ID: 969322738

View in Genome Browser
Species Human (GRCh38)
Location 4:6422846-6422868
Sequence GTCCTACTGTGTTACTGTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 98}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969322738 Original CRISPR GTCCTACTGTGTTACTGTTA TGG (reversed) Intronic
906415757 1:45620562-45620584 GTCCTACTATGTAACAGATAAGG - Intronic
912988998 1:114465019-114465041 GTCTTACTGTTTTACCATTATGG - Intronic
915520777 1:156441554-156441576 GTCCTACTGTCTCAATGTTTGGG - Intergenic
921032034 1:211342344-211342366 GTCCTACTTTTTTATTTTTATGG + Intronic
1065539548 10:26748510-26748532 GTCATACTGTGGGACTATTATGG - Exonic
1065648884 10:27866499-27866521 GTCCAATTGTGTTACTATGAAGG + Intronic
1065705375 10:28467308-28467330 ACCCTACTGTGTAACTGATATGG - Intergenic
1065796303 10:29311475-29311497 GTCCTTCTGGGGTACTCTTAAGG - Intronic
1065946630 10:30610973-30610995 GTCCTTCTGGGGTACTCTTAAGG + Intergenic
1066250073 10:33624718-33624740 GTCCTTTTGTGTTGCTGTAAAGG + Intergenic
1070070516 10:73084802-73084824 GTCTTAATGTGTTAATTTTAGGG - Intronic
1070700110 10:78595709-78595731 GTCCAGCTTTGTTAGTGTTAAGG + Intergenic
1071778512 10:88816183-88816205 GTGCTACCCTGTTACTGGTATGG - Intronic
1074899354 10:117803257-117803279 TTCCTACTGTGTACCTGTGAGGG + Intergenic
1078650557 11:13186949-13186971 GTCCATTTGTGTTACTGTAAAGG - Intergenic
1080844861 11:36017905-36017927 GTTCTACTGTGTAGCTGTTCTGG + Intronic
1083314907 11:61808657-61808679 TTCCTATTGTGGAACTGTTATGG - Intronic
1085719624 11:78901748-78901770 ATCCTACTCTGTTACTGATGAGG + Intronic
1087263754 11:96039450-96039472 CTCCTCCTATGTTACTTTTATGG - Intronic
1093750638 12:22795105-22795127 CTTCTACTGTATTACTTTTATGG - Intergenic
1097093329 12:56525131-56525153 GGCTTACTGTGTTTCTGTTTTGG + Intronic
1101041849 12:100763366-100763388 TGCCTACTTTGTTTCTGTTATGG - Intronic
1104273276 12:127302092-127302114 GCCCTACTGTCTTAATGTTCAGG - Intergenic
1105567438 13:21564537-21564559 GTCGGACTGTGTGACTGTGAAGG + Intronic
1109509925 13:63357626-63357648 GTCCTACTCTTTTACTTTTAGGG - Intergenic
1113132009 13:107047452-107047474 GTCCTCCAGAGTTCCTGTTAAGG - Intergenic
1115933321 14:38522708-38522730 GTCCTTATGTGTTCATGTTAGGG - Intergenic
1117421290 14:55548168-55548190 GTCATACTGTGGGACTGTTGTGG + Intergenic
1118711157 14:68520711-68520733 GACCTACTGTGTGCCAGTTAGGG + Intronic
1119964938 14:78904028-78904050 GTCCTAATGTCATACTGTGATGG - Intronic
1120181547 14:81347867-81347889 GTCCTACTCTGTTGCTGCAATGG - Intronic
1129557264 15:76525305-76525327 GTCCTACTATGTTATTGTTGTGG + Intronic
1138612594 16:58138559-58138581 GTCCTTTTGTGTTGCTGTGAAGG - Intergenic
1141109456 16:81260206-81260228 CTCGTACAGTTTTACTGTTACGG - Intronic
1146261342 17:31423908-31423930 GTCCCCCTGTGTGACTGCTACGG + Intronic
1146317472 17:31819483-31819505 TTCCTACTTTGTTAGTGTCAGGG + Intergenic
1155375155 18:25149228-25149250 GTGCTACTGTGTAACTTCTAAGG + Intronic
1158247746 18:55451267-55451289 GCTCTGCTGTGTAACTGTTAGGG - Intronic
1159691733 18:71496402-71496424 GTCCTACAGTTTTGCTGTCAAGG + Intergenic
1165661112 19:37580899-37580921 TTCATACTGTGTTACTATAAAGG - Intronic
1168429961 19:56270785-56270807 GTGCTACTGTGTAATTGATAGGG + Intronic
925065489 2:926385-926407 GTCCTGCTGTGCTACTGAGACGG - Intergenic
929402373 2:41599693-41599715 GTCCTTCTGTGTGAATTTTATGG - Intergenic
929865429 2:45713427-45713449 TTCCTTCTGTGTTACTGATTGGG + Intronic
929971642 2:46583237-46583259 TTCCTAATCTGTTTCTGTTAGGG - Intronic
945930133 2:215846495-215846517 TGCCCACTGTGTTACTCTTAAGG + Intergenic
946348576 2:219131569-219131591 GTTCTACTGTATCACTGTTTTGG + Intronic
1170900768 20:20460672-20460694 ATCCTACTGAGTTATTGTCAGGG + Intronic
1173392603 20:42648383-42648405 GGCCAACTGTGTTCCTGTGATGG - Intronic
1178430298 21:32512805-32512827 CTCCTTCTGTGATGCTGTTAGGG - Intronic
1178565805 21:33683300-33683322 GTCCTACTGTCTTTTTGTGACGG + Intronic
1181875046 22:25933966-25933988 GTCCTACTGGCTTCCTGTCATGG + Intronic
1182888498 22:33796739-33796761 GTCTTACTGTGTCACCTTTAAGG - Intronic
949757425 3:7428630-7428652 GTCTGACTGTGTGGCTGTTAAGG - Intronic
951775794 3:26309063-26309085 TTCCTACAGTGGTATTGTTATGG + Intergenic
951899590 3:27643656-27643678 GTCTTGCTTTGTTACTGTCAAGG - Intergenic
953462730 3:43094612-43094634 GTCCTAATGTCTGACTGTTCAGG + Intronic
953481313 3:43254678-43254700 GTCCTTTTGTGTTGCTGTAAAGG - Intergenic
955463436 3:59210882-59210904 GTCATACAGTTTTGCTGTTAGGG + Intergenic
956390563 3:68768896-68768918 TTCCCACTGTTCTACTGTTATGG - Intronic
962489161 3:135874459-135874481 GTATTACTGTATTACTGTAATGG + Intergenic
962518599 3:136176894-136176916 GTCCGTTTGTGTTGCTGTTAAGG - Intronic
964337536 3:155672137-155672159 ATCCTACTGTGTTCCTGAAAGGG + Intronic
966106270 3:176338555-176338577 GTCAGTCTGTGTTGCTGTTAAGG - Intergenic
967566360 3:190978456-190978478 TACCTACTGTGATACTGTGAAGG - Intergenic
969322738 4:6422846-6422868 GTCCTACTGTGTTACTGTTATGG - Intronic
970708065 4:18829310-18829332 GTCCTACTGTGTGTCTATCATGG + Intergenic
976436195 4:85021336-85021358 GCCCTGATTTGTTACTGTTAAGG - Intergenic
979636639 4:122962416-122962438 GTCCTACTGTGTAAATATTATGG + Intronic
988031498 5:25769448-25769470 ATCCTACAATGTCACTGTTAGGG + Intergenic
993257488 5:85611178-85611200 GTCCTACAGTGTTATTATAATGG - Intergenic
996703323 5:126471617-126471639 TTCCTACTGTATTATTGTGAAGG - Intronic
997959791 5:138311396-138311418 GTCTTGCTGTGTTACTCTTCTGG - Intronic
999353361 5:150899336-150899358 GTCTTATTTTGTTACTTTTATGG - Intronic
1000793049 5:165630560-165630582 CTCCAATTGTGTTCCTGTTATGG - Intergenic
1005402589 6:25450066-25450088 TTCCTAGTGTGCTACTGTAAAGG + Intronic
1005502558 6:26442911-26442933 GGCCTACTATATTAGTGTTAAGG - Intronic
1010932751 6:81822118-81822140 GTGCTTCTGTGTTACAGTAATGG - Intergenic
1011627894 6:89298300-89298322 TTCCTCTTGTGTGACTGTTAAGG - Intronic
1014262909 6:119240414-119240436 CTCCTGCTGTGTTTCTGATAGGG - Intronic
1017065071 6:150520909-150520931 GTCCTTTTGTGTTGCTGTAAAGG - Intergenic
1019882150 7:3871454-3871476 GTCCATTTGTGTTACTGTAAAGG + Intronic
1020969178 7:14912647-14912669 GTCCTACTTTGTTGCAGCTAAGG - Intronic
1021627138 7:22604366-22604388 GTCTTAATGAGTCACTGTTATGG + Intronic
1028404664 7:90462630-90462652 GTCTTAATATGTTACTGTCAAGG + Intronic
1031263631 7:119555257-119555279 TTACTACTGTGTTACTGCTGTGG - Intergenic
1031689857 7:124774186-124774208 GCCCTTCTGTGACACTGTTATGG + Intergenic
1037612835 8:20490774-20490796 GTCCTACTCCTTTTCTGTTATGG + Intergenic
1038853813 8:31308776-31308798 ATCCTAAGGTGTTACTCTTAGGG + Intergenic
1039366325 8:36931993-36932015 GTTATCCAGTGTTACTGTTAGGG + Intronic
1046023948 8:108699599-108699621 GGCCTCCTGTTCTACTGTTAAGG + Intronic
1055160834 9:73126007-73126029 GTCCAACTTTGTAACAGTTATGG + Intergenic
1056623092 9:88231333-88231355 GTCGTAGAGTGTTTCTGTTATGG - Intergenic
1061569802 9:131470207-131470229 GACCTACGGTGTTACAGTGAGGG - Intronic
1192671153 X:73143377-73143399 GTCTTACAGTGCTAATGTTAAGG + Intergenic
1199639357 X:149845547-149845569 GTCCTACTGACATACTGGTAAGG + Intergenic
1199697061 X:150350198-150350220 GTCCCACTGTTTTTCTGTCAGGG + Intergenic
1200048676 X:153416710-153416732 GTCCTCCTGTGTTGCTGTACAGG + Intergenic
1200267929 X:154655764-154655786 GTCCTACTGAGATGCTGTCAAGG + Intergenic
1200977659 Y:9229623-9229645 GGGTTAGTGTGTTACTGTTAGGG - Intergenic
1202019567 Y:20450587-20450609 ATCCCACTGCCTTACTGTTAAGG + Intergenic
1202133157 Y:21633294-21633316 GGGTTAGTGTGTTACTGTTAGGG + Intergenic