ID: 969318496

View in Genome Browser
Species Human (GRCh38)
Location 4:6396154-6396176
Sequence CTTGTACTCCACCCAGGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 153}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969318493_969318496 -10 Left 969318493 4:6396141-6396163 CCCGAGGGTTGAACTTGTACTCC 0: 1
1: 0
2: 0
3: 5
4: 71
Right 969318496 4:6396154-6396176 CTTGTACTCCACCCAGGAGCAGG 0: 1
1: 0
2: 1
3: 16
4: 153
969318492_969318496 -2 Left 969318492 4:6396133-6396155 CCACAACTCCCGAGGGTTGAACT 0: 1
1: 0
2: 0
3: 7
4: 64
Right 969318496 4:6396154-6396176 CTTGTACTCCACCCAGGAGCAGG 0: 1
1: 0
2: 1
3: 16
4: 153
969318489_969318496 11 Left 969318489 4:6396120-6396142 CCACATGGGGAAACCACAACTCC 0: 1
1: 0
2: 0
3: 40
4: 674
Right 969318496 4:6396154-6396176 CTTGTACTCCACCCAGGAGCAGG 0: 1
1: 0
2: 1
3: 16
4: 153
969318488_969318496 18 Left 969318488 4:6396113-6396135 CCAGCTTCCACATGGGGAAACCA 0: 1
1: 0
2: 3
3: 45
4: 714
Right 969318496 4:6396154-6396176 CTTGTACTCCACCCAGGAGCAGG 0: 1
1: 0
2: 1
3: 16
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969318496 Original CRISPR CTTGTACTCCACCCAGGAGC AGG Intronic
900574266 1:3375239-3375261 CTGGTACTCCCCCCAGGACATGG + Intronic
901845222 1:11977889-11977911 CTTGTACTCTGCCCAGCAGCTGG - Intergenic
906151127 1:43588323-43588345 TTGGTGCTCCAGCCAGGAGCAGG + Intronic
911037675 1:93567684-93567706 CTTGTACTCCACTCCCCAGCGGG + Intronic
915821648 1:159030758-159030780 GTTGTCCTCCAGCCAGGAGGTGG + Intronic
916170658 1:161999416-161999438 TTTATTCTCCACCCAGTAGCTGG - Intronic
916843543 1:168625447-168625469 TTTCTAGTCCACCCAGCAGCAGG + Intergenic
924883245 1:248186653-248186675 CTTGGCCTCCAGCCAGGAGGTGG + Intergenic
1064557166 10:16559195-16559217 GTTGGCCTCCAGCCAGGAGCTGG + Intergenic
1067066106 10:43105162-43105184 CTTGAACTCCACCACGGCGCTGG - Exonic
1067067899 10:43113815-43113837 CTGTTACTCCACCCAGGAGAGGG + Intronic
1068284897 10:54921905-54921927 CTTCTGCTCCACCATGGAGCAGG - Intronic
1069129537 10:64681907-64681929 GTTGGTCTCCAGCCAGGAGCTGG + Intergenic
1070999457 10:80816353-80816375 GATGTACTCCAACAAGGAGCAGG + Intergenic
1071525434 10:86355457-86355479 CTTCTCCTCCACCCAGGTGTGGG - Intronic
1072717618 10:97762170-97762192 CTTGTAGGCCACCCACGTGCAGG - Intergenic
1073114715 10:101085267-101085289 CTTGAACTCCACCTGGGAGGTGG + Intergenic
1073623311 10:105071377-105071399 ACTGTACTCCTCCAAGGAGCAGG - Intronic
1077409296 11:2396012-2396034 CTAGGACCCCACCCAGGGGCGGG - Intronic
1078656516 11:13245626-13245648 CTTGCTTTCCAGCCAGGAGCAGG + Intergenic
1083072957 11:60005796-60005818 CTTGTCCTCCACCCTCCAGCAGG + Intergenic
1083294663 11:61708857-61708879 CCTGTCCTCCACCCGGCAGCAGG + Intronic
1083974484 11:66106625-66106647 CTTCACCTCCACCCAGTAGCTGG - Intronic
1084307897 11:68298706-68298728 CTAGGACTCCACCAGGGAGCAGG + Intergenic
1084455643 11:69266659-69266681 CTTGCACACCACCCTGGAGATGG - Intergenic
1089596182 11:119582103-119582125 CTCATACTCCACCCAGGCCCAGG - Intergenic
1089637078 11:119821771-119821793 GTTCTGCTCCACCCAGTAGCTGG + Intergenic
1094535657 12:31320500-31320522 CTTGTATTACAACCAGGTGCTGG + Intronic
1095736049 12:45557311-45557333 CTAGGACTCCAGCCAGGAGCTGG - Intergenic
1096542832 12:52317770-52317792 CTTCTACCCCACCCAGGATGTGG - Exonic
1097069717 12:56346046-56346068 CTGGTGCTCCACCCAGGAGAAGG + Intronic
1097069845 12:56346826-56346848 CTGGTGCTCCACCCAGGAGCAGG + Exonic
1098966512 12:76795356-76795378 CTTGGACCCCACCCAGGATAGGG - Intronic
1101144212 12:101825920-101825942 TTTGTGCTGCACCTAGGAGCAGG + Intronic
1101544391 12:105697921-105697943 GTTGGCCTCCACCCAGGAGGTGG + Intergenic
1101842693 12:108339570-108339592 CTTGCACTTCCCCCAGCAGCCGG - Intergenic
1102199229 12:111046055-111046077 CCTGAACTCCAGCCAGGTGCAGG + Intronic
1102784855 12:115596085-115596107 CTCCTATTCCACCCTGGAGCAGG - Intergenic
1105715430 13:23057809-23057831 CTTGTCTGCCACCCAGGGGCTGG - Intergenic
1106227330 13:27795032-27795054 CTTGTGCGCCACGCCGGAGCGGG - Intergenic
1106785772 13:33106843-33106865 CTCGCACACCACCCAGGAGCTGG + Exonic
1109975727 13:69829101-69829123 CTTGGCCTCCAGCCAGGAGGTGG - Intronic
1110789085 13:79567587-79567609 CTTGTACCCTACCCAGGAAGTGG - Intergenic
1112759438 13:102677384-102677406 CCTGTTCTCCACACAGCAGCTGG + Intronic
1119267861 14:73274973-73274995 CATGGACTTCACCTAGGAGCTGG - Intergenic
1122641130 14:103160371-103160393 CGTGTTCTCCCCACAGGAGCAGG + Intergenic
1126765988 15:52011658-52011680 CTTGTATTTCCCCTAGGAGCAGG + Intronic
1127647504 15:60973321-60973343 CTGCTCATCCACCCAGGAGCTGG - Intronic
1129787723 15:78320530-78320552 CTTGTTGTCCACACAGCAGCTGG - Intergenic
1131593475 15:93773362-93773384 CCTGTGCTCCTCCCAGGAGCTGG + Intergenic
1133072355 16:3254726-3254748 CTTGTTCTCCCCCAGGGAGCTGG + Exonic
1134362095 16:13541121-13541143 CTTCTGCTCCAGCCAGGAGGGGG - Intergenic
1137537515 16:49338721-49338743 CTTCTTCTCCACGCAGCAGCTGG + Intergenic
1137735478 16:50720111-50720133 CTTGTCCTCCCCACTGGAGCTGG - Intronic
1139375623 16:66494740-66494762 CCTGCTCTCCATCCAGGAGCGGG + Intronic
1139967757 16:70755128-70755150 CTTCTACACCACCCTGCAGCAGG + Intronic
1142134616 16:88445963-88445985 TTTGTATTCCACCCAGATGCAGG + Intergenic
1142190544 16:88715292-88715314 CTGGTACACCACACTGGAGCCGG + Exonic
1142222756 16:88863680-88863702 CTTGTGCTCCATCCTGGGGCTGG - Exonic
1144755665 17:17679176-17679198 CTTAGGCTCCACTCAGGAGCAGG + Intergenic
1145882795 17:28364428-28364450 CGTGGACTCAAGCCAGGAGCTGG + Exonic
1147042668 17:37730534-37730556 CTTGTACACCACCCAGCTGATGG + Intronic
1147166553 17:38596495-38596517 CTGGTTCTCCACCCAGAAACAGG + Intronic
1149020225 17:51955056-51955078 CAAATACTCCACCCAAGAGCCGG - Intronic
1149380738 17:56091063-56091085 CTTGTTTTCCTCCCAGAAGCTGG + Intergenic
1151003212 17:70402148-70402170 CTTGTACACCTCCCACCAGCCGG + Intergenic
1151931974 17:77238195-77238217 CTTGAACCCAACCCAGGAGGTGG - Intergenic
1157304313 18:46506017-46506039 CTTGTGCACCCCCCAGGAGCAGG - Exonic
1157621545 18:49020200-49020222 AATGTGCTCCACACAGGAGCGGG + Intergenic
1160347364 18:78144862-78144884 CTCATTCTCCAGCCAGGAGCCGG + Intergenic
1160822553 19:1065275-1065297 CTTGTACTTCTCCAAGGACCAGG + Exonic
1161219182 19:3110206-3110228 CTTGTCCTCCTCCGAGTAGCCGG - Exonic
1163158596 19:15452160-15452182 CTGGCACTCCCACCAGGAGCTGG - Intronic
1163186035 19:15640409-15640431 CTTGAACTCCATCCAGCAGCAGG + Intronic
1165797796 19:38528809-38528831 GTTCTACTCAAGCCAGGAGCTGG - Intronic
1167765803 19:51481426-51481448 CATGTTCTCCACCAGGGAGCTGG - Exonic
1168281198 19:55306286-55306308 CTTGTACTCGGCCCTGAAGCTGG - Exonic
1168283112 19:55316582-55316604 CCTGTCCTCCACACAGCAGCTGG - Intronic
925441862 2:3895072-3895094 GTTGTCCTCCAACCAGGAGGTGG + Intergenic
927022147 2:19028656-19028678 ATTGCAATCCACCCAAGAGCAGG - Intergenic
929197091 2:39196142-39196164 GTTGACCTCCAGCCAGGAGCTGG - Intronic
932645754 2:73499819-73499841 CTCGTAGTTCACCCAAGAGCTGG + Intronic
932842632 2:75097837-75097859 CTTGTACTACCACCAGGAACAGG - Intronic
934676827 2:96255131-96255153 CCTGCAGACCACCCAGGAGCAGG - Intronic
937691429 2:124760133-124760155 CATGTACCCCACTCAGGAGAAGG + Intronic
941825978 2:169897583-169897605 CTTGAACTGAACCCAGGAGGCGG - Intronic
943149948 2:184099322-184099344 CTTGGCCTCCAGCCAGGAGGTGG + Intergenic
944427858 2:199602465-199602487 GTCATACTCCACCCAGGAGAGGG + Intergenic
945124022 2:206488666-206488688 TTTGTACTCTACCCAGGAGGAGG - Intronic
945550246 2:211212439-211212461 CTTCTACTTCTCCCATGAGCAGG - Intergenic
945969736 2:216223869-216223891 TTTCTACTCCTCCCAGGAGTGGG - Intergenic
948289358 2:236813829-236813851 CTTGAACCCCACCCAGCACCTGG + Intergenic
948702248 2:239767689-239767711 CTGGTGCTCCTCCCAGGGGCAGG + Intronic
1170600427 20:17837392-17837414 CATGTACCCCAGCCAGGAGCAGG + Intergenic
1173644848 20:44626866-44626888 CCTGTTCTCCACCCAGCAGTTGG + Intronic
1173647519 20:44642694-44642716 CCTGTCCTCCACACAGCAGCCGG - Intronic
1176272035 20:64240370-64240392 CATGTACTCCAACCAGGACCCGG + Exonic
1176430316 21:6571382-6571404 GCTGCACTCCACACAGGAGCTGG + Intergenic
1177893398 21:26833629-26833651 CTTGGCCTCCAGCCAGGAGGTGG - Intergenic
1179636834 21:42717455-42717477 CAGGCACTCCACCCAGGAGGTGG + Intronic
1179705710 21:43178844-43178866 GCTGCACTCCACACAGGAGCTGG + Intergenic
1181821301 22:25477740-25477762 CTTGCACTCCTGCCATGAGCAGG - Intergenic
1182994569 22:34800697-34800719 CCTGTAGACCACCCAGGACCAGG + Intergenic
1183546569 22:38457234-38457256 CTTGTGCCCCGCCCAGGGGCTGG - Intergenic
1183791885 22:40078484-40078506 ATTGCACTCCAGCCAGGAGATGG + Intronic
1184765451 22:46569778-46569800 CGTGTTTTCCACCGAGGAGCGGG + Intergenic
954295629 3:49673381-49673403 CTCAGACTCCACCCAGGACCAGG - Intergenic
954752113 3:52819581-52819603 CTTGAGATCCACCCAGGAGTGGG + Exonic
960593571 3:119388500-119388522 CCTCTCCTCCACACAGGAGCTGG - Intronic
966435671 3:179881229-179881251 CTTGTACTCAAGGCAGGGGCCGG + Intronic
967794001 3:193578756-193578778 CTCTTTCTCCTCCCAGGAGCTGG + Intronic
969318496 4:6396154-6396176 CTTGTACTCCACCCAGGAGCAGG + Intronic
971470032 4:27013747-27013769 ATTGTAGCCCACCCAGGGGCTGG - Intronic
972469989 4:39395071-39395093 CAGCTACTCCACCCAGGAGGTGG + Intergenic
973021598 4:45209468-45209490 CTGGTAGTCCAGCTAGGAGCTGG - Intergenic
973842861 4:54880230-54880252 GTTGTACTTTAGCCAGGAGCTGG + Intergenic
977292908 4:95182447-95182469 CTTCCACTCCACCCAGCAGCAGG + Intronic
977654430 4:99504935-99504957 CTTGGCCTCCAGCCAGGAGGTGG + Intergenic
980905339 4:138943122-138943144 CTTGTGCTCCACCTGGGAGGTGG + Intergenic
990005414 5:50939181-50939203 GTTGTCCTCCAGCCAGGAGGTGG - Intergenic
992106720 5:73454217-73454239 TTTGTACTTCACCCAGAGGCTGG + Intergenic
995186918 5:109281308-109281330 CTTGGCCTCCAGCCAGGAGGTGG - Intergenic
995524407 5:113039059-113039081 CTTTCACTCTACCCAGGAGCAGG - Intronic
1001648744 5:173300754-173300776 TTTCTACTCTACCCAGCAGCAGG + Intergenic
1004291383 6:14370482-14370504 CTTCTACTCCATCCACCAGCTGG - Intergenic
1009800200 6:68527659-68527681 TTTGGACACCACCCAGGAGGTGG + Intergenic
1014420248 6:121235176-121235198 CTTGGCCTCCAGCCAGGAGGTGG + Intronic
1018596775 6:165489115-165489137 GTTGTCCTCCAGCCAGGAGGTGG - Intronic
1018755328 6:166843438-166843460 GTTGTCCTCCAGCCAGGAGGTGG - Intronic
1019710915 7:2517914-2517936 CTTATTCTCCACGCAGCAGCTGG - Intronic
1022033774 7:26515720-26515742 CTGGGACTCCAGCCAGGAGCAGG - Intergenic
1024196695 7:47066235-47066257 CATGTTCTCCACTCAGCAGCTGG + Intergenic
1025078072 7:55960444-55960466 CTTGGACTCCATCCCAGAGCTGG - Intronic
1026425563 7:70288951-70288973 CTTTTAATCTACCCAGGACCCGG + Intronic
1026920811 7:74153989-74154011 CTTGACCTCCACCAAGGACCTGG + Intergenic
1034295643 7:149969923-149969945 CTTGAAATCCCCCAAGGAGCTGG + Intergenic
1034810418 7:154126982-154127004 CTTGAAATCCCCCAAGGAGCTGG - Intronic
1035019732 7:155793879-155793901 CTTGGCCTCCACCAAGGAGCAGG - Intergenic
1036218961 8:6904404-6904426 TGTGTACTCAGCCCAGGAGCTGG + Intergenic
1037088904 8:14888249-14888271 CTCTTACTCCACCCATGAGACGG - Intronic
1038168847 8:25110389-25110411 CTTGCACTGTACCCAAGAGCGGG - Intergenic
1038186305 8:25278139-25278161 CTGTGACTCCACCCAGGACCTGG - Intronic
1038422157 8:27440276-27440298 CTTGTTCTCCAGCCAGAAGAAGG - Exonic
1043616405 8:82130485-82130507 CTTGGCCTCCAACCAGGAGGTGG - Intergenic
1045905831 8:107343441-107343463 CTTCTACAGCTCCCAGGAGCAGG + Intronic
1046026211 8:108727261-108727283 TTTGTTCTCCACACAGCAGCTGG - Intronic
1047253917 8:123201448-123201470 CCTGTTCTCCCTCCAGGAGCTGG - Intronic
1055389452 9:75803765-75803787 CTTGTATTTCCCCTAGGAGCAGG + Intergenic
1057443201 9:95096608-95096630 CTTGGACTCCACCTAGAGGCTGG - Intergenic
1058233642 9:102461935-102461957 CTTGGCCTCCAGCCAGGAGGTGG - Intergenic
1060839223 9:126781236-126781258 CTTCCACTCCTGCCAGGAGCTGG + Intergenic
1061630994 9:131872114-131872136 CTGGTCCACCAGCCAGGAGCTGG - Intronic
1062150626 9:135016998-135017020 CTTGGGCTCCATCCACGAGCAGG - Intergenic
1062483850 9:136764574-136764596 CATCTGCTCCGCCCAGGAGCAGG - Intronic
1062525744 9:136977445-136977467 CTTGGCCTCCACCCAGGGCCCGG - Intergenic
1187678785 X:21745014-21745036 GTTGTACTCCCTTCAGGAGCAGG + Intronic
1187863555 X:23703779-23703801 CGTGTCCTCCACACAGGAGGAGG - Exonic
1188389314 X:29600495-29600517 GTTGGCCTCCAGCCAGGAGCTGG + Intronic
1188709055 X:33371634-33371656 GTTGGCCTCCACCCAGGAGGTGG + Intergenic
1189446858 X:41087613-41087635 CTTTCACTCCACCCAAAAGCTGG - Intronic
1189946039 X:46180084-46180106 CTTGGCCTCCAGCCAGGAGGTGG + Intergenic
1190109115 X:47578634-47578656 CCTCTACCCCATCCAGGAGCGGG - Intronic
1191210160 X:57876179-57876201 CTTGACCTCCAGCCAGGAGGTGG - Intergenic
1192852967 X:74977340-74977362 CTTGGCCTCCAGCCAGGAGGTGG + Intergenic
1194103566 X:89738443-89738465 GTTGGACTCCAGCCAGGAGGTGG + Intergenic
1195419825 X:104662180-104662202 ATTGTACACCACCCAAAAGCAGG - Intronic
1197557189 X:127970353-127970375 CTTGAACCCAACCCAGGAGGCGG - Intergenic
1198696039 X:139339359-139339381 CTTGGACTCCAGCCAGGAGGTGG + Intergenic
1200091366 X:153637626-153637648 CTTGAACTCCACCCTGGTGGGGG + Intergenic
1200253186 X:154564583-154564605 CTGGAGCCCCACCCAGGAGCTGG + Exonic
1200264581 X:154639832-154639854 CTGGAGCCCCACCCAGGAGCTGG - Intergenic