ID: 969323668

View in Genome Browser
Species Human (GRCh38)
Location 4:6428117-6428139
Sequence TAGGACATGCATAAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 208}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969323668_969323672 27 Left 969323668 4:6428117-6428139 CCTTCCTCTTTATGCATGTCCTA 0: 1
1: 0
2: 2
3: 12
4: 208
Right 969323672 4:6428167-6428189 GTTTTAAGATCAAGACTGTTTGG 0: 1
1: 0
2: 0
3: 10
4: 170
969323668_969323673 30 Left 969323668 4:6428117-6428139 CCTTCCTCTTTATGCATGTCCTA 0: 1
1: 0
2: 2
3: 12
4: 208
Right 969323673 4:6428170-6428192 TTAAGATCAAGACTGTTTGGTGG 0: 1
1: 0
2: 0
3: 7
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969323668 Original CRISPR TAGGACATGCATAAAGAGGA AGG (reversed) Intronic
900578578 1:3396260-3396282 TAGGATATTCATAAAGGGGGTGG - Intronic
900810572 1:4798569-4798591 TTGGACAGGCAGGAAGAGGAGGG - Intergenic
903463553 1:23536067-23536089 TAGGAAAAGCACAAAGAAGATGG - Intergenic
904025335 1:27499295-27499317 TGGGACAGGCTTACAGAGGAAGG + Intergenic
904966468 1:34378220-34378242 GAGGCCAGGCATAGAGAGGAAGG - Intergenic
905864586 1:41369791-41369813 TAGGACATGGATGAAGAGAATGG + Intronic
906221868 1:44086845-44086867 TGGAACATGTATAAAGAGGGAGG + Intergenic
908460628 1:64345455-64345477 TGGGAAATGCATGAAGATGAGGG + Intergenic
908651478 1:66337570-66337592 AAGGACATGGGGAAAGAGGAGGG + Intronic
909666823 1:78143386-78143408 CTGGCCATGCAAAAAGAGGAAGG - Intergenic
909924468 1:81422947-81422969 TAGTAAATGCATAAAGGGGCAGG - Intronic
912265489 1:108152926-108152948 TATGACATATAGAAAGAGGAAGG + Intronic
913688639 1:121257518-121257540 CAGGACAGGCAGAAAGATGATGG - Intronic
914148960 1:145022758-145022780 CAGGACAGGCAGAAAGATGATGG + Intronic
914247412 1:145896452-145896474 CAGCACATGGATAAAGAGGTGGG + Intronic
915086314 1:153391242-153391264 TAGGAGAAGCGGAAAGAGGAAGG + Intergenic
915790669 1:158666852-158666874 TAGGAGAAGCATAATGAGGTTGG + Intronic
916124945 1:161561043-161561065 TAGAAAATGCATGAAGAGCAAGG + Intergenic
916163278 1:161940909-161940931 TACAACAAGAATAAAGAGGAAGG - Intronic
917155428 1:171992753-171992775 TAGGACATACACAAAAAGAATGG - Intronic
917343120 1:174001043-174001065 TGGGACAGGCATAAAGAGAAGGG + Intronic
918534649 1:185560765-185560787 TCAGACAAGAATAAAGAGGAAGG + Intergenic
918830072 1:189384535-189384557 TAGGATATGGATATAGAAGAGGG - Intergenic
920206977 1:204299350-204299372 GAGGACAGGAAGAAAGAGGAGGG + Intronic
920475963 1:206276019-206276041 CAGGACAGGCAGAAAGATGATGG - Intronic
922029961 1:221788331-221788353 TAGGAGATTAATAAAGAAGACGG + Intergenic
923938464 1:238792166-238792188 AAGGACAGACATAAAGAGGTGGG + Intergenic
1063206354 10:3834611-3834633 AAGGACAGTCATACAGAGGAAGG - Intergenic
1063544168 10:6963673-6963695 TACCACATGCACACAGAGGAAGG - Intergenic
1064668400 10:17682154-17682176 TAGTACTTGCATAAGGTGGAAGG - Intronic
1066331300 10:34426383-34426405 AAGCACATGCAAAAAGTGGATGG - Intronic
1067819079 10:49510848-49510870 TAGGAAATGCAGCAAGAGGTAGG - Intronic
1067920361 10:50449559-50449581 AAGGACATGAAGAAAGTGGAGGG - Intronic
1072842712 10:98793201-98793223 TAGGACATGCATAAGGCTTAGGG - Intronic
1073507427 10:104011242-104011264 TAGGACATAAAAATAGAGGATGG + Intronic
1073712013 10:106054097-106054119 TAGTACATGCATAAAGACACTGG - Intergenic
1077349980 11:2088557-2088579 TAGGCCATACATAAAAATGATGG - Intergenic
1077716675 11:4588118-4588140 TAGCACATTCCTAAAGAGCAGGG - Intergenic
1077901452 11:6492936-6492958 GAGGGCATGAATAAAGAGCATGG - Intronic
1078092648 11:8276856-8276878 GTGGACATGCAGAGAGAGGATGG - Intergenic
1078712236 11:13805212-13805234 TAGAACATACATAATGAGTAAGG + Intergenic
1078963438 11:16307066-16307088 TAAGACATGTTTAAGGAGGAGGG + Intronic
1079281449 11:19090508-19090530 TTGGACATTCCTAATGAGGAAGG - Intergenic
1079300675 11:19276387-19276409 TAGGGCAAACATAATGAGGATGG + Intergenic
1081478281 11:43458531-43458553 TAAGACATGGGTGAAGAGGAGGG + Intronic
1082958414 11:58896248-58896270 TAGGTGATGCATGAAGAGGCTGG - Intronic
1085631769 11:78124041-78124063 GAGTACATCCATAAAGATGACGG + Exonic
1086231082 11:84570615-84570637 TAGGTCTTTCATAAAGTGGAAGG - Intronic
1087539372 11:99495595-99495617 TAGCACATGCATAAAGGCCATGG + Intronic
1087811459 11:102613042-102613064 TAATACATTCTTAAAGAGGAAGG + Intronic
1089870926 11:121672045-121672067 TAGGACATGAATGAAGAAGAGGG - Intergenic
1089960186 11:122610277-122610299 CAAGACATGCAGAAACAGGAGGG + Intergenic
1090934151 11:131326931-131326953 GAGGAGAGGCATCAAGAGGATGG - Intergenic
1091853280 12:3718289-3718311 GAGCTCATGCAAAAAGAGGAAGG - Intronic
1095182048 12:39157537-39157559 TAGGACATTCATGTAAAGGATGG + Intergenic
1096859042 12:54509861-54509883 GAGGAAATGCAAAGAGAGGAGGG - Exonic
1097269534 12:57765661-57765683 CAGGAAATGAGTAAAGAGGAAGG - Intronic
1102355127 12:112227548-112227570 TAGGACATGCACACAGGGGTTGG - Intronic
1106024208 13:25941391-25941413 TAGGCCATGCATGGAGGGGAGGG - Intronic
1107527292 13:41245884-41245906 CAGGACAGGGATAAAGAGGGAGG - Intronic
1107843383 13:44483791-44483813 AAGGACATGCAGAAAGATGCTGG + Intronic
1113016372 13:105832807-105832829 TGAGACAGGCATAAAGTGGAAGG + Intergenic
1114823140 14:26045791-26045813 TGGGAAAGGCATAAAGAGAAGGG - Intergenic
1115202264 14:30867682-30867704 TAGAACATGTATAAAGAACATGG + Intergenic
1115469861 14:33757342-33757364 TAAGACAGGGATGAAGAGGATGG + Intronic
1117219891 14:53592741-53592763 TAGGAGGTGAATAAAGAGAATGG + Intergenic
1118775851 14:68973617-68973639 TTGGTCATGCATGAAGAGGGAGG + Intronic
1122898370 14:104771671-104771693 TAGGACAGGCATTCAGGGGAGGG + Intronic
1124409266 15:29422460-29422482 TTGGACTTGAATAAAGAGAACGG + Intronic
1127126260 15:55814985-55815007 TAGTAAATGCATAAAGCTGAGGG - Intergenic
1127254079 15:57273604-57273626 TAGGAAAGACATAAAGAGCAGGG - Intronic
1130904693 15:88232181-88232203 TAGGACCTGGATAGAGAGGGAGG - Intronic
1131676436 15:94674977-94674999 TAGGACATGCATGATGTGGCTGG - Intergenic
1134470097 16:14517133-14517155 AGGGGCATGCATAAAAAGGAAGG - Intronic
1136640003 16:31556208-31556230 TAAGACATGCATACAGAGTTGGG - Intergenic
1136664761 16:31800334-31800356 TAAGACATGCACACAGAGGTGGG + Intergenic
1138248800 16:55486933-55486955 TAGTAAAAGCATAAACAGGAAGG - Intronic
1138313182 16:56045607-56045629 TAGGTAATGCAGAAAGAGGTAGG + Intergenic
1141076391 16:81009612-81009634 TAAGACAAAGATAAAGAGGAAGG - Intronic
1144354724 17:14434424-14434446 TAGGAGATGCATCCTGAGGAAGG + Intergenic
1146543174 17:33715446-33715468 TGAGACAAGCACAAAGAGGATGG + Intronic
1147260749 17:39208708-39208730 AGGGAGATGCAGAAAGAGGAGGG - Intergenic
1148644057 17:49209266-49209288 TAGGACTTGCCTCAGGAGGAAGG - Intronic
1149282600 17:55124883-55124905 TTGTACATGCACACAGAGGAGGG + Intronic
1150413335 17:64965632-64965654 TAGCAAATGCATAAAGAAGCAGG - Intergenic
1150798480 17:68259585-68259607 TAGCAAATGCATAAAGAAGCAGG + Intronic
1153752820 18:8250990-8251012 TAGTACATGCATATGGAAGAGGG - Intronic
1155848559 18:30740540-30740562 AAGAACATGGTTAAAGAGGATGG - Intergenic
1157132902 18:45024186-45024208 TGAGACAGGCATAAAGAGTAAGG + Intronic
1157453883 18:47809268-47809290 AAGGAACTGAATAAAGAGGAAGG - Exonic
1157601881 18:48897871-48897893 TAGGACCTGCTTAAAGAAAAGGG + Intergenic
1161861601 19:6802024-6802046 TAGGAGAGGCATTATGAGGACGG - Intronic
1165537620 19:36462614-36462636 TGGGACATGCAAAAACAGGGGGG + Intronic
926888571 2:17619724-17619746 GAGGAAATGCATAAGGAGGGAGG - Intronic
928885349 2:36142183-36142205 TTGTACATGCATATGGAGGAAGG - Intergenic
929769452 2:44879626-44879648 TAGGAGATTCATAGACAGGATGG + Intergenic
931183594 2:59928368-59928390 TAGGGCAAGCATTAAGAGGGAGG - Intergenic
931317627 2:61147472-61147494 GAGGACATGCAGCAAGAGGAAGG - Intronic
932591245 2:73069205-73069227 TCTGACTTGCAGAAAGAGGAAGG + Intronic
933292337 2:80451923-80451945 TAAGATAAGCATAAAGAGGAGGG + Intronic
936480744 2:112883034-112883056 GAGGACATCCATGAAGTGGAGGG + Intergenic
937674383 2:124573349-124573371 AAAGACATAGATAAAGAGGAAGG - Intronic
939328951 2:140733548-140733570 TAACACATGCAAAAACAGGAGGG + Intronic
940541794 2:155029799-155029821 TAGGACATGGATATATATGAGGG - Intergenic
941277392 2:163507175-163507197 TATAACATGCATAAAGTGTATGG + Intergenic
941343364 2:164336149-164336171 TAGGCCATGCATGTGGAGGAGGG + Intergenic
941390948 2:164914064-164914086 CAGGGCAGGCAGAAAGAGGATGG + Intronic
944141972 2:196466545-196466567 TAGGAAATGCATAGAGAAGCAGG + Intronic
944446000 2:199789900-199789922 CAGGACCTGCATAAAGAGGATGG + Intronic
1171235135 20:23518618-23518640 TGGGACATGCATCAAGATGGGGG + Intergenic
1172556097 20:35842715-35842737 GAGGGCTTGCATGAAGAGGATGG + Exonic
1174713312 20:52729749-52729771 TAGAAAATGCATAAACAGGCTGG - Intergenic
1175307595 20:57987662-57987684 TAGGAAATGCATAAACACGAAGG + Intergenic
1177530002 21:22346248-22346270 TAGGACTGGCTTAAGGAGGAGGG + Intergenic
1177842686 21:26252234-26252256 GAGGACATGCAAAAATAGGATGG - Intergenic
1178229235 21:30762050-30762072 TTGGACATGATGAAAGAGGAAGG - Intergenic
1179062272 21:37990010-37990032 TAGGACATGCAGAAAGTCTAAGG - Intronic
1179163170 21:38914574-38914596 TACGTCATCCATAAAGAAGAAGG + Intergenic
1184387344 22:44183541-44183563 TAGGTCAAGCATAAAGCAGAAGG - Intronic
949109507 3:242055-242077 TAGGATATACATATAGTGGAGGG - Intronic
951076813 3:18403895-18403917 CAGGACATGCACAAAGGGGTGGG - Intronic
953191729 3:40694190-40694212 TAGTCCATGCACAAAGAGGAGGG - Intergenic
953369311 3:42373651-42373673 TAAGACATGCACAATCAGGAAGG + Intergenic
953896072 3:46802946-46802968 TAGCACATGCATAAATATGGAGG - Intronic
954645743 3:52130586-52130608 GAGGACATGCAGAGAGAGAACGG - Intronic
956259651 3:67324809-67324831 TAGGAAATGGAAAAAGAAGATGG + Intergenic
957395905 3:79637667-79637689 TAAGATATATATAAAGAGGATGG + Intronic
959019962 3:101178075-101178097 CAGAACATGTATCAAGAGGAGGG + Intergenic
959912542 3:111779806-111779828 TAGCAAAGGCAAAAAGAGGATGG - Intronic
960233162 3:115252780-115252802 TAGCACATGTAGAAAGTGGAAGG + Intergenic
961559803 3:127720816-127720838 TAAAACATGCACAAACAGGAAGG + Intronic
962193317 3:133334048-133334070 TTGGACCTGCAAAATGAGGATGG - Intronic
962258583 3:133888405-133888427 CAGGAAATGCATAAAAAGAATGG - Intronic
963057929 3:141202389-141202411 TAGGACATGCAGGAGGAGGAAGG + Intergenic
963583718 3:147158442-147158464 AAGGACATTAATAAAGAGCATGG - Intergenic
965186283 3:165468495-165468517 TTGGACAAGCAGGAAGAGGAAGG - Intergenic
965247215 3:166288485-166288507 TACTACATGCTTAAGGAGGAAGG + Intergenic
965367982 3:167822353-167822375 TAAAACAGGCATAAATAGGAAGG + Intronic
969323668 4:6428117-6428139 TAGGACATGCATAAAGAGGAAGG - Intronic
969978172 4:11126433-11126455 TAGGACATGTTAAAAGAAGAAGG + Intergenic
970867887 4:20780042-20780064 TAGGACATGGATAAGGAAGTAGG + Intronic
971136004 4:23869202-23869224 TACGACAGCCATAAAGAGAAAGG + Intronic
971960085 4:33474676-33474698 TGGGACCTGGAGAAAGAGGATGG - Intergenic
973309514 4:48693397-48693419 TGGGACCTGCAGAAAGAGGGTGG + Intronic
975490881 4:74987128-74987150 TATCACATGCATAAAAAGAAGGG - Intronic
975803212 4:78084679-78084701 CAGGAAATGTATGAAGAGGACGG - Intronic
976348418 4:84031508-84031530 AAGGACAGGGATAAAGAGCACGG - Intergenic
976554946 4:86439450-86439472 TGGTACATCCATAAAGTGGAAGG - Intronic
977257169 4:94754225-94754247 GAGGATATCCATGAAGAGGAAGG + Intergenic
979016200 4:115436923-115436945 TAGGACCTGCATTAATAGGGAGG - Intergenic
979566129 4:122155965-122155987 TAACATATGCATAAAGATGATGG - Intronic
980017216 4:127663817-127663839 TAGGAAAAGAAAAAAGAGGAAGG + Intronic
980999765 4:139817552-139817574 TAGGACATGTAAACAGAGGGAGG - Intronic
983563217 4:169122273-169122295 TAGGAAAAACATAAAGAGAAAGG + Intronic
983874158 4:172856920-172856942 TAGGACTTTAATAAATAGGAAGG + Intronic
985846398 5:2352760-2352782 TAGGACATAGATAGATAGGAGGG - Intergenic
986442744 5:7796156-7796178 TACTTCATGCATAAACAGGATGG + Intronic
987623285 5:20364753-20364775 ATGCACATGCATAAATAGGATGG + Intronic
987665510 5:20933323-20933345 GAGGACGAGGATAAAGAGGAAGG + Intergenic
988019868 5:25608691-25608713 TAGGAGATGCACAAATTGGAAGG - Intergenic
988537173 5:32079487-32079509 TAGGACAGCCCTAAAAAGGAAGG - Intronic
988757185 5:34268855-34268877 GAGGACGAGGATAAAGAGGAAGG - Intergenic
990029088 5:51234188-51234210 GAGAGCATGCATAAAGAAGAAGG + Intergenic
993292069 5:86086265-86086287 AAGGATAAGCATAAAGAAGAAGG + Intergenic
993339681 5:86708000-86708022 TAGGAAAAACATAGAGAGGAGGG + Intergenic
995531157 5:113093141-113093163 TAGGACATGCACAAAATGGGGGG + Intronic
996503391 5:124241690-124241712 TAGGACAGGCCTAATGAGGCAGG + Intergenic
997339171 5:133129240-133129262 TAGGACATGAAAAAGGAGAATGG - Intergenic
998007119 5:138664484-138664506 TAGGACATGGATACAGATAAAGG - Intronic
998437673 5:142126956-142126978 TAGGACCTAGATACAGAGGAAGG + Intronic
1000346340 5:160317507-160317529 TAGTACATGCAAACAGAGAACGG - Intronic
1000927430 5:167210782-167210804 TAGAAAATGCATGTAGAGGAAGG - Intergenic
1004586990 6:17012275-17012297 TGGGACATGGAGAAAGAAGAGGG - Intergenic
1006204692 6:32330088-32330110 TAGGACATGAGGAAAGAGAAAGG + Intronic
1006313234 6:33276159-33276181 TAGGACCTGGATTCAGAGGAGGG - Exonic
1010856310 6:80844561-80844583 TAGGACTTGCATTAAGATAAGGG - Intergenic
1010939273 6:81896515-81896537 TGGGACATGCTTTAAAAGGAAGG - Intergenic
1011931113 6:92714728-92714750 TAGAGCATGCAAAAAGGGGAGGG + Intergenic
1013078299 6:106790283-106790305 TAGCACTTGAAGAAAGAGGATGG + Intergenic
1015441975 6:133259111-133259133 TAGGAAATGCATTAAGTGGAAGG - Intronic
1016898186 6:149074576-149074598 TAGGACATCGAAAAGGAGGATGG + Exonic
1018492117 6:164304529-164304551 TAGGACATAGAGAAAGAGGGAGG - Intergenic
1019398852 7:839318-839340 TACCACATGTGTAAAGAGGAAGG + Intronic
1020669873 7:11093565-11093587 TAGCACAGGCATACAGAGAAAGG - Intronic
1022059407 7:26776433-26776455 TAGGTCAGTCATACAGAGGAAGG - Intronic
1025860296 7:65320709-65320731 AAGGAAATGCGGAAAGAGGATGG - Intergenic
1026176489 7:68002187-68002209 TAGGACTTGAATGAAGAGAAAGG - Intergenic
1030723407 7:112897028-112897050 TAGTGCACACATAAAGAGGAAGG + Intronic
1031379941 7:121073324-121073346 GAGGAGATGGAAAAAGAGGAGGG + Intronic
1037648310 8:20813852-20813874 TAGGACAGGAATATGGAGGATGG - Intergenic
1038525331 8:28268011-28268033 TAGGACATGCATCAGGGGCAGGG + Intergenic
1038949329 8:32397082-32397104 TAGGAGATGGATAAATAGGTAGG + Intronic
1038976068 8:32697647-32697669 TAGCACATACATAAATAGGTTGG - Intronic
1042409362 8:68445019-68445041 TAGGCCATTCAAAAAGAGAATGG - Intronic
1042917814 8:73892580-73892602 TAGGACATGTATGGAAAGGAAGG + Intergenic
1045065460 8:98439997-98440019 TAGGACTTGCAGGGAGAGGAGGG + Intronic
1046644964 8:116776100-116776122 TAGCACATTGATAAAGAGCAGGG - Intronic
1046653807 8:116871757-116871779 TAGGACAGTCATGAAGAGGTTGG - Intronic
1047824052 8:128553706-128553728 TTGGACAAGCATAAATAGCAAGG - Intergenic
1050500619 9:6294298-6294320 TTGGAGATTCAGAAAGAGGAAGG - Intergenic
1052643054 9:31194063-31194085 TAGGATTTCCATAAAGAGAAAGG - Intergenic
1056392149 9:86150269-86150291 TAGGCAAAGCATAAATAGGAAGG + Intergenic
1056898286 9:90572255-90572277 ATGTACATACATAAAGAGGAAGG + Intergenic
1057056725 9:91967756-91967778 TAGCACATATATTAAGAGGATGG + Intergenic
1058135284 9:101300500-101300522 TAGGAAATGCATCAAGCAGAGGG + Intronic
1058472939 9:105299719-105299741 TAGGACAGGCAGAAGGAGGAAGG - Intronic
1058858734 9:109093117-109093139 TAAGATATGCGTAAAGTGGAGGG + Intronic
1186222250 X:7362528-7362550 AAGAACATGCATACAAAGGAGGG + Intergenic
1186652933 X:11580405-11580427 TAGGACAGGAAGAAAGGGGAGGG - Intronic
1188642513 X:32523768-32523790 TATGACCTGTATAAGGAGGAAGG + Intronic
1189163940 X:38840289-38840311 ATGGACAAGCATAAAGAGGTGGG + Intergenic
1190593843 X:52033123-52033145 TAGAACATGAAGAAAGAGCAAGG + Intergenic
1192153620 X:68727004-68727026 TAGGAGATGGATAAAGAGGAGGG + Intergenic
1193476646 X:81974284-81974306 GAGGACATGGAGAAATAGGAAGG + Intergenic
1194138977 X:90184234-90184256 TAAGAAATGGAAAAAGAGGAGGG + Intergenic
1195909880 X:109878427-109878449 TAGGCCTTTTATAAAGAGGAAGG - Intergenic
1196076489 X:111583270-111583292 TAGCAGATGAATAAACAGGAAGG + Intergenic
1196101722 X:111853858-111853880 CAGGAGAAGCATAAAGAGGAAGG + Exonic
1198795237 X:140387530-140387552 TAGGATATTCATACAGATGAAGG - Intergenic
1199585167 X:149407086-149407108 AAGGAGATGCAAAAAGAAGAAGG + Intergenic
1200324102 X:155219671-155219693 TGGGAAATGCATAAAGTGGTGGG + Intronic
1200484775 Y:3754465-3754487 TAAGAAATGGAAAAAGAGGAGGG + Intergenic
1200890817 Y:8322201-8322223 TAGGACAGGCACAAAGATGGTGG + Intergenic