ID: 969319760

View in Genome Browser
Species Human (GRCh38)
Location 4:6404632-6404654
Sequence TCTGAGTTGCAGAGGGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 224}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969319754_969319760 5 Left 969319754 4:6404604-6404626 CCTGTAGGAAATTATGGGCCCTG 0: 1
1: 0
2: 0
3: 6
4: 104
Right 969319760 4:6404632-6404654 TCTGAGTTGCAGAGGGATGCTGG 0: 1
1: 0
2: 0
3: 14
4: 224
969319750_969319760 14 Left 969319750 4:6404595-6404617 CCCGAGGGGCCTGTAGGAAATTA 0: 1
1: 0
2: 5
3: 29
4: 196
Right 969319760 4:6404632-6404654 TCTGAGTTGCAGAGGGATGCTGG 0: 1
1: 0
2: 0
3: 14
4: 224
969319751_969319760 13 Left 969319751 4:6404596-6404618 CCGAGGGGCCTGTAGGAAATTAT 0: 1
1: 0
2: 1
3: 9
4: 130
Right 969319760 4:6404632-6404654 TCTGAGTTGCAGAGGGATGCTGG 0: 1
1: 0
2: 0
3: 14
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969319760 Original CRISPR TCTGAGTTGCAGAGGGATGC TGG Intronic
900790738 1:4678559-4678581 TCTCATTTGGAGAGGGCTGCAGG - Intronic
900835917 1:5003867-5003889 TCTCATTTGGAGAGGGCTGCAGG - Intergenic
904602847 1:31683359-31683381 TCTGACTTGCAGGGGGAGCCTGG - Exonic
905043387 1:34977843-34977865 TCTGGGTGGCACAGGGATGGGGG - Intergenic
905351660 1:37350911-37350933 AATGAGTTACAGAGGAATGCTGG - Intergenic
905646887 1:39631126-39631148 TCTGTAGTGCAGAGGGATGAGGG + Intronic
906050705 1:42869001-42869023 TCTTAGTTCCAGAGGGAGGAAGG + Intergenic
906212860 1:44021819-44021841 TCTGAGGTGCATAGGGCAGCTGG - Intronic
906704584 1:47885611-47885633 TCTGGGTTGAAGCGGGAGGCAGG + Intronic
907241787 1:53085053-53085075 TGTGAGTTCCAGAGGGTGGCAGG - Exonic
912391812 1:109308161-109308183 TTTAAAATGCAGAGGGATGCTGG - Intergenic
912470125 1:109901116-109901138 TGTGAGTGGCAGAGGGTTGGAGG - Intergenic
912579387 1:110706380-110706402 TATGAGTTGCAGAGGAACACTGG - Intergenic
912608910 1:111022714-111022736 TCTGTGTTCCTGAGGGATGTTGG - Intergenic
916202727 1:162287458-162287480 TCTGAGGTGAAGAGGAAAGCAGG + Intronic
916435143 1:164771083-164771105 TCTGAGTTGAAGATGTAGGCAGG - Intronic
916452518 1:164934606-164934628 TCTGAGTTGGAGAGGAAAGGAGG + Intergenic
916831028 1:168491273-168491295 TCTAAGTTGAAAAGGGATGTGGG - Intergenic
922464983 1:225840314-225840336 ACTGAGAAGCAGAGGGATGGAGG + Intronic
923413739 1:233734531-233734553 TCTGACCTGCACAAGGATGCAGG - Intergenic
923481694 1:234391082-234391104 TCTGAGCCTCACAGGGATGCTGG + Intergenic
1065493983 10:26310514-26310536 TCTGTGTTGCAGAGAGTTGTTGG - Intergenic
1066629033 10:37440475-37440497 TCTGAGAACCAGAGGGATGATGG + Intergenic
1067552938 10:47247848-47247870 CCTGAGGGGCAGAGGGAGGCAGG + Intergenic
1069753650 10:70760667-70760689 TCTCAGGGGCAAAGGGATGCTGG - Exonic
1070827483 10:79399633-79399655 TCTGACTTCCAGAGTGAGGCTGG + Intronic
1071086498 10:81874020-81874042 CCTGAGTTCCTGAGAGATGCAGG - Intergenic
1073036069 10:100565021-100565043 GCTGAGTTCCAGAGGGAAGGGGG + Intergenic
1073060245 10:100729609-100729631 TCTGAGTCGCAGTGGGAAGGCGG + Intergenic
1073533640 10:104255074-104255096 TCGGAGCTGCAGTGGGACGCGGG + Intronic
1073995660 10:109313196-109313218 TCTTAGTTCCAGAGGGAAGAAGG - Intergenic
1076520154 10:131076293-131076315 ACTGGGGTGCAGAGGGATGGAGG - Intergenic
1077512464 11:2975730-2975752 TCTGAGTTGGAGAGGACAGCTGG - Intronic
1079270851 11:18984377-18984399 TAAGAGTTGCAGAAGGATGAAGG - Intergenic
1081737786 11:45416349-45416371 ACTGAGTTGGAGAAGGATGTAGG - Intergenic
1081793469 11:45804734-45804756 TCGGATTGGCAGAGGGACGCGGG + Exonic
1084973685 11:72784959-72784981 TCTGACTTGCTGTGTGATGCAGG - Intronic
1087766618 11:102162298-102162320 TGTCTGTTGCAGAGGGAGGCTGG + Intronic
1090097456 11:123756929-123756951 TGTGAGATGCAGAGGGAGGTGGG + Intergenic
1090357523 11:126149996-126150018 CCTGAGTTGCCAAGGGCTGCAGG - Intergenic
1090400860 11:126447419-126447441 TCTGAGATGCAGGGTGATGGAGG + Intronic
1090425707 11:126605720-126605742 CCTGAGTTGAGTAGGGATGCTGG + Intronic
1093194967 12:16120028-16120050 TATGCTTTGCAGAGGGGTGCGGG + Intergenic
1094442716 12:30497156-30497178 TCTCTGTTACTGAGGGATGCTGG - Intergenic
1096370326 12:51063957-51063979 TCTGATTTACAGAGGGCAGCTGG + Exonic
1096626582 12:52899596-52899618 TCTGAGAAGCAAAGGGATGCAGG - Intronic
1097178889 12:57159708-57159730 TCTGGGCTACAGAGGGGTGCAGG - Intronic
1097894361 12:64809727-64809749 TCACAGATGCAGAGGGAAGCTGG - Intronic
1098441859 12:70527705-70527727 TTTGAGATACAAAGGGATGCAGG - Intronic
1099573594 12:84356237-84356259 ACTCAGTTCCTGAGGGATGCAGG + Intergenic
1100131529 12:91499756-91499778 TATGAGTTTCCCAGGGATGCTGG - Intergenic
1102344326 12:112149527-112149549 TCTGATTTGTGCAGGGATGCGGG - Intronic
1102383375 12:112486159-112486181 GCTGAGTGCCACAGGGATGCAGG + Intronic
1102795071 12:115682105-115682127 TCTGAGACCCAGAGGGATGAAGG - Intergenic
1103728457 12:123010782-123010804 TCTGAGGCTGAGAGGGATGCAGG + Intronic
1104403874 12:128501388-128501410 TCTGAGTCACATAGGGATGCAGG - Intronic
1104871850 12:132005060-132005082 GCTCAGCTGCAGAGGGTTGCGGG - Exonic
1106286742 13:28324505-28324527 CCGGGGTTGCAGAGGGAGGCAGG + Intronic
1109068692 13:57735384-57735406 TCTCAGCTGCAGGGAGATGCTGG - Intergenic
1114064686 14:19051174-19051196 ACTGAGTACCAGAGGGATGTAGG - Intergenic
1114097575 14:19348828-19348850 ACTGAGTACCAGAGGGATGTAGG + Intergenic
1119377898 14:74209367-74209389 CCTGGGTTGCAGAGGGGTCCTGG - Intergenic
1121774368 14:96580859-96580881 GCTGGGTTCCAGAGGGATGCAGG - Intergenic
1123931876 15:25175869-25175891 GGTGACTTCCAGAGGGATGCAGG - Intergenic
1124372410 15:29111181-29111203 TCTGAGTTCCGGAGTGATGGAGG + Intronic
1126765148 15:52004149-52004171 TCTGAGTCACAGAGGGAGGAGGG + Intronic
1127728007 15:61769849-61769871 CCTGATGTGCAGAGGGATTCAGG - Intergenic
1127921980 15:63501598-63501620 CCTCAGTGCCAGAGGGATGCGGG + Intergenic
1132415390 15:101615365-101615387 CCTGAGTAGAAGAGGGAGGCTGG + Intergenic
1132676109 16:1121885-1121907 TGTGAGGGGCACAGGGATGCTGG + Intergenic
1132730128 16:1356970-1356992 TCTGAGTGGCAGATGGGTGAGGG + Intronic
1133206084 16:4234501-4234523 TCAGGGCTGCAGAGGGATGAGGG + Intronic
1134222023 16:12362521-12362543 ACTGAGTTGCAGAAGGATTTTGG + Intronic
1134833860 16:17345419-17345441 TCTCTGTGGCACAGGGATGCAGG + Intronic
1137850644 16:51738602-51738624 TCTGAGTAGAAGAGGGAGACTGG - Intergenic
1137955589 16:52825685-52825707 AATGAGTTGCAGAGGGAGGCAGG - Intergenic
1139877510 16:70157944-70157966 GCTGAGTTCCAGAGAGCTGCCGG + Exonic
1142314678 16:89336165-89336187 TCTGAGCTCCAGAGGTATCCTGG - Intronic
1146967572 17:37045929-37045951 TCTGATTTGCAGAGGCAGGAAGG + Intronic
1147659214 17:42108229-42108251 TGTGAGCTCCAGAGGGAGGCCGG + Intronic
1147947230 17:44086904-44086926 TCTGAGATGGGGAGGGATGGGGG + Intronic
1148489173 17:48012312-48012334 TCTGCTTTGCACAGGGCTGCTGG - Intergenic
1150161373 17:62901017-62901039 TCTGAGGTGCAGCAGGAAGCAGG - Intergenic
1152012413 17:77726709-77726731 TTTGAGGTGCAGAGTGAAGCTGG - Intergenic
1153322298 18:3785283-3785305 GCTGAGTTGCTTACGGATGCTGG + Intronic
1153416037 18:4846651-4846673 GCTGAGTTGCAGAAGGAAGCAGG - Intergenic
1153597359 18:6741371-6741393 GCTGAGTTGCAGAAAGCTGCAGG + Intronic
1155437294 18:25826567-25826589 TCTGAGCTGCAGAGGACAGCTGG - Intergenic
1155562725 18:27096931-27096953 TTTCAGTATCAGAGGGATGCTGG - Intronic
1156144616 18:34159883-34159905 TCTCAGCGGGAGAGGGATGCGGG + Intronic
1158823686 18:61190175-61190197 TCTATGTTGCAGGGGGATGGGGG + Intergenic
1160569491 18:79807148-79807170 CCTGAGGTGCAGACAGATGCAGG - Intergenic
1164759295 19:30716824-30716846 GATGATTTGCTGAGGGATGCAGG + Intergenic
1164922295 19:32097537-32097559 TCTGGGATGCAGAGGGCTGGGGG - Intergenic
1165068883 19:33243837-33243859 GCTGAGCAGCAGAGGGGTGCTGG - Intergenic
1165613363 19:37176604-37176626 TCTGAGTCACAGAGGAATGAAGG - Intronic
1166503876 19:43359610-43359632 TGTGAGTGGCAGAGGTAGGCTGG - Intronic
1166506578 19:43375148-43375170 TGTGAGTGGCAGAGGTAGGCTGG + Intergenic
925036565 2:691976-691998 ACTGAGCTGGAGAGAGATGCGGG - Intergenic
925122708 2:1431885-1431907 TCTAACTTGCAGAGGGAAGGAGG + Intronic
926652954 2:15366579-15366601 GCTGAGCTGCTGAGGGTTGCAGG - Exonic
927178026 2:20424050-20424072 ACTGACTTGCAGAGAGATGCAGG + Intergenic
927482085 2:23462081-23462103 TCTCAGCTGCTGAGGGAGGCAGG + Intronic
928365257 2:30695615-30695637 GCTGAGTTACAGACAGATGCTGG + Intergenic
928387458 2:30882688-30882710 TCTGAGTTGCAGAGGGGCAAGGG - Intergenic
929526377 2:42706995-42707017 CCTGGGTTACAGAGGGAAGCGGG - Intronic
932595799 2:73092846-73092868 ACTGGGTTGCAGAGGGAGGTGGG - Intronic
933614665 2:84471423-84471445 TAGGAGTTGCAGAAGGATGAAGG + Intergenic
934046948 2:88180137-88180159 TCTGGGCTGCAGAGGGCGGCTGG - Intronic
936069178 2:109353902-109353924 TCTGAACTCCAGAGGGAGGCAGG - Intronic
936111050 2:109665203-109665225 TTTGAGATGCAGAATGATGCTGG + Intergenic
937901235 2:127020728-127020750 TCTCCATTGCAGAGAGATGCTGG - Intergenic
938481966 2:131670206-131670228 ACTGAGTACCAGAGGGATGTAGG - Intergenic
939130433 2:138229416-138229438 TCTTAGTTGCAGAGGAATCAGGG + Intergenic
940388804 2:153106726-153106748 TATGACTTGCAAATGGATGCTGG + Intergenic
940763981 2:157769893-157769915 CCAGATTTGCAGAGGGATTCAGG - Intronic
946339674 2:219059409-219059431 GCTGAGATGCCGAGGGAGGCAGG - Intronic
946416270 2:219541543-219541565 TCTGAGAGGCAAAGGGATGTTGG - Intronic
948116244 2:235495606-235495628 CCTGACATGCAGAGGGAAGCGGG - Intronic
948611766 2:239173792-239173814 TCTGAGTTTAACAGGGTTGCTGG + Intronic
1170962746 20:21039779-21039801 TCTGAGTTCCAGATGGACACAGG + Intergenic
1171041814 20:21771105-21771127 TCTGAGTTGGAAAGAGAAGCTGG + Intergenic
1171195937 20:23199421-23199443 TCTGGGTCACAGAAGGATGCTGG + Intergenic
1171484334 20:25476580-25476602 TCTGAGGGGCCGTGGGATGCCGG + Exonic
1173189089 20:40862657-40862679 TCTGTGTTGCACATGGGTGCTGG + Intergenic
1176074716 20:63243227-63243249 GCAGAGTGGCTGAGGGATGCTGG + Intronic
1176613802 21:9011120-9011142 GGTGAGTTGCAGAGGGAGACTGG - Intergenic
1176711390 21:10152769-10152791 TGTGAGTTGCAGAGGGAGACTGG + Intergenic
1177242452 21:18477060-18477082 TCTGACTTGCAGAGTAATGAGGG + Intronic
1179050415 21:37884394-37884416 GCTGAGATGCAGAGAGAAGCTGG - Intronic
1179600531 21:42474654-42474676 TCTGACTTGCACAGGGAGGGTGG - Intronic
1180098603 21:45573860-45573882 GCTGAGTTCCAGAGAAATGCAGG - Intergenic
1180483174 22:15773796-15773818 ACTGAGTACCAGAGGGATGTAGG - Intergenic
1181465730 22:23109672-23109694 TCTGAGATGCTGAGGGAGACAGG - Intronic
1183010236 22:34940307-34940329 TCTGAATAGCTGAGTGATGCTGG - Intergenic
1184021318 22:41823658-41823680 TCTGAGTTGCTGGGAGAGGCTGG - Intronic
1184629268 22:45763170-45763192 TCTCAGTTGGGGAGGGCTGCCGG + Intronic
950573830 3:13818907-13818929 TCTGACTTGCAGCGGGAGGGTGG + Exonic
950970064 3:17177423-17177445 TCTGAATTTCAGAGGATTGCAGG + Intronic
954780599 3:53056655-53056677 TCTGGGCAGCAGAGGGATTCAGG - Intronic
961965767 3:130901244-130901266 TCTGGGGTGGGGAGGGATGCTGG - Intronic
963767519 3:149352956-149352978 TCTGAGTTGCAGAGTTGTGTTGG - Intergenic
964851079 3:161096889-161096911 TCAGAGTTTCAGAGGGTGGCAGG + Intronic
967711256 3:192710993-192711015 TCTTAGTTGTAGAGTGATGTTGG - Intronic
968343782 3:197982659-197982681 TATGAATTGCAGAGGGAGACAGG + Intronic
969284620 4:6195102-6195124 CCTGAGTTGCAGAGGGTTCAGGG + Intronic
969319760 4:6404632-6404654 TCTGAGTTGCAGAGGGATGCTGG + Intronic
969352110 4:6603963-6603985 TCTGATTTGGAGAGGGAGGCTGG - Intronic
970510602 4:16777979-16778001 CCTGAGGTGGAGAGGGATGGGGG - Intronic
970861189 4:20704585-20704607 TCTGTGCTACAGATGGATGCAGG + Intronic
971424507 4:26502832-26502854 TCTGAGTTCTAGAGAGATGAGGG + Intergenic
978823995 4:112999150-112999172 TCTGTATTGCAGAGGGAAACTGG - Intronic
980661246 4:135861753-135861775 TCTAATTTGCAGTGGTATGCAGG + Intergenic
980984606 4:139683384-139683406 TCTGAGATGGAGAAGGCTGCAGG + Intronic
982224856 4:153155987-153156009 TCTGATTTGCCAAGGGAAGCTGG + Intronic
985553282 5:543857-543879 TCTGAGCCACTGAGGGATGCAGG - Intergenic
985689452 5:1299072-1299094 TCTGTGTTCCAGAGGGAGGGGGG + Intergenic
986181621 5:5398392-5398414 TCTGAGTTCCACAGGGCAGCAGG - Intergenic
986214470 5:5706443-5706465 TCTGTGTTGGAGAGGGGGGCTGG + Intergenic
986726867 5:10604981-10605003 CGTGAGTTGCAGTGGGATGCTGG + Intronic
987876810 5:23690479-23690501 TCGGGGTTGCAGAAGGATGAGGG - Intergenic
988092642 5:26562857-26562879 TCTTAGTTCCAGAGGGAGGAAGG + Intergenic
988267538 5:28971783-28971805 TCTTAGTTCCAGAGGGAGGAAGG - Intergenic
989214289 5:38888158-38888180 TCTGATTTGCATAGGGCTGAGGG + Intronic
990262646 5:54041817-54041839 TCTGAGTTGCAGAGAAAAGGCGG + Intronic
992278068 5:75141683-75141705 TCCCAGTTACTGAGGGATGCTGG + Intronic
993487469 5:88504240-88504262 CCTAAGTTGTAGAGAGATGCAGG - Intergenic
993800561 5:92329299-92329321 TCTCAGTTGCAAATGGAGGCAGG + Intergenic
996821325 5:127631902-127631924 TCAGAGTTGCAGGGTGCTGCTGG - Intergenic
997419516 5:133755031-133755053 TCTGGCTTGCAGGGGGATGGAGG - Intergenic
997442133 5:133916252-133916274 GCTGAGATGCATAGGGATGAGGG + Intergenic
997596613 5:135111433-135111455 TCTGAGTCACAGAGGGGTGTGGG - Intronic
998159998 5:139808079-139808101 TCTGCTCTGGAGAGGGATGCTGG - Intronic
998406324 5:141876601-141876623 TCTGACTTACAGAGGGTAGCTGG + Intronic
999509269 5:152230911-152230933 ATTGAGTGGAAGAGGGATGCAGG + Intergenic
1001747550 5:174103388-174103410 TCTGAGATGAAGAAGAATGCAGG + Intronic
1003751928 6:9068640-9068662 TGTGAGATGCAGGGGGATGATGG - Intergenic
1003758827 6:9151652-9151674 TCTTAGTTCCAGAGGGAGGAAGG + Intergenic
1004125245 6:12866692-12866714 TTTTATTTGCAGAGGGAAGCTGG - Intronic
1004248145 6:14000217-14000239 TCAGAGTCCCTGAGGGATGCAGG + Intergenic
1007425689 6:41744535-41744557 TGTTAGTTCCAGAGGGATCCAGG + Intronic
1008139355 6:47814073-47814095 ATTGAGTTGCAGAGTGAAGCAGG + Intronic
1008979097 6:57463092-57463114 TCTAAGTGGCAGAGGGGTGGTGG + Intronic
1009167233 6:60356084-60356106 TCTAAGTGGCAGAGGGGTGGTGG + Intergenic
1011918056 6:92534800-92534822 TCTGAGTGGAAGAGTCATGCTGG - Intergenic
1014404448 6:121032439-121032461 TGTAAGTTGCAGAGAAATGCTGG - Intergenic
1015195151 6:130517639-130517661 TTTGGTTTGCAGGGGGATGCTGG - Intergenic
1015429062 6:133108894-133108916 TCTGAACTGCAGAGTGTTGCTGG - Intergenic
1016531566 6:145064136-145064158 TCTGTGTTTCAGAGGGTTTCTGG - Intergenic
1017561804 6:155636293-155636315 TCAGAGTGCCAGAGGGAGGCAGG + Intergenic
1019324606 7:432041-432063 GCGGAGTTGAAAAGGGATGCAGG + Intergenic
1019988865 7:4678670-4678692 GCAGAGAAGCAGAGGGATGCAGG - Intergenic
1022434761 7:30372308-30372330 TCAGAGCTGGAGGGGGATGCTGG + Intronic
1024052123 7:45631806-45631828 TCTGAGATGCAGAGATATGCAGG - Intronic
1025754342 7:64321729-64321751 TCTGAGTTCAAGAGGGATGTTGG + Intronic
1027052468 7:75028812-75028834 TCTGAGCTGGAGAGGCTTGCAGG + Intronic
1030884306 7:114919917-114919939 CCTGAGTTACCTAGGGATGCAGG + Intergenic
1033872470 7:145772090-145772112 TCAGAGTTGCTGAGGGTTGAGGG + Intergenic
1038292268 8:26260501-26260523 TCTCAGGACCAGAGGGATGCAGG - Intergenic
1038292460 8:26262146-26262168 TCTCAGCGCCAGAGGGATGCAGG + Intergenic
1039474660 8:37833361-37833383 TCTGAATAGCAGAGGGCGGCTGG - Intronic
1041143132 8:54843798-54843820 GCTCAGGTGCAGAGGGAAGCAGG + Intergenic
1042441172 8:68828520-68828542 TCAGAGTTGCAAAGTGGTGCTGG + Intergenic
1043924524 8:86021949-86021971 TCTAAGTTCCAAAGGGATGAGGG + Intronic
1044901539 8:96950925-96950947 TCTGGGTTTCAGAGGCAAGCAGG - Intronic
1045795280 8:106036704-106036726 TCTGAGTTGCAGCCTGAGGCAGG + Intergenic
1047994991 8:130326098-130326120 TCTAAGTAGTAGAGGGTTGCTGG + Intronic
1048262012 8:132953188-132953210 TGTGAGTTGCAGAGGGGAGCTGG + Intronic
1048650976 8:136477381-136477403 TATGAGTAGCAGAGGGATGAAGG - Intergenic
1049545669 8:143229476-143229498 TCTGTGTGGAAGAGGGAGGCAGG - Intergenic
1049805731 8:144537969-144537991 TGTGAGTGGCAGAGAGGTGCCGG + Intronic
1050277708 9:4017216-4017238 TCTTAGGTGAAGAGAGATGCTGG + Intronic
1051599904 9:18862302-18862324 CCTGAGTTCCTGAGGCATGCTGG + Intronic
1052372420 9:27680451-27680473 TCTGAGTGGCAGAGACATGACGG + Intergenic
1053648378 9:40138460-40138482 GGTGAGTTGCAGAGGGAGACTGG + Intergenic
1053757360 9:41325381-41325403 GGTGAGTTGCAGAGGGAGACTGG - Intergenic
1054329356 9:63736403-63736425 GGTGAGTTGCAGAGGGAGACTGG + Intergenic
1054536202 9:66237710-66237732 GGTGAGTTGCAGAGGGAGACTGG - Intergenic
1057408207 9:94792816-94792838 TCACAATTGCAGTGGGATGCTGG + Exonic
1057890900 9:98869065-98869087 TCTGTGGTGCTGAGGGATGGAGG + Intergenic
1058354424 9:104066071-104066093 GCTGAGGTGCAGAAGGATGAAGG - Intergenic
1060398384 9:123332526-123332548 TCTGAGTTCCAGTGGTGTGCTGG + Intergenic
1060771858 9:126337746-126337768 TTTGAGATACAGATGGATGCTGG + Intronic
1061011271 9:127956024-127956046 TCTTGGTTGCAGAGGGTTGTTGG - Intronic
1202796143 9_KI270719v1_random:121758-121780 TGTGAGTTGCAGAGGGAGACTGG + Intergenic
1186437264 X:9553226-9553248 TCTGAGTGGAATAGGGAAGCTGG + Intronic
1190321821 X:49184306-49184328 TCTGAGTCTAAGAGGGGTGCTGG + Intronic
1190359487 X:49635556-49635578 TCTGAATTGCAGTGGGGTGGAGG + Intergenic
1191629811 X:63311026-63311048 TCTTAGTTCCAGAGGGAGGAAGG - Intergenic
1192836482 X:74804883-74804905 CCTGTGTTGCAGAGGCTTGCTGG + Intronic
1195920095 X:109975050-109975072 TCTGAGATCCAGAGAGAAGCTGG - Intergenic
1198000730 X:132433162-132433184 TCTGAGGTGCAGATGGGTCCTGG + Intronic
1200059494 X:153477941-153477963 TGTGAGATCCAGAGGGGTGCAGG - Intronic
1200842881 Y:7801644-7801666 TCTGCTTTCCAGAGGGATTCTGG + Intergenic
1202092243 Y:21205023-21205045 TCTGCGTTGAAAAGGGATGAGGG - Intergenic
1202275733 Y:23117733-23117755 TTGCAGTTGCAGAGGGATGGGGG + Intergenic
1202290295 Y:23302958-23302980 TTGCAGTTGCAGAGGGATGGGGG - Intergenic
1202428725 Y:24751452-24751474 TTGCAGTTGCAGAGGGATGGGGG + Intergenic
1202442066 Y:24918637-24918659 TTGCAGTTGCAGAGGGATGGGGG - Intergenic