025883279 7:65560648-65560670 CTTTGGCATGAGGCAGGCCTGGG - Intergenic
1025890167 7:65641959-65641981 CTTTGGCATGAGGCAGGCCTGGG + Intergenic
1026512366 7:71037824-71037846 CCTTCCCGTGAGGCAGGGCTCGG + Intergenic
1026841401 7:73671478-73671500 CCCTGGCCTCAGGCAGGCCCTGG + Exonic
1026984771 7:74547829-74547851 GCTTTGGGTCTGGCAGGCCTGGG - Intronic
1027306614 7:76904877-76904899 CTTTGGGGTCAGGCAGGTCTGGG + Intergenic
1029155230 7:98512669-98512691 GCTTGGCCTCAGGGAGGCCATGG + Intergenic
1029277428 7:99415305-99415327 CCTTGGTGCCAGGCAGGCAAGGG - Intronic
1030085236 7:105810273-105810295 CCTTGGAGCCAGGGAGACCTGGG + Intronic
1031852318 7:126880035-126880057 CTTTGGCATGAGGCAGGCCTGGG - Intronic
1034678529 7:152910436-152910458 CTTTGGTGACAGGCAGGACTAGG + Intergenic
1034756218 7:153622911-153622933 CCAAGGTGTCAGCCAGGCCTGGG + Intergenic
1034834914 7:154343322-154343344 CCTTGGAGACAGGCAGTCTTTGG - Intronic
1035239242 7:157519363-157519385 CCTGGACGTCAGGGAGGCCCGGG - Intergenic
1037579959 8:20239202-20239224 CCTTGGCCACAGTCAGGCCTGGG + Intergenic
1037806310 8:22059573-22059595 CTTTGGCCTCAGGCAGGCCGGGG + Intronic
1038434799 8:27527963-27527985 CTTTGGAGTCAAACAGGCCTAGG - Intronic
1038826532 8:31008823-31008845 CCTTGGTGTCAGCCAGTCCTGGG - Intronic
1039411326 8:37357618-37357640 CTTTAGGGCCAGGCAGGCCTTGG + Intergenic
1039914937 8:41852763-41852785 CCTTGAGGTCAGACAGACCTGGG - Intronic
1042525254 8:69757931-69757953 CTGTGGCTTCAGGCAGACCTGGG + Intronic
1044226519 8:89725156-89725178 CTTTGAAGTCAGGCAGACCTGGG - Intergenic
1045553541 8:103193807-103193829 TTTTGGAGTCAGGCAGGCCTGGG - Intronic
1046423057 8:114009513-114009535 CTTTGGAGTCAGACAGACCTCGG - Intergenic
1047181689 8:122594606-122594628 ACTGAGAGTCAGGCAGGCCTGGG - Intergenic
1047191097 8:122679638-122679660 TCTTGGCTTCCGGGAGGCCTCGG - Intergenic
1047338149 8:123955516-123955538 CTTTGAAATCAGGCAGGCCTGGG + Intronic
1048028169 8:130605770-130605792 CTATGGAGTCACGCAGGCCTAGG + Intergenic
1048166687 8:132067910-132067932 GCTTGAAGCCAGGCAGGCCTGGG - Intronic
1048178383 8:132172892-132172914 CCTTGAAGTCAGGAAGACCTGGG + Intronic
1048988069 8:139746013-139746035 CCTTGGTGCCAGGGAGACCTGGG - Intronic
1049203343 8:141352186-141352208 CCCTGGAGTCAGGCAGGGCTGGG + Intergenic
1049220290 8:141425857-141425879 GTTTGGGGTCAGACAGGCCTTGG + Intronic
1049831583 8:144704564-144704586 CCCTGGCCTCAGGCAGGGGTGGG + Intergenic
1051344153 9:16137428-16137450 CTTTTGAGGCAGGCAGGCCTAGG + Intergenic
1052400203 9:27990725-27990747 ACTTTGTGTCAGGCAGACCTGGG - Intronic
1053306740 9:36989715-36989737 CTCTGGGGTCAGGCAGGACTTGG + Intronic
1053510692 9:38685659-38685681 CTTTGGCGTCAGGCAGATCTGGG - Intergenic
1055557558 9:77490514-77490536 CCTTCCCGCGAGGCAGGCCTCGG - Intronic
1057256727 9:93555157-93555179 CCTTGGGGGCAGGTAGGGCTGGG - Intronic
1057742149 9:97721300-97721322 CCTTGCAGACAGGCAGACCTGGG + Intergenic
1057815211 9:98289378-98289400 CCTGGGAGTCAGACAGACCTGGG - Exonic
1057870502 9:98713419-98713441 ATTTGGGGTCAGGCAGGACTGGG - Intergenic
1058696657 9:107564654-107564676 CCTCAGCCTCAGGCAGGCCCAGG - Intergenic
1059336774 9:113573924-113573946 CTTTGGAGTCAGGCAGACCATGG + Intronic
1059431407 9:114252616-114252638 CCTTGGGTCCAGGCACGCCTGGG - Exonic
1059485898 9:114626611-114626633 CCCTGGAGTCAGACAGCCCTGGG - Intronic
1059641241 9:116219015-116219037 CCAGGGAGTCAGGCAGACCTGGG - Intronic
1059670248 9:116484407-116484429 CCTTGGGGACACGCAGGGCTGGG - Intronic
1060248561 9:121967132-121967154 ACTTGGTATCAGCCAGGCCTGGG - Intronic
1060252523 9:121997585-121997607 CTTCGGAGTCAGGCAGACCTGGG + Intronic
1060299343 9:122365739-122365761 TTTTGGCGTAAGGCAGACCTGGG - Intergenic
1060359558 9:122941535-122941557 CCTGGGCCTCAGGCTGTCCTGGG + Intronic
1060401735 9:123353623-123353645 CTTTGGCATCAGGCAGACCTGGG - Intergenic
1060526177 9:124322552-124322574 CCTGGGGGTCAGGCAGGCCTGGG - Intronic
1060788053 9:126465917-126465939 CTTTGGTGTCAGACAGCCCTAGG - Intronic
1060901965 9:127266438-127266460 CTTTGGAATCAGGTAGGCCTGGG + Intronic
1060949002 9:127588859-127588881 GCTTTGAGTCAGGCAGACCTCGG + Intergenic
1061471919 9:130834022-130834044 CCTTGGAGCCAGGCAGACCTGGG + Intronic
1061587850 9:131579945-131579967 CCTCAGAGTCAGGCAGGCCAGGG + Intronic
1061681748 9:132245942-132245964 CTCTGGAGTCAGGCAGCCCTGGG - Intergenic
1061876821 9:133548219-133548241 CTCTGGCACCAGGCAGGCCTGGG - Intronic
1062266255 9:135687784-135687806 CCTAGGCTCCAGGGAGGCCTGGG + Intergenic
1185451609 X:283674-283696 CCTTGGTGTCAGGCACGGGTGGG + Intronic
1186794352 X:13030094-13030116 CTTTGGTGTCAGGCAGACCCAGG - Intergenic
1188441437 X:30218000-30218022 CCTTGGCTTCATGTAGGGCTTGG - Intronic
1189282108 X:39826199-39826221 TTTTGGAGTCAGGCATGCCTAGG - Intergenic
1189496933 X:41517098-41517120 CCTGTGCTCCAGGCAGGCCTGGG - Intronic
1189564791 X:42230570-42230592 CTTTGGCGTCAGACAGACCTGGG + Intergenic
1191853363 X:65602591-65602613 TCTCGGTGTCAGGCAGACCTGGG + Intronic
1192198928 X:69051457-69051479 CTTTGGAGCCAAGCAGGCCTAGG + Intergenic
1192259363 X:69495223-69495245 CTTTGGAATCAGGCAGGCCTGGG - Intergenic
1192341167 X:70264461-70264483 GCTTGGAGTCAGACAGACCTAGG + Intergenic
1192342244 X:70273595-70273617 CTTTGGAGTCAGACAGGCCTGGG + Intronic
1192437590 X:71152462-71152484 CTTTGGAGTCAAGCAGACCTGGG + Intronic
1193357081 X:80533615-80533637 CTATGGCTTCATGCAGGCCTAGG - Intergenic
1193367179 X:80649154-80649176 CCTTGGAATCAGGCAGACCTGGG - Intergenic
1194291796 X:92082118-92082140 CTGTGGTGTCAGGTAGGCCTGGG - Intronic
1195677820 X:107520728-107520750 CCCTGGAGTTAGGCAGACCTGGG + Intergenic
1195717835 X:107834824-107834846 CCCTGGAGTCAGACAGACCTGGG + Intronic
1195938012 X:110143647-110143669 CCTTGGCATAAGACAGACCTGGG + Intronic
1196111617 X:111952605-111952627 CTTTGGGGTCAGGAAGACCTGGG + Intronic
1196582714 X:117394910-117394932 CCTTCCCGTGGGGCAGGCCTCGG + Intergenic
1197840467 X:130740837-130740859 CTTTGGAGTCAGACAGACCTGGG + Intronic
1198045100 X:132893699-132893721 TCTTGGCTTCAGGCAGATCTTGG - Intronic
1198642247 X:138769311-138769333 CTTTGGCATCAGGCAGACCCAGG + Intronic
1198799925 X:140438283-140438305 CATTGGCTTCAGACAAGCCTTGG + Intergenic
1199664699 X:150087445-150087467 CTTTGGGGTCAGGGAGTCCTGGG + Intergenic
1200609311 Y:5306690-5306712 CTGTGGTGTCAGGTAGGCCTGGG - Intronic