ID: 969320976

View in Genome Browser
Species Human (GRCh38)
Location 4:6412413-6412435
Sequence GCTGCCTGCCTAATATCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 120}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969320973_969320976 -9 Left 969320973 4:6412399-6412421 CCCTGGAAGGGAAAGCTGCCTGC 0: 1
1: 0
2: 1
3: 21
4: 243
Right 969320976 4:6412413-6412435 GCTGCCTGCCTAATATCACAGGG 0: 1
1: 0
2: 0
3: 15
4: 120
969320964_969320976 26 Left 969320964 4:6412364-6412386 CCCCTGCCCTCATTTCACCAGTG 0: 1
1: 0
2: 3
3: 32
4: 310
Right 969320976 4:6412413-6412435 GCTGCCTGCCTAATATCACAGGG 0: 1
1: 0
2: 0
3: 15
4: 120
969320968_969320976 19 Left 969320968 4:6412371-6412393 CCTCATTTCACCAGTGAGAAAAA 0: 1
1: 2
2: 17
3: 180
4: 1157
Right 969320976 4:6412413-6412435 GCTGCCTGCCTAATATCACAGGG 0: 1
1: 0
2: 0
3: 15
4: 120
969320966_969320976 24 Left 969320966 4:6412366-6412388 CCTGCCCTCATTTCACCAGTGAG 0: 1
1: 0
2: 2
3: 26
4: 198
Right 969320976 4:6412413-6412435 GCTGCCTGCCTAATATCACAGGG 0: 1
1: 0
2: 0
3: 15
4: 120
969320965_969320976 25 Left 969320965 4:6412365-6412387 CCCTGCCCTCATTTCACCAGTGA 0: 1
1: 0
2: 1
3: 33
4: 267
Right 969320976 4:6412413-6412435 GCTGCCTGCCTAATATCACAGGG 0: 1
1: 0
2: 0
3: 15
4: 120
969320969_969320976 9 Left 969320969 4:6412381-6412403 CCAGTGAGAAAAATGAGACCCTG 0: 1
1: 2
2: 5
3: 38
4: 486
Right 969320976 4:6412413-6412435 GCTGCCTGCCTAATATCACAGGG 0: 1
1: 0
2: 0
3: 15
4: 120
969320974_969320976 -10 Left 969320974 4:6412400-6412422 CCTGGAAGGGAAAGCTGCCTGCC 0: 1
1: 0
2: 3
3: 30
4: 309
Right 969320976 4:6412413-6412435 GCTGCCTGCCTAATATCACAGGG 0: 1
1: 0
2: 0
3: 15
4: 120
969320967_969320976 20 Left 969320967 4:6412370-6412392 CCCTCATTTCACCAGTGAGAAAA 0: 1
1: 1
2: 16
3: 133
4: 877
Right 969320976 4:6412413-6412435 GCTGCCTGCCTAATATCACAGGG 0: 1
1: 0
2: 0
3: 15
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969320976 Original CRISPR GCTGCCTGCCTAATATCACA GGG Intronic
905597789 1:39223381-39223403 GCAGCTTGCCCAAGATCACAAGG - Intronic
905928459 1:41768972-41768994 GCAGGCTTCATAATATCACAAGG - Intronic
916410858 1:164545679-164545701 GCAGCCTGGCTAATATTACTGGG + Intergenic
920975767 1:210783705-210783727 GCTGGGTGCCTAAGACCACAAGG + Intronic
922097883 1:222458123-222458145 CCTGCAGGCTTAATATCACATGG - Intergenic
1063249591 10:4259420-4259442 GCTTCCTGCTTAGTTTCACAAGG + Intergenic
1068599005 10:58935897-58935919 GCTGCCTGATGAATATGACAAGG + Intergenic
1068617008 10:59129873-59129895 ACTGCCTGACTAAATTCACATGG - Intergenic
1071277157 10:84065777-84065799 GCAACTTGCCTAAAATCACAGGG + Intergenic
1072155549 10:92720425-92720447 GCTGAATGCCTCATTTCACATGG + Intergenic
1076540677 10:131212855-131212877 ACTTCCTACCTCATATCACATGG - Intronic
1077510826 11:2961408-2961430 CCTGCCTGGCAAAAATCACAAGG + Intronic
1080145797 11:28981996-28982018 GCTACCTGCATAATCTCACAGGG + Intergenic
1083598775 11:63933410-63933432 GCAGCTTGCCTAAAGTCACAAGG + Intergenic
1088410894 11:109533249-109533271 CCTGCCTCCCTAATTTCTCATGG + Intergenic
1091992019 12:4963049-4963071 GCAACCTGCCCAAGATCACACGG - Intergenic
1094007853 12:25774485-25774507 GCTGCCAGCCGAAAATCTCATGG - Intergenic
1096173221 12:49491212-49491234 GTTTCCTGCCTTAAATCACACGG - Intronic
1099948269 12:89270493-89270515 GCTGCCTGTCTAATATCTATGGG - Intergenic
1101336261 12:103799657-103799679 GCTTCCTGCCTCATGTCACGGGG - Intronic
1101991057 12:109485477-109485499 GCAGCTTGCCCAATATCACATGG + Intronic
1102788070 12:115620310-115620332 GTTGCCTGCCCAAGACCACAGGG + Intergenic
1102880492 12:116481380-116481402 GGTGCCTGCCTTATAGGACAGGG - Intergenic
1104411895 12:128565192-128565214 GCTGCCAGCCCAATAGCCCATGG + Intronic
1113364640 13:109664843-109664865 GCGGGCTGCCTGAGATCACATGG + Intergenic
1115786567 14:36833299-36833321 GCTGCCTTCCTGGCATCACAAGG - Intronic
1119197367 14:72727021-72727043 GCTTCCTTCTTTATATCACATGG + Intronic
1119526939 14:75330267-75330289 ACTGCCCACCAAATATCACATGG - Intergenic
1120290272 14:82560787-82560809 GCAGCATGCCTAAAATCTCAGGG - Intergenic
1121323613 14:93007138-93007160 GCTGCCTGCCCAAGGTCACACGG + Intronic
1124504412 15:30260994-30261016 GCTGCCTGGCTCGTGTCACATGG - Intergenic
1124739139 15:32277641-32277663 GCTGCCTGGCTCGTGTCACATGG + Intergenic
1127177885 15:56381574-56381596 GCCCCCTGCCCAATATCACTAGG + Intronic
1127454778 15:59147138-59147160 GATGGCTGCCGAATCTCACAAGG + Intronic
1130796965 15:87219867-87219889 GCTTTCTGCCTAGAATCACATGG - Intergenic
1130903559 15:88224788-88224810 GCTGCCTCCCTAACAAGACAGGG - Intronic
1132216583 15:100067094-100067116 GCTGCCTTCTCAATATCATAAGG - Intronic
1132216594 15:100067206-100067228 GCTGCCTTCTCAATATCATAAGG - Intronic
1132216604 15:100067318-100067340 GCTGCCTTCTCAATATCATAAGG - Intronic
1133102816 16:3489518-3489540 CCTGCCTGGCTAATACCACATGG - Intergenic
1137859227 16:51829742-51829764 GCTGCCTACCTGATGACACAGGG + Intergenic
1140909129 16:79435973-79435995 ACCGCATGCCTAAAATCACAGGG - Intergenic
1141518441 16:84561940-84561962 GCATCCTGCCTAAGGTCACACGG + Intergenic
1143612313 17:8025823-8025845 GCAGCCTTCCTCAAATCACATGG + Intergenic
1144865245 17:18331374-18331396 GCTGCCTGCCTAAAGCCACACGG - Intronic
1149867564 17:60159154-60159176 GGTGCCTGCCTGAGGTCACACGG + Intronic
1151844703 17:76644306-76644328 GCTGCCAGCCCAAGAGCACATGG + Intergenic
1154145576 18:11863614-11863636 GCTGCTTCCTTAAAATCACATGG + Intronic
1162453370 19:10767972-10767994 GCTGCCTGCCTTTCTTCACAGGG - Intronic
1165960950 19:39533749-39533771 GCCTCCTACCTGATATCACATGG + Intergenic
1166820211 19:45574594-45574616 GCTGCCTGCTCAAAGTCACATGG + Intronic
930486813 2:52020950-52020972 GCTGCCTTCATGATATGACAAGG + Intergenic
930537809 2:52666240-52666262 CCTGTATGCCCAATATCACATGG + Intergenic
931700580 2:64905687-64905709 GTGGCCTGCCTGATATCTCAGGG - Intergenic
931988147 2:67760996-67761018 AATGCCTGCCTAAGATCACATGG + Intergenic
933835657 2:86243351-86243373 CCTGCCTGCCTGACCTCACAGGG - Intronic
933903090 2:86862816-86862838 GCTGCCTGCTTTAGATCTCAGGG - Intergenic
935777456 2:106486454-106486476 GCTGCCTGCTTTAGATCTCAGGG + Intergenic
935797970 2:106663884-106663906 CCTGCAGGCCTAATACCACATGG - Intergenic
939178343 2:138778137-138778159 GTTGCCAGCCTTATAACACAAGG - Intronic
940336912 2:152538752-152538774 GTTGCCTGTCTAATATCTAAAGG + Intronic
942110843 2:172681413-172681435 GCTGCATGCCAAGTCTCACAAGG - Intergenic
942127774 2:172844648-172844670 ACTGCCAGCCAAAAATCACAGGG - Intronic
943800550 2:192052253-192052275 GCTGCATGCCTAATATTTCCAGG - Intronic
945674026 2:212833414-212833436 GCTGCCTGACCACTATCACACGG + Intergenic
946962528 2:224999966-224999988 GCATCCTGCCTGATGTCACAAGG + Intronic
1170134818 20:13061276-13061298 CTTGCCTGCATAATTTCACAAGG - Intronic
1170335893 20:15269699-15269721 GCTACCTGCCCAAGATGACAAGG - Intronic
1175721820 20:61292282-61292304 ACTGGCTGCCTAATATTCCATGG - Intronic
949788284 3:7765556-7765578 GTTTGCTGCCTAATAACACAAGG + Intergenic
949831928 3:8224011-8224033 GCTGCCAGGCTAATATAATAAGG + Intergenic
950094743 3:10322229-10322251 TCTGCCTCCTTAATGTCACAAGG - Intergenic
951534487 3:23728858-23728880 GCTGCCTTTCAAATAACACAAGG - Intergenic
951708697 3:25568652-25568674 GTTGCCTCCCTAAGAGCACACGG - Intronic
954416340 3:50395305-50395327 GCAGCCTGCCCAAGGTCACATGG + Intronic
954751468 3:52816607-52816629 GCTGCCTGCCCAGGGTCACAAGG + Intronic
956490234 3:69763466-69763488 GCTGCCTACTTAAAATGACAGGG - Intronic
958710219 3:97708870-97708892 CCTGCAGGCCCAATATCACATGG - Intronic
962967070 3:140365180-140365202 GCTGCCGGACTAATATTTCATGG + Intronic
963060574 3:141221604-141221626 ACAGCCTGCCTAGCATCACACGG - Intergenic
966332983 3:178836077-178836099 GCTCCCTTCCTACCATCACAAGG + Intronic
966731063 3:183151803-183151825 GTTGCCTGCCCAGTGTCACAAGG + Intronic
969320690 4:6410660-6410682 TACACCTGCCTAATATCACAGGG + Intronic
969320976 4:6412413-6412435 GCTGCCTGCCTAATATCACAGGG + Intronic
971629999 4:28978939-28978961 GCTGCTTTCCTTATACCACAGGG + Intergenic
972878482 4:43395195-43395217 TCTGCAGGCTTAATATCACATGG - Intergenic
973039728 4:45455430-45455452 ACTGCCAACCTCATATCACAAGG + Intergenic
977661636 4:99594715-99594737 TCTGCCTGCATAATACCAAAGGG - Exonic
979826337 4:125238161-125238183 GCTGCCTACCTACTATCATAAGG + Intergenic
980206326 4:129723379-129723401 GATGCCTGCATAATATTCCATGG - Intergenic
981171773 4:141633545-141633567 ACAGCTTGCCTAAGATCACATGG - Intergenic
982585779 4:157236675-157236697 TGTTTCTGCCTAATATCACAAGG + Intronic
983379104 4:166968572-166968594 CCTGCATGCCCAACATCACATGG - Intronic
984414906 4:179446007-179446029 TCTGCATGCCTAATATTTCATGG - Intergenic
986987350 5:13514611-13514633 CCTGCTGGCCCAATATCACATGG - Intergenic
988886060 5:35559182-35559204 CCTGCAGGCTTAATATCACATGG + Intergenic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
991184864 5:63794990-63795012 CCTGCAGGCCTAATATCACATGG + Intergenic
996081260 5:119260872-119260894 GCTGCCTGCTGAATATTACTGGG - Intergenic
998135467 5:139671928-139671950 GCCACCTGCCTAAGGTCACAAGG - Intronic
1002069293 5:176669909-176669931 GTGGCCTGCTGAATATCACATGG + Intergenic
1003939707 6:11012065-11012087 GCTGCCTGGCACATATCACTTGG + Intronic
1004018051 6:11750210-11750232 ACTGGCTGCCTAATGTCCCAGGG - Intronic
1004999432 6:21225650-21225672 ACTACCTGCCTAAGATCACATGG + Intronic
1007234435 6:40380050-40380072 GGTCCCTGCCTAAGATAACAAGG - Intergenic
1008628882 6:53345182-53345204 GCTGCCACCATAATCTCACATGG - Intronic
1013533020 6:111037457-111037479 GATCCCTGCCTAATCTGACAAGG - Intergenic
1013585440 6:111574670-111574692 GGTCCCTGCCCAATACCACATGG + Intronic
1020398845 7:7751061-7751083 GAAGCCTGCATAATATCAAATGG - Intronic
1023519716 7:41038327-41038349 GCTGCCTGCAGAATAGCAGAAGG - Intergenic
1024044671 7:45578547-45578569 TCTGCCTTCCTAATACCCCATGG - Intronic
1024143191 7:46482677-46482699 TATGCCTGCATAATATTACATGG - Intergenic
1027206878 7:76107441-76107463 GCAGCCTGCCCAAAATCACATGG + Intergenic
1027604520 7:80284065-80284087 GCTGCAGGCCAAATACCACATGG - Intergenic
1036920446 8:12848906-12848928 TCTGCCTGCCTTGCATCACAGGG + Intergenic
1040066055 8:43144908-43144930 CCTGAGTGCCTTATATCACAAGG - Intronic
1040484809 8:47859716-47859738 ACTGTCTGCCAAATATGACAGGG + Exonic
1041098145 8:54369896-54369918 TCTGCCTGCCTATTACCACATGG + Intergenic
1041285127 8:56252785-56252807 GCTGTATCCCTAATTTCACAGGG + Intergenic
1043105602 8:76106338-76106360 GCTTCCTGCCTAATATAAAAGGG - Intergenic
1043726388 8:83616970-83616992 CCTGCCTGGATAATCTCACAAGG - Intergenic
1043736672 8:83756744-83756766 GCTGCTTATCTAAGATCACAAGG - Intergenic
1043755020 8:83992627-83992649 TCTGGCTGCATAATATCCCATGG - Intergenic
1047967005 8:130052689-130052711 GCTGCATGTCTAAAATTACATGG - Intronic
1049447647 8:142638755-142638777 ACTGCCTGCCAAATGCCACAAGG - Intergenic
1050168328 9:2789581-2789603 ACTGCCTGGCTGATATCACGTGG - Intronic
1052037296 9:23696828-23696850 GCTGCCTCCAGAATATCTCAGGG + Intronic
1053462965 9:38284834-38284856 GCTGGCTGCCTAATGACAAAGGG + Intergenic
1055379116 9:75686962-75686984 ATAGCCTGCATAATATCACATGG + Intergenic
1056263274 9:84870760-84870782 GCTTACAGCATAATATCACATGG + Intronic
1056833539 9:89935447-89935469 CTTGCCTGCCTAAGATCACATGG + Intergenic
1058293789 9:103279143-103279165 ACTGCCTGGGTAATATCACAGGG + Intergenic
1062026037 9:134341251-134341273 GCTGCTTGCCCAATATCATGTGG + Intronic
1062590222 9:137271230-137271252 CCTGCCTGCCACATCTCACAGGG - Intronic
1192805669 X:74506398-74506420 GCTCCCTGCCCCATATCACTAGG - Intronic
1193044180 X:77034265-77034287 GCTGTCTGCCTGAGTTCACATGG - Intergenic