ID: 969320706

View in Genome Browser
Species Human (GRCh38)
Location 4:6410727-6410749
Sequence TGAGAAAGGGTGACCTGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 301}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969320706 Original CRISPR TGAGAAAGGGTGACCTGGCC AGG (reversed) Intronic
900361198 1:2289873-2289895 AGGGAAGGGGTGGCCTGGCCAGG + Intronic
900746192 1:4362259-4362281 TGAGAAAGGGCACCCTGGACAGG + Intergenic
901301430 1:8202380-8202402 TGTGCAAAGGTGACCTCGCCTGG - Intergenic
901540443 1:9911716-9911738 TGAAAAAGTGTGAGCAGGCCGGG - Intergenic
902452844 1:16509011-16509033 TGAGACAGGGTCACCTAGACTGG + Intergenic
902741412 1:18441126-18441148 TGAGGAAGGGTGGCCTAGTCAGG + Intergenic
903979612 1:27176458-27176480 TGGAAAAGTGAGACCTGGCCAGG + Intergenic
904259495 1:29280218-29280240 AGGAAAAGGGTGAGCTGGCCTGG - Intronic
904723207 1:32526683-32526705 AGAAAAAGGGTAAGCTGGCCAGG + Intronic
906315806 1:44785753-44785775 TGAGAAAGAGCCTCCTGGCCAGG - Intronic
906989395 1:50721917-50721939 GCAGAAAAGGAGACCTGGCCAGG - Intronic
907046678 1:51303818-51303840 TGAGGCAGTGTGGCCTGGCCAGG - Intronic
907923159 1:58931709-58931731 TAAGAAGGGGTGACATGGTCAGG - Intergenic
908153432 1:61328360-61328382 TTAGAAAGGGTGGCCAGGGCAGG - Intronic
910998479 1:93135265-93135287 AGAGAAAAGTTGTCCTGGCCAGG - Intronic
911190451 1:94943432-94943454 CCAGAGAGGGTGACCTGCCCAGG + Intergenic
912132726 1:106621541-106621563 GGAGAAAGGGTGACATAGTCTGG - Intergenic
914358787 1:146911796-146911818 TGAAAATGGGTGATGTGGCCGGG - Intergenic
914904271 1:151731188-151731210 TTAGAAAGGGTTTGCTGGCCAGG + Intergenic
915074576 1:153297838-153297860 TGAGAAAGGATGGGCTGGCAGGG + Intergenic
915532321 1:156509840-156509862 TGTGAAAGGGAGAGCTGGGCTGG - Intergenic
916735263 1:167601838-167601860 TGAAACAGGCTGACCTGGGCAGG + Intergenic
918004168 1:180526233-180526255 TCAGAGATGGTAACCTGGCCAGG + Intergenic
918716371 1:187791907-187791929 TTAAAAACGGTGATCTGGCCGGG - Intergenic
919903099 1:202058339-202058361 TGAGACAGGGTGGCCCAGCCTGG - Intergenic
919939288 1:202275376-202275398 TGATAAAGGCTGTCGTGGCCTGG + Intronic
920189992 1:204187594-204187616 TGAGAAGAGGAGACCTGCCCTGG + Intergenic
920540185 1:206772356-206772378 TCAGACTGGGTGCCCTGGCCTGG + Exonic
920740798 1:208579533-208579555 TGAGAAGGCCTGCCCTGGCCTGG - Intergenic
921955179 1:220975190-220975212 TGAGTTAGTGTGTCCTGGCCTGG + Intergenic
922491542 1:226020993-226021015 TTTGAAAGGGTGACATGGGCCGG + Intergenic
922719222 1:227891822-227891844 TGAGAGAGGGCCACCTGGCAAGG + Intergenic
923129742 1:231065080-231065102 TGAAAAAGGCTGACATGACCTGG - Intergenic
924594570 1:245434364-245434386 TCAGAAAGTCTGACCTGGCCAGG + Intronic
924641742 1:245839463-245839485 TTAGAAAGGCTGGCCTGGGCTGG - Intronic
1063416329 10:5875512-5875534 TTAGATAGGGTGGCCTGGGCAGG + Intronic
1065252278 10:23827858-23827880 TCAGAAAGGGTGACTTCCCCTGG + Intronic
1065557667 10:26932505-26932527 TGAGAAAAGGTAAACTGTCCGGG - Intergenic
1066986995 10:42476308-42476330 TGAGAAAGGGAGCCCTGATCAGG + Intergenic
1067192301 10:44081858-44081880 TAAAAAAGCATGACCTGGCCGGG + Intergenic
1067391428 10:45866489-45866511 TGAGACAGGGTCACCTAGGCTGG + Intergenic
1067871863 10:49969662-49969684 TGAGACAGGGTCACCTAGGCTGG - Intronic
1068632209 10:59309628-59309650 TAAGAAAGGGAGACCTGACTGGG - Intronic
1069460331 10:68589095-68589117 TGAGAAAGGGTCTTCTGCCCAGG - Intronic
1069729148 10:70599986-70600008 TGAGGAAGGATGACCCGGCCAGG + Intronic
1070571023 10:77639042-77639064 TGATCAAGGACGACCTGGCCTGG + Intergenic
1071562273 10:86653582-86653604 TGTGAAAGGGTGACCAGCCTTGG + Intergenic
1071612774 10:87046683-87046705 TAAGAAATAGTGACCAGGCCAGG - Intergenic
1074156615 10:110805648-110805670 TGACCCAGGGTGACCTAGCCAGG + Intronic
1074424068 10:113335748-113335770 TGACAAAGGCTGACCTTGGCTGG + Intergenic
1076235585 10:128861544-128861566 TGGGACAGGATGACCAGGCCAGG + Intergenic
1077041211 11:524334-524356 AGAGAAAGGAAGATCTGGCCGGG + Intergenic
1077337086 11:2010213-2010235 TGAGAAAGGGCTATCTGACCAGG + Intergenic
1077337107 11:2010345-2010367 AGAGAAAGGAGGACGTGGCCTGG + Intergenic
1078211931 11:9276806-9276828 TAAGAAAGAGGCACCTGGCCAGG + Intergenic
1080340249 11:31254713-31254735 TGAGCTAGGGTGACCTTGGCTGG + Intronic
1080898663 11:36467131-36467153 GGAGACTGGGTGACATGGCCTGG + Intergenic
1081292942 11:41349118-41349140 TGAGAATGTGTGACCAGGCAGGG - Intronic
1081539272 11:44018222-44018244 TGAGAGAGGGTGAGCTTCCCAGG + Intergenic
1081650653 11:44821942-44821964 GGAGGAAGGGTGACCTTGGCTGG + Intronic
1082011790 11:47454744-47454766 TAAGAATGGGAGTCCTGGCCAGG - Intergenic
1083655592 11:64227668-64227690 TGAGTGAGGTTGACCTGGACAGG + Intronic
1083966542 11:66047161-66047183 AGAGAAGGGCTGGCCTGGCCTGG + Intronic
1084161523 11:67353007-67353029 TGAGGCAGTTTGACCTGGCCTGG - Exonic
1084431023 11:69111328-69111350 TGAGCCAGAGTGACCTGGTCGGG + Intergenic
1087831812 11:102826757-102826779 ATAGCAAGAGTGACCTGGCCAGG + Intergenic
1089157534 11:116413927-116413949 TGAGGGAGGGGAACCTGGCCTGG - Intergenic
1089381970 11:118039753-118039775 TGAGAAACAATAACCTGGCCAGG + Intergenic
1089616886 11:119699847-119699869 AGAGAAAGGGTGAGCTGGTGGGG - Intronic
1089753532 11:120669016-120669038 TGAGGAAGGGTGATCCGGGCAGG - Intronic
1090765398 11:129871808-129871830 TGAGCAAGGGTGACTTGATCTGG - Intronic
1091161374 11:133424186-133424208 TCAGAAAGGGAGACTTGGCTGGG - Intronic
1202820070 11_KI270721v1_random:65395-65417 TGAGAAAGGGCTATCTGACCAGG + Intergenic
1202820091 11_KI270721v1_random:65527-65549 AGAGAAAGGAGGACGTGGCCTGG + Intergenic
1091593722 12:1860755-1860777 TGTGAAAGGGTCCCGTGGCCCGG - Intronic
1092192747 12:6532890-6532912 TGAGAAAGGGTTAACGGTCCTGG + Intergenic
1094830149 12:34296436-34296458 TGAGAAGGGGGGGCCTGGCCTGG + Intergenic
1097196984 12:57248262-57248284 TGAGAAAGGGTGAGCACTCCTGG - Intronic
1099207918 12:79749158-79749180 AGAGGAAGGGAGACCTGGGCTGG + Intergenic
1100125584 12:91420895-91420917 AGAGAAAGGGTGGCCAGGCGTGG + Intergenic
1100944031 12:99758850-99758872 TGAGAAAGGGGCACCAGGCTAGG + Intronic
1102250429 12:111383228-111383250 TGAGAACAGGAGAGCTGGCCGGG + Intergenic
1102765814 12:115431992-115432014 TGAGCAGGGGTGATCTGACCTGG - Intergenic
1103555048 12:121761272-121761294 TAAGAACGGGAGACTTGGCCAGG - Intronic
1105507215 13:21020656-21020678 GGAGAGAGGCAGACCTGGCCTGG - Intronic
1105544937 13:21344388-21344410 TCAAGAAGGGTGACTTGGCCGGG - Intergenic
1107175388 13:37393802-37393824 TAAGAAAGGCTGCCTTGGCCAGG - Intergenic
1107662548 13:42654021-42654043 TGACAACGTGAGACCTGGCCTGG + Intergenic
1107815074 13:44237456-44237478 TGAGACAGGCTGTCCTGCCCAGG + Intergenic
1109250978 13:60020658-60020680 TAATAAAGGCTGACTTGGCCAGG - Intronic
1110000260 13:70188750-70188772 TGAGAAAGAATGACCTCACCAGG + Intergenic
1110299844 13:73913600-73913622 TGAGAAAGGGAGAACTGGACTGG + Intronic
1111163928 13:84432665-84432687 GGAGAAAGGCTGGCCTGGCATGG + Intergenic
1111175098 13:84584392-84584414 TTAGAAAGGGTGGTCTGGGCAGG + Intergenic
1112099330 13:96169721-96169743 TAAGAAGGGTTGACATGGCCTGG + Intronic
1113804091 13:113103601-113103623 GGAGAGAGGGAGGCCTGGCCTGG + Intergenic
1114620429 14:24093381-24093403 AGAGAAAGAATGACCAGGCCGGG + Intronic
1115056709 14:29136651-29136673 TCTGAAAGGCTGAACTGGCCTGG + Intergenic
1115228045 14:31125466-31125488 TAGGAAAGAGTGAACTGGCCGGG - Intronic
1118346861 14:64947277-64947299 AGAGCAAGGGAGAGCTGGCCAGG - Exonic
1120150273 14:81024540-81024562 TAAGAAAGGCATACCTGGCCAGG - Intronic
1120372355 14:83652282-83652304 TGAGAAAGGGTCACCAGTGCTGG - Intergenic
1120928195 14:89819437-89819459 TGACAAAGTGAGACCTTGCCTGG - Intronic
1121038151 14:90723673-90723695 TTAGATAGGGTGGCCTGGCCAGG - Intronic
1121255467 14:92527345-92527367 TAAGAAAGGGAGAAATGGCCAGG - Intronic
1121485442 14:94310915-94310937 TGGGAAATGGTGGCCTGGCAAGG - Intronic
1121724278 14:96135209-96135231 TGAGAGAGGGAGAGGTGGCCTGG - Intergenic
1122516038 14:102309479-102309501 TAAGAAAAGGTTTCCTGGCCAGG + Intergenic
1126587099 15:50299692-50299714 TGTTAAAGGGTTACCTGGCTGGG - Intronic
1126907677 15:53385161-53385183 TGGGGCAGGGTGACCTGGCTGGG + Intergenic
1127847231 15:62881492-62881514 TGATTAAGAGTGCCCTGGCCAGG + Intergenic
1128759175 15:70203848-70203870 TGAGAAAGGAGCACCAGGCCTGG - Intergenic
1130969187 15:88718815-88718837 TGAGAAAAGGTGACCCAGCTGGG - Intergenic
1131943222 15:97590328-97590350 TGAGCAAGGTTGACATGGTCTGG - Intergenic
1133588677 16:7220955-7220977 TGAGAAAGGGACACCTGTCCAGG + Intronic
1134231280 16:12432476-12432498 GGAGAAAAGGTGGCCTGGGCTGG + Intronic
1134429817 16:14193014-14193036 TGAGTAAAGGGGACCTGGACAGG - Intronic
1134998367 16:18756780-18756802 TCAGAAAGGGTGGCCTGGGAAGG - Intergenic
1137292409 16:47060973-47060995 TGAGGAAGTCTGACCAGGCCAGG + Intergenic
1137988001 16:53126972-53126994 TGAAAAAGTGAGACCTGGCTGGG - Intronic
1138562978 16:57813030-57813052 TGAAAAAGGAGAACCTGGCCAGG + Intronic
1139486256 16:67258252-67258274 TGAGGAAGGGCCACCTGGCCAGG + Intronic
1139703223 16:68722492-68722514 TGGGAAAGGTGGAACTGGCCAGG - Intronic
1139906943 16:70372656-70372678 TGAGAGAGAGTGATCTGGCGAGG + Exonic
1140313586 16:73872526-73872548 TAAGAAAGGATCACCTGGCCTGG - Intergenic
1140394778 16:74617265-74617287 TGAGAAAGGGTGACAGGGTAGGG - Intergenic
1142020323 16:87778247-87778269 TCAGAAATGGGGACCTGGTCAGG - Intergenic
1142813360 17:2406932-2406954 TGAGTAATGGTGACCTACCCAGG - Intronic
1144180312 17:12745502-12745524 ATTTAAAGGGTGACCTGGCCAGG - Intronic
1144675080 17:17156884-17156906 GGAGCAAGGGTCACCTGTCCAGG - Intronic
1144942616 17:18952127-18952149 TCAGAAAGGGTTTCCTGGCAGGG - Intronic
1145882684 17:28363932-28363954 TGAGAACTGGGGACCAGGCCTGG + Intergenic
1146411037 17:32585432-32585454 TGAGAAAGGGCAGTCTGGCCAGG + Intronic
1146676332 17:34776027-34776049 TGAGAATGGTTGCCCTGGCTTGG - Intergenic
1146949159 17:36893720-36893742 TCATAAAGGGAGGCCTGGCCTGG + Intergenic
1147246070 17:39121818-39121840 TAAGAATGGGTGACCGGGTCCGG + Intronic
1147427158 17:40351419-40351441 TGAGAGTGGGGGACCTGGCGGGG - Intronic
1148521934 17:48285319-48285341 AGAAAAAGGGAGCCCTGGCCGGG + Intronic
1150308945 17:64111650-64111672 TAAGATTGGATGACCTGGCCGGG - Intronic
1150336759 17:64335966-64335988 TAAGAAATGATGATCTGGCCGGG + Intronic
1151528419 17:74687517-74687539 CAAGAAAGGGTGACTTGGCTGGG - Intronic
1152891519 17:82884285-82884307 TGTGGATGGGTGAGCTGGCCAGG - Intronic
1153685358 18:7539686-7539708 TAAAAAAGAGTGGCCTGGCCTGG + Intergenic
1155472793 18:26208400-26208422 TTAAAAAGGTTGTCCTGGCCGGG + Intergenic
1156940270 18:42758809-42758831 TCAGAAAGGGTAATCAGGCCAGG - Intronic
1157043220 18:44063762-44063784 AGAGAAAGGATAACCTGGGCTGG - Intergenic
1157849051 18:51030483-51030505 TGAGGAGGGGCGGCCTGGCCGGG + Exonic
1158138648 18:54233020-54233042 TGTGAAAGGGAGACCTCTCCTGG - Intergenic
1159644863 18:70905848-70905870 TGACAAAAGGAGTCCTGGCCTGG - Intergenic
1159974823 18:74698557-74698579 TGAGAGAGGGTGACCTGGGAAGG - Intronic
1161437815 19:4274016-4274038 TAAGAAAGGCAGAGCTGGCCAGG + Intergenic
1162099262 19:8329972-8329994 GGAGAGAGGGAGAACTGGCCAGG + Intronic
1162416468 19:10541095-10541117 TGAGAAAGGGTGCACTTGGCTGG + Intergenic
1162456201 19:10786520-10786542 TCAGAAAGGGTGGCATGGGCAGG - Intronic
1162488403 19:10976361-10976383 TCAGGGAGGGTGAGCTGGCCAGG + Intronic
1163271710 19:16258539-16258561 GGGGACAGGGTGTCCTGGCCTGG - Intergenic
1163478955 19:17543234-17543256 TGAGAAGGGGTCAGCTGGGCAGG + Intronic
1165071088 19:33255211-33255233 GGAGAAGAGGTGACCTGCCCAGG + Intergenic
1165404777 19:35622886-35622908 TCAGAGAGGGCGGCCTGGCCTGG - Exonic
1165844711 19:38810770-38810792 TTAAATAGGGTGGCCTGGCCGGG - Intronic
1165977476 19:39689376-39689398 TTAGAAAGGTTGACCAGGCATGG + Intergenic
1166790884 19:45397859-45397881 TGAAAAAAGGGGACCAGGCCAGG - Intronic
1167288585 19:48612695-48612717 TCAGAAAGGGGGGCCCGGCCGGG - Intronic
1167323072 19:48808002-48808024 AGAGACAGAGTGGCCTGGCCTGG + Intronic
926634001 2:15161704-15161726 TGAGAAAAGCTGCCCTGGCTGGG - Intergenic
927810760 2:26179151-26179173 GGAGTCAGGGAGACCTGGCCTGG + Intronic
928032403 2:27792727-27792749 AGAGAAAGGGGGACTTGGCAGGG - Intronic
929580668 2:43080001-43080023 TGATAAAGGCTGGTCTGGCCGGG + Intergenic
929822200 2:45282661-45282683 TGCCAAAGGCTGACCTGGCAGGG - Intergenic
934544612 2:95204629-95204651 TGAGAAAGAGTGACCAGTCAAGG + Intergenic
935005897 2:99076780-99076802 TGAGAAAGGGTGATCCAGACAGG - Intronic
935300545 2:101690224-101690246 TGAGAAAGTGTGTCTGGGCCAGG - Intergenic
937366617 2:121266706-121266728 AGTGAAAGGGTGACCTGCCCTGG + Intronic
937597554 2:123689064-123689086 TCAGAAACGGTGGCCTGGGCTGG - Intergenic
937989932 2:127656708-127656730 TTTGAAAAGGTGACCTGGCCGGG - Intronic
938768494 2:134480000-134480022 GGAGAAAAGCTGACCTGGTCTGG - Intronic
939513103 2:143131712-143131734 GGAGAAAGGGAGGCCTGGCTAGG - Intronic
941674082 2:168325152-168325174 TTAGAAATGCAGACCTGGCCAGG - Intergenic
942259273 2:174141225-174141247 TAAGAAACGGTGCCCTGGCCAGG - Intronic
942735224 2:179102928-179102950 TGAGAGAGAGTCACCTGGACAGG - Exonic
943192453 2:184696136-184696158 TAAGAAGGTGTCACCTGGCCTGG - Intronic
946445453 2:219736385-219736407 GGAGAAAGGGTGACCTCTGCTGG - Intergenic
946780093 2:223185851-223185873 TAACAAAGAATGACCTGGCCGGG + Intronic
946923852 2:224606246-224606268 TAAGACAGGGTAAGCTGGCCGGG - Intergenic
947907964 2:233779519-233779541 GGAGAAAGGGAGACCTAGGCTGG - Intronic
1168978117 20:1983071-1983093 TGAGACAGGATGGCCTGGCAGGG - Exonic
1169615911 20:7445303-7445325 TGAGAAAGAACAACCTGGCCGGG + Intergenic
1170790564 20:19505791-19505813 TGAGAAAGGTTCCCCTGCCCAGG - Intronic
1172299216 20:33837121-33837143 TGAGAAAGGAAGAACTGGCCGGG + Intronic
1172356798 20:34285802-34285824 TAAGAAATGTTGAGCTGGCCGGG + Intronic
1173448128 20:43138428-43138450 GGAGACAGGGTGGCCTGCCCAGG - Intronic
1174142608 20:48426385-48426407 TCAGACAGGGTGCCTTGGCCAGG + Intergenic
1174452308 20:50627972-50627994 TGGGAGAGGGTCACCTGGGCCGG + Intronic
1175919848 20:62445755-62445777 TGAGCCAGCGTGGCCTGGCCTGG + Intergenic
1177047921 21:16194122-16194144 TGAGAAAGGGTTGTCTGGCGGGG + Intergenic
1177439082 21:21096156-21096178 TGAGCAAGGGTAACCTTGCTAGG + Intronic
1178863613 21:36309610-36309632 TGAAAAAGGGAGACCCGGCCGGG - Intergenic
1180171391 21:46060539-46060561 TGGGGAAGGGTGGCCTGCCCAGG - Intergenic
1180785010 22:18542313-18542335 TGAGAAAGGGGAGCCTGGGCCGG - Intergenic
1180800618 22:18630258-18630280 GGAGGAAGGGTGGCCTGGCTGGG - Intergenic
1180851850 22:19025815-19025837 GGAGGAAGGGTGGCCTGGCTGGG - Intergenic
1181128593 22:20716346-20716368 TGAGAAAGGGGAGCCTGGGCCGG - Intronic
1181221101 22:21365004-21365026 GGAGGAAGGGTGGCCTGGCTGGG + Intergenic
1181241913 22:21481667-21481689 TGAGAAAGGGGAGCCTGGGCCGG - Intergenic
1182095433 22:27622326-27622348 TGAGAAAGGTTGACCTGGCTGGG - Intergenic
1182405999 22:30130890-30130912 TTAGGAAGGAAGACCTGGCCAGG - Intronic
1182619542 22:31611356-31611378 TGAGAAATGGTCTCCTGGCCTGG - Intronic
1183107324 22:35623757-35623779 TGAAAAAGGGAGCACTGGCCAGG + Intronic
1183253489 22:36746039-36746061 TGAGAACAGCTGCCCTGGCCAGG + Intergenic
1183265383 22:36821935-36821957 TGAGAAAGTCTGACTTGGGCTGG + Intergenic
1184167248 22:42737129-42737151 TTAGAAAGGGAAAACTGGCCAGG - Intergenic
950189804 3:10968748-10968770 TGAGTAAGAGTGTCATGGCCTGG - Intergenic
951289603 3:20859526-20859548 TAAGAAAGGGTCACTGGGCCTGG + Intergenic
951624667 3:24646127-24646149 ACAGAAAGGGTGGCCTGGCCAGG - Intergenic
951772884 3:26278362-26278384 TAATAAAGGGTGGACTGGCCGGG - Intergenic
951867602 3:27325163-27325185 TGAGCAAGTGTCACCTGGCCAGG - Intronic
954149828 3:48651836-48651858 GGGGGAAGGGTGACCTGGGCAGG - Intronic
954934152 3:54311541-54311563 TGTGCAAGGGTGCTCTGGCCAGG - Intronic
955473023 3:59306391-59306413 TCAGAAAGGCTGGCCTGGACAGG + Intergenic
955757025 3:62235393-62235415 TGAGAAAGTGAGCCCTGGACAGG - Intronic
963078198 3:141367532-141367554 TGACCAAGGGCAACCTGGCCAGG - Intronic
963143639 3:141969943-141969965 TGAGAGAGGCTGCCCTGGCGTGG + Intronic
963797251 3:149643137-149643159 TGTGAAAGGGCAAACTGGCCTGG + Intronic
965104063 3:164337152-164337174 TCAGAGACGGTGACCTGGGCTGG + Intergenic
965825971 3:172730129-172730151 TGAGAAAGGGAGAGATGGCTGGG + Intergenic
967740012 3:192994570-192994592 TAAGAAAGAGTGGCCGGGCCAGG - Intergenic
968650771 4:1759446-1759468 TGAGAAAGAAGGACCTGCCCAGG + Intergenic
969320706 4:6410727-6410749 TGAGAAAGGGTGACCTGGCCAGG - Intronic
969439925 4:7210958-7210980 AGTGGAACGGTGACCTGGCCTGG + Intronic
970908516 4:21246193-21246215 AGGGAAAGGGTGTCCTGGGCTGG - Intronic
972194611 4:36638455-36638477 TGAGAAAGGGAAGCCTGGGCTGG + Intergenic
972309266 4:37864711-37864733 TAAAAGAGGGTGACCTGGCCGGG - Intergenic
976118933 4:81758937-81758959 TTAGTAAGGCTGAGCTGGCCTGG - Intronic
976454697 4:85232876-85232898 TGAAAAAGGGTGATTTGGCGTGG - Intergenic
976476889 4:85494801-85494823 AGAAAAAGAGTGACCTGGCCGGG + Intronic
978837345 4:113167593-113167615 TAAAAGATGGTGACCTGGCCGGG - Intronic
982067155 4:151664404-151664426 TGACAACAGGAGACCTGGCCTGG + Intergenic
982483158 4:155935555-155935577 TGAGAAAGGGTTGCCTGGCAGGG - Intronic
985076009 4:186215601-186215623 TGAGACAGGGTCACCTAGGCCGG + Intronic
985089915 4:186351877-186351899 TTACACAGGGTGACCTGGACTGG - Intergenic
985972697 5:3390955-3390977 TGAGAAAAGGGGACTTGGACTGG - Intergenic
987138666 5:14922722-14922744 TGAGAAAGGAGCACCTGGCCAGG + Intergenic
988692982 5:33591331-33591353 TTAGAAAGAGTGACGTGTCCTGG - Intronic
988958945 5:36349772-36349794 AGAAAATGGGTCACCTGGCCAGG - Intergenic
990305565 5:54491410-54491432 TGACACATGGTGACCTAGCCAGG + Intergenic
992821672 5:80504011-80504033 CAAGAGAGGGAGACCTGGCCTGG - Intronic
992969230 5:82038617-82038639 TTAGAAAGAGAGAACTGGCCAGG - Intronic
993824703 5:92668721-92668743 GGAGAAAGGTTGACATGGTCCGG - Intergenic
994678793 5:102860161-102860183 TGAGGAAGGGTGGCCTGGCATGG + Intronic
994690132 5:103007480-103007502 TGAGGAACAGTGAACTGGCCTGG - Exonic
997067370 5:130577768-130577790 GGAGAAAGAGAAACCTGGCCAGG + Intergenic
997438423 5:133891679-133891701 GGAGGCAGGGTGACCTGCCCTGG + Intergenic
997857267 5:137383518-137383540 TGTGAAAGGCTGACCTTGCAAGG + Intronic
998556811 5:143133467-143133489 TGGGAAATGGTGCCCTGCCCTGG + Intronic
999577667 5:152997687-152997709 TAAGAAATGGTGACCTGGGCCGG - Intergenic
999697691 5:154201139-154201161 TGTGAAAGGGTGAAGTGCCCAGG - Intronic
1001297310 5:170506995-170507017 TGGGGAAAAGTGACCTGGCCAGG - Intronic
1002057866 5:176609224-176609246 TGAGCAGGGGTGAGCAGGCCAGG + Intronic
1002271085 5:178072696-178072718 TGAGATAGGGTCACCTGGACTGG - Intergenic
1002558486 5:180063006-180063028 TGAGTAAGGGTGAAATGACCTGG + Intronic
1003114662 6:3275959-3275981 TGGGCAAAGGTGACCTGGGCAGG + Intronic
1004093361 6:12528088-12528110 TAAGAAAGGAAGAGCTGGCCGGG - Intergenic
1004399411 6:15274651-15274673 TGTGAAGGGGTGACTTAGCCAGG + Intronic
1005325946 6:24700729-24700751 TAAGAAAGGTGGATCTGGCCGGG - Intronic
1005342635 6:24857712-24857734 TGAGGAAGGTTGACCTGCCCTGG + Intronic
1006361712 6:33590557-33590579 AGAGGAAGGGTGACCAGCCCAGG - Intergenic
1006737084 6:36281722-36281744 TAAGAAAGTGAGATCTGGCCGGG + Intronic
1006793061 6:36716172-36716194 AGAGAAAGGGAGCCCTGGCCGGG + Intronic
1007136708 6:39529489-39529511 TAAAAATGGGTGACCTGGCCAGG + Intronic
1007441207 6:41861995-41862017 TTAAAAAGAGTGACATGGCCGGG - Intronic
1019434855 7:1017389-1017411 GGTGAAGGGGTCACCTGGCCTGG + Intronic
1019572996 7:1722033-1722055 TGGGAATGGCTGACCTGGTCAGG + Intronic
1019701320 7:2476162-2476184 TGTGACAGGGTGACCAGGGCTGG + Intronic
1019768742 7:2870332-2870354 TGGGAAAGGGGGACCCGGACAGG - Intergenic
1020261708 7:6534350-6534372 TTGGAAAGTGTGACGTGGCCAGG - Intronic
1021755121 7:23844007-23844029 TGAGAGAGGGAGAACTGGCTGGG - Intergenic
1021813026 7:24422403-24422425 TGAGACAGGGTGCCCTGACAGGG - Intergenic
1022819299 7:33943384-33943406 TGAAAAAGCATGAACTGGCCTGG - Intronic
1023134927 7:37041803-37041825 TGAGAAAGGGTGCCGTCGCAGGG - Intronic
1023139020 7:37082699-37082721 TGAGACAGGGTCACCCGGGCTGG - Intronic
1023362616 7:39431872-39431894 TGAAATCTGGTGACCTGGCCTGG - Intronic
1024044693 7:45578657-45578679 TGGGAAAGGGGGGCCTGGGCAGG + Intronic
1026580000 7:71607660-71607682 TGAGAAAAGATGACCTGCCAGGG + Intronic
1026888472 7:73968346-73968368 TGAGAAAGGGAGGCCTGGAGAGG - Intergenic
1027200293 7:76059950-76059972 GGAGTTAGGGTGACCTGCCCAGG + Intronic
1027937312 7:84624738-84624760 TGACAAAGGGTGATCTTGACGGG - Intergenic
1028093568 7:86733017-86733039 TAAGAAAGGCTGAGATGGCCGGG + Intronic
1029618227 7:101673449-101673471 GGAGAGAGAGTGATCTGGCCAGG - Intergenic
1032756021 7:134891568-134891590 AGAGATACGGAGACCTGGCCAGG - Intronic
1035008709 7:155691758-155691780 TAAAAAATGGTGACCTGGCTGGG + Intronic
1035113076 7:156500733-156500755 CCATAAAGAGTGACCTGGCCTGG + Intergenic
1035363144 7:158327667-158327689 AATGAAAGGGTGACCTAGCCTGG - Intronic
1035450307 7:158973619-158973641 TGAGGAAGGGAGACCTGCCTGGG - Intergenic
1035695777 8:1594717-1594739 TAAGAGAGTGTGACCTGGCCGGG - Intronic
1036683160 8:10890938-10890960 TGACCAAGGGTCACCTGACCAGG + Intergenic
1038255540 8:25947758-25947780 TGAAGAAGGGTTACCTGGGCAGG - Intronic
1039358558 8:36848835-36848857 TGATAAGGGGTGACTAGGCCAGG - Intronic
1041244648 8:55879287-55879309 TGAGAAACGGAGAACTTGCCGGG + Intergenic
1041367877 8:57128357-57128379 TCAGAAAGGGGGAGCTGGCAGGG - Intergenic
1045312967 8:101019313-101019335 TGAAAAAGGGTGAACTGGAGTGG - Intergenic
1046571032 8:115966440-115966462 TAAGAAAGGGACATCTGGCCAGG - Intergenic
1047210036 8:122833699-122833721 TAAGAAAGAGTGAGCGGGCCGGG + Intronic
1049049514 8:140183553-140183575 TTAGAAATGGAGACCTGGCTGGG + Intronic
1049087271 8:140488422-140488444 GGAGAAAAGGTGTCCTGGCCGGG - Intergenic
1049509663 8:143021115-143021137 TGAGACAGTGTGGCCAGGCCGGG - Intronic
1050309302 9:4336385-4336407 AGAGTATTGGTGACCTGGCCTGG - Intronic
1051504615 9:17813581-17813603 TGAAAAAGCCTGTCCTGGCCAGG + Intergenic
1051896324 9:21993678-21993700 TGGGAGAGGGTGACCCCGCCGGG + Intronic
1052955909 9:34253129-34253151 TGACAAAGGGTGACTGGACCAGG + Exonic
1053549369 9:39059650-39059672 TAAGAAAGAATTACCTGGCCAGG - Intergenic
1053813487 9:41879710-41879732 TAAGAAAGAATTACCTGGCCAGG - Intergenic
1054617109 9:67307729-67307751 TAAGAAAGAATTACCTGGCCAGG + Intergenic
1054784844 9:69200745-69200767 AGAGAAAAGGTGACATGGGCTGG - Intronic
1055954377 9:81760719-81760741 TGAGAAATGGTGACTAGACCAGG - Intergenic
1056380606 9:86053905-86053927 TGAGGCAGGGAGACCTGGGCTGG - Intronic
1056490851 9:87105534-87105556 TGAGAAAATGTGTCCTGACCTGG - Intergenic
1057562603 9:96140108-96140130 TGGGAAACGCTGACCTTGCCAGG - Intergenic
1059221655 9:112627163-112627185 GAAGAAAAGCTGACCTGGCCTGG - Intronic
1059654832 9:116348069-116348091 TGGGGAAGTGTGACCTGGCTGGG + Intronic
1060898827 9:127239278-127239300 TGAGAAAGGGTGACCTTCTGAGG - Intronic
1060913752 9:127371322-127371344 TGGGAAAGGGAGTCCTGGCTAGG - Intronic
1062446465 9:136597394-136597416 TGAGGAAGGGGTGCCTGGCCGGG + Intergenic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1185637302 X:1562191-1562213 CGGGACAGGGTCACCTGGCCAGG - Intergenic
1186369281 X:8930224-8930246 TTAGAAGGGGTGACTCGGCCAGG - Intergenic
1189254557 X:39627702-39627724 TGACAATGGGTGACCCAGCCCGG + Intergenic
1189287801 X:39864608-39864630 GGAGACAGGGTCACCTGGGCTGG - Intergenic
1191690674 X:63934884-63934906 TGAGAAAGGGAAGCATGGCCTGG - Intergenic
1195328121 X:103774542-103774564 TGAGACACGGTCACCTGGCTGGG + Intronic
1197142710 X:123134013-123134035 TGAGAAAGGGAGTCTTGTCCTGG - Intergenic
1198749833 X:139928025-139928047 TGAGAAAGGCTGTCCTAGACAGG - Intronic
1199966976 X:152828752-152828774 AAGGAAAGGGTGACCTGACCAGG - Intronic