ID: 969324450

View in Genome Browser
Species Human (GRCh38)
Location 4:6432961-6432983
Sequence TTTTCTGTTCATTAAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 1, 2: 14, 3: 47, 4: 348}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969324450 Original CRISPR TTTTCTGTTCATTAAGTGGA AGG (reversed) Intronic
900551666 1:3259501-3259523 TTTTCTCATGATTATGTGGAGGG - Intronic
900935317 1:5762404-5762426 TATTTTGTTCATTTACTGGAAGG - Intergenic
901916796 1:12506343-12506365 TTTTCTGAACATGAAGTGGATGG + Intronic
902672299 1:17983255-17983277 TTTTCTGTTCATGAAGTCACTGG + Intergenic
904016097 1:27422091-27422113 TTTCCTGCTCCTTAAGTGAAGGG + Intronic
904783135 1:32965219-32965241 ATTTCTGTTTATTAAGCAGACGG + Intergenic
905581313 1:39084356-39084378 TTTTCTGCTCATGCAGTGGCAGG - Exonic
907228149 1:52968977-52968999 GTTACTATTCATTAAGTGGAAGG + Intronic
907971273 1:59384011-59384033 TTTTGGGTTCACAAAGTGGAGGG + Intronic
908386751 1:63650167-63650189 GCTTTTGTTCAGTAAGTGGAAGG - Intronic
908711971 1:67025680-67025702 TTTTATGTTTATTAATTAGATGG - Intronic
909076764 1:71058429-71058451 TTTTCTGTTTCTTAAGTCCAAGG - Intergenic
909288321 1:73849594-73849616 TCTCATGTTCATTAATTGGAAGG - Intergenic
909908142 1:81224270-81224292 TATTCTGTTCATTGCTTGGAAGG + Intergenic
910439825 1:87240779-87240801 ATTTCTTTCCAATAAGTGGATGG + Intergenic
910900737 1:92117919-92117941 TTTTCTAATTATTAAATGGAAGG + Intronic
912185939 1:107275705-107275727 TGTTCTATTCACTAACTGGATGG + Intronic
916481697 1:165220169-165220191 TTTTATGTTCCTTAAGAGCAAGG - Intronic
916483826 1:165239477-165239499 TTTTGTCTTCATAAAGTAGATGG - Intronic
916521525 1:165567778-165567800 TTTTCTGAGAATTAAGTGCAGGG - Intergenic
917463589 1:175254488-175254510 TTTTTTTTTTTTTAAGTGGAAGG + Intergenic
917518515 1:175728874-175728896 TCTTCTGTTCCTTAAGTAGGAGG - Intronic
918448013 1:184633711-184633733 TTTTCTGTTTATTCAGTGGAGGG - Intergenic
919515647 1:198519106-198519128 TTTTCTTTTCTTTAAGTTTAGGG + Intergenic
920046215 1:203134272-203134294 TTTTCTGTTCCTTGAGGGGCGGG - Intronic
920082758 1:203387701-203387723 TTGTCTTTTCATTTAGTAGATGG + Intergenic
920128904 1:203715561-203715583 TTTTCTTTTCATTATATGGGGGG + Intronic
920401197 1:205677670-205677692 TTTTCTGTTTTTTAAGAGCAAGG + Intronic
921220195 1:212968230-212968252 CTTACTGTTCAATAAGTGAAAGG + Intronic
921503207 1:215932449-215932471 TTTTCAGATCATTAAGTAAAAGG + Intronic
921589848 1:216990648-216990670 TTTACTATTAGTTAAGTGGAAGG - Intronic
922503562 1:226113722-226113744 TTGTTTGTTCATTTAGTGGCTGG + Intergenic
923176198 1:231468125-231468147 TTTTCAGTTCTTTAAGTGACGGG + Intergenic
923715755 1:236423719-236423741 TTTTCTAGTCACTAATTGGATGG + Intronic
923880248 1:238095898-238095920 ATTACTATTCATCAAGTGGAAGG - Intergenic
924005378 1:239604171-239604193 TTTTGTGTTCCTTAAGTTAAAGG + Intronic
1063843320 10:10096601-10096623 TTTTCTCATCTCTAAGTGGAAGG + Intergenic
1064762287 10:18633624-18633646 TTTTTTTTTCACTAAGTGCATGG - Intronic
1065549111 10:26852579-26852601 ATTTCTGATGTTTAAGTGGAGGG + Intronic
1065812263 10:29452977-29452999 TTTTCTTTTCAAAAAGAGGAAGG + Intergenic
1067457317 10:46428447-46428469 TTTTCTTTTTAATAAGTAGAAGG - Intergenic
1067629885 10:47956191-47956213 TTTTCTTTTTAATAAGTAGAAGG + Intergenic
1067989214 10:51191128-51191150 TTTTCTGTTAATAATCTGGATGG - Intronic
1068007142 10:51405097-51405119 ATTTGCCTTCATTAAGTGGAGGG + Intronic
1069296424 10:66850873-66850895 ATTTCTGTTCATTAATCTGAAGG - Intronic
1069482252 10:68794378-68794400 TTGTATATTCATTCAGTGGATGG + Intergenic
1069844078 10:71358601-71358623 TCCTCTGTTCATTCAGTGGCTGG - Intronic
1070456422 10:76621639-76621661 ATTTCTTTACATTAAGTGCAAGG + Intergenic
1074026359 10:109640079-109640101 TTTTATTTTTATTAAGGGGAAGG + Intergenic
1074342768 10:112650462-112650484 TTTTTTTTTAAATAAGTGGAAGG + Intronic
1074399439 10:113129702-113129724 TTTTCAGTTCTTTAAGTGAAAGG + Intronic
1078195889 11:9136749-9136771 TTTTCTCTTCATTTATTAGATGG - Intronic
1078929397 11:15901552-15901574 TTTCCCTTTCATTATGTGGAAGG - Intergenic
1079121150 11:17686117-17686139 TTTTCTTTTCTTTAAGGTGAGGG + Intergenic
1080312422 11:30910564-30910586 TATTCTGTTCAACAAGAGGATGG + Intronic
1080621110 11:33987814-33987836 CTTTTTCTTCTTTAAGTGGAAGG + Intergenic
1081043735 11:38245335-38245357 TTTTCTGTACATTAAGAAAAAGG + Intergenic
1081493060 11:43581817-43581839 TTTTCTTTGCATTGAGTGAATGG - Intronic
1081714770 11:45241956-45241978 TTTTCTGTTTTTTCAGAGGATGG + Exonic
1082307887 11:50605262-50605284 GTTTCTGTCCATTCAGTGAAAGG + Intergenic
1082577495 11:54826877-54826899 TTTTTTGTCCATTATGTGAATGG + Intergenic
1082593756 11:55048404-55048426 GTTTCTGTTCATTTTGTGAATGG - Intergenic
1082669340 11:56015260-56015282 TTTTCTATGCATTCAGGGGAGGG - Intergenic
1084932826 11:72570726-72570748 TTTCCTGTCCATTAACTTGAAGG - Intergenic
1085305538 11:75483526-75483548 TTTTCTGATCATGAAGTGCCTGG + Intronic
1085874309 11:80387577-80387599 TTGTCTCTGCATTGAGTGGAAGG - Intergenic
1087466083 11:98508106-98508128 CTTTCTCTCCATCAAGTGGAGGG + Intergenic
1088583657 11:111338428-111338450 TTCTCTATAGATTAAGTGGAAGG - Intergenic
1088998410 11:115026253-115026275 TCTTGTGTTCATGAATTGGAAGG + Intergenic
1092388614 12:8055139-8055161 TTTTCATTTCATGAAGGGGAGGG - Exonic
1092555145 12:9551344-9551366 TGTTCTTTTCTTTAAGAGGACGG - Intergenic
1092569614 12:9708292-9708314 TTTTCTGTTTTTTAAGTGAGAGG + Intergenic
1092677554 12:10938832-10938854 TTTTCTCTACCTAAAGTGGAGGG - Exonic
1093090797 12:14918064-14918086 TTGAGTGTTCATTACGTGGAAGG + Intronic
1093340765 12:17970769-17970791 TTTTATGTTCATTGACTGGAAGG - Intergenic
1094221537 12:27998873-27998895 TTTTCTCTTCCTTAGGGGGAGGG + Intergenic
1095270998 12:40218913-40218935 TTTACTGTTTATTAAGTGAAAGG - Intronic
1095397033 12:41772999-41773021 ATTGCTGTTCATTAAGAAGATGG - Intergenic
1096945447 12:55402521-55402543 TTCTCTGATCATTATGTGCATGG - Intergenic
1098085597 12:66839177-66839199 TTTTCTGTTCAATAAATGCAGGG - Intergenic
1098815316 12:75153804-75153826 TTTATTATTCACTAAGTGGAAGG + Intronic
1099105336 12:78488807-78488829 TTTTCTTTTCATTAATTAGTAGG + Intergenic
1100255834 12:92882014-92882036 TTTACTATTCTTTAAGTGGAAGG - Intronic
1100345266 12:93723862-93723884 GTTTCTGTTCATCACATGGAAGG + Intronic
1100464228 12:94831346-94831368 TTTTCTGGTCAGTGAGTGGAAGG + Intergenic
1100873427 12:98937439-98937461 TGTTCAGTTCATTAAGTAGAAGG - Intronic
1101085326 12:101229942-101229964 TTTCCTCTTCAGTAAATGGAAGG + Intergenic
1101710163 12:107257439-107257461 TTTACTGTTCATTAAGATGGCGG - Intergenic
1103893575 12:124257883-124257905 ATCTCTTTTCATTAAGTGGCAGG - Intronic
1104166373 12:126234153-126234175 ATTACTGGTCATTAAGAGGAAGG - Intergenic
1104204380 12:126623108-126623130 TTTTTTTTTAAATAAGTGGAAGG + Intergenic
1104811987 12:131624835-131624857 TGTTCTGGTAATTAATTGGATGG + Intergenic
1105987745 13:25585726-25585748 TTTCTTGTTCATTAAAAGGAAGG + Intronic
1106008843 13:25798360-25798382 TTTTCTGTTTGTTTAGGGGAGGG + Intronic
1106625470 13:31416679-31416701 TCTACTCTTCATTAAGTGCAAGG - Intergenic
1106929461 13:34648214-34648236 TTTTTTGTCAGTTAAGTGGATGG + Intergenic
1107982424 13:45746283-45746305 TTTTTTCTTCCTTAAGTGGAAGG - Intergenic
1108866761 13:54933223-54933245 TCTTCTGTTCCTTAAGTTAAAGG + Intergenic
1109704374 13:66070896-66070918 TTTTCTCTTCATTATGTGAAAGG - Intergenic
1110121304 13:71885055-71885077 ATTTCTGTTGATTAAGTTGCTGG + Intergenic
1112720733 13:102241719-102241741 CTCTTTCTTCATTAAGTGGATGG - Intronic
1112855045 13:103758000-103758022 TTTATTATTCATTAGGTGGAAGG - Intergenic
1114412851 14:22517085-22517107 TTTTATCTTCATTTTGTGGATGG - Intergenic
1114752981 14:25226833-25226855 ATTTCTTTTTATTAAGTAGATGG + Intergenic
1115632614 14:35260414-35260436 TTTTCTCTTCCTTATGTTGAGGG - Intronic
1116213731 14:41982478-41982500 TTTTCTCATCTTTAATTGGAAGG + Intergenic
1116481011 14:45391737-45391759 TTTTCTATTCCTCAAGTGGAAGG - Intergenic
1116855923 14:49952334-49952356 TTTTCTTCTCCTTAAGTGGTTGG + Intergenic
1117757016 14:58985670-58985692 TTTTCTATTCATTAATTGGGAGG + Intergenic
1117825653 14:59700256-59700278 TCTTATGTTCATGAATTGGAAGG + Intronic
1118079830 14:62345805-62345827 TTTACTTTTCATTAAGTAGCTGG + Intergenic
1118102336 14:62621038-62621060 TTTTAAGTTCATTAAGGGAATGG - Intergenic
1118697710 14:68400904-68400926 TTTTCCTTTCCTTAAGTAGAAGG + Intronic
1120230028 14:81831885-81831907 TTTTCTGTTTATTATGTGTCAGG + Intergenic
1120458568 14:84764110-84764132 TTTCCTGTTCAGGAAGTGGTAGG + Intergenic
1120506950 14:85364752-85364774 TTTACTACTCATTAAGTGCAAGG + Intergenic
1121156493 14:91689945-91689967 TTTTGTGTTTAATAATTGGATGG - Intronic
1124395683 15:29299831-29299853 TTAGCTGTTGATTAAATGGATGG + Intronic
1125639257 15:41216058-41216080 TTTGCTGCTCAGTAAGGGGAGGG + Intronic
1126006909 15:44266516-44266538 TTTTCTTTTCATTCAGCTGAGGG + Intergenic
1127265461 15:57357279-57357301 TTTACTGTTCATTAAGTAGAAGG - Intergenic
1127354682 15:58186903-58186925 TTTTCGATTCATGAGGTGGAGGG - Intronic
1127555847 15:60086780-60086802 ATTGCTGTTCATTAATTGCAAGG + Intergenic
1127827489 15:62717842-62717864 GTTTTTGTCCATTAAGTGGATGG + Intronic
1128376493 15:67080171-67080193 TGTGCTGTTGCTTAAGTGGAAGG + Intronic
1128445167 15:67752719-67752741 TTTTGTGTTCATGAAGTGGGAGG + Intronic
1130240055 15:82179689-82179711 TTTACTTTTCTTTCAGTGGAGGG - Intronic
1130602662 15:85287366-85287388 AGTTCTTTTCATTCAGTGGATGG - Intergenic
1131314470 15:91321294-91321316 TTTTCTGTTCATTTTATAGATGG + Intergenic
1131443219 15:92474368-92474390 TTTACTGATCATTGAGTGGCTGG - Intronic
1131571132 15:93537582-93537604 GTTTCTCATCATTAAGTGGGAGG - Intergenic
1131754861 15:95548824-95548846 TTTTCTCTTCCTTCAGTGCAGGG + Intergenic
1132334792 15:101039858-101039880 TTTTCTGTTAAATATGTTGATGG + Intronic
1132507203 16:317096-317118 GGTTCTGTTCATCAGGTGGATGG - Intronic
1134320235 16:13156042-13156064 TCTGCTGTTTCTTAAGTGGATGG + Intronic
1135162200 16:20106779-20106801 TTTTGATTTTATTAAGTGGAAGG - Intergenic
1137776810 16:51062148-51062170 TTTGCTGTTCAATACGTAGATGG + Intergenic
1140636423 16:76920145-76920167 TTTTCTGACCATTGAGAGGAGGG + Intergenic
1141020604 16:80492536-80492558 TTTTCTGTTGATGAAGCTGAGGG - Intergenic
1141319525 16:82994233-82994255 TTTTCTGTTCAGTTCTTGGATGG + Intronic
1141547459 16:84780646-84780668 TTTTCTGTCCTCTAAGAGGATGG + Intergenic
1142122089 16:88391527-88391549 TGTCCTCTTCATCAAGTGGAGGG + Intergenic
1203012218 16_KI270728v1_random:306144-306166 TTTTCTGTTCATTCGATGAATGG + Intergenic
1203030553 16_KI270728v1_random:579303-579325 TTTTCTGTTCATTCGATGAATGG + Intergenic
1203041168 16_KI270728v1_random:755128-755150 TTTTCTGTTCATTCGATGAATGG - Intergenic
1142946193 17:3430473-3430495 TTTTCTGTTCATCCTGTTGATGG - Intergenic
1145044479 17:19602315-19602337 TTTTCCGTTCAGTGAGTGTAAGG - Intergenic
1147299058 17:39509438-39509460 TTTTTTGTTTTTTAAGTGTAAGG + Intronic
1148997354 17:51722797-51722819 TTTTCCCTTCATAAAATGGAGGG - Intronic
1149712771 17:58757264-58757286 TTTTCAGTCCATTAAGTAGATGG + Intronic
1150067338 17:62122477-62122499 ATTTCTCTTTATTAATTGGATGG + Intergenic
1151216168 17:72577826-72577848 TTTACTATTCATTAAGTGGAAGG - Intergenic
1153496099 18:5701755-5701777 TGCTCTGTTCAACAAGTGGAAGG + Intergenic
1158330305 18:56355145-56355167 TTTTCTTTTCATTAATTCCATGG + Intergenic
1158330538 18:56357430-56357452 TTTTCTTTCCATTGGGTGGAGGG + Intergenic
1159273593 18:66186887-66186909 TTTTCTGTTCATTAAGGAGAAGG - Intergenic
1160016358 18:75143764-75143786 TCTTCAGTACATAAAGTGGAGGG + Intergenic
1160452665 18:78976238-78976260 TTTTTTTTGCATTAAGTGGTTGG + Intergenic
1164914017 19:32035462-32035484 TTTTCTGTTCTTTCAGAAGATGG - Intergenic
1165265848 19:34663536-34663558 TTTTCTGTTATTTTAGTGGATGG - Intronic
1166242067 19:41501306-41501328 TTTTCTTTTCACTCAGTGGAAGG - Intergenic
1166609796 19:44180926-44180948 TTTTCTTTTCAGTCAGTGGAAGG + Intergenic
1167623059 19:50569284-50569306 TCTTCTCTTCATGAGGTGGAGGG - Intergenic
925096664 2:1210055-1210077 TTTACTGGTCCTTAAATGGAAGG + Intronic
926401489 2:12501621-12501643 TTGCCTGTTCAGTCAGTGGAGGG - Intergenic
926675588 2:15617206-15617228 TTTAGTTTTCATTAAGTGGTTGG + Intronic
927711808 2:25330792-25330814 TTTTCTTTTTAATAAGGGGAGGG - Intronic
927924009 2:26996845-26996867 TTTTCTGTTCCTCAGGTGAAGGG - Intronic
928697024 2:33859648-33859670 ATGTCTGCTCATTAAGTGGAAGG - Intergenic
930194769 2:48498010-48498032 TTATATTTTAATTAAGTGGATGG + Intronic
930242154 2:48947065-48947087 TTTCCTGTTCTTTTAGTGGTGGG + Intergenic
930751684 2:54940552-54940574 TTTGCTGTGTATTAAGTGTAAGG - Intronic
932082604 2:68728852-68728874 TTATCTGTTCATTTAGTGGATGG - Intronic
932998403 2:76886189-76886211 TTTTCTGTTCATATAATGAAGGG + Intronic
933018264 2:77159573-77159595 TTTACTATTCATTAAATGAAAGG + Intronic
933098292 2:78216360-78216382 TTTTGTGTTCATTTTGTTGATGG - Intergenic
935230664 2:101093070-101093092 TTTACTATTCATTAAGTGGAAGG - Intronic
936680130 2:114760326-114760348 ATTTCTGTTAATTAATTGGCTGG - Intronic
936841098 2:116770380-116770402 CTTTCTTTTCATTCAGAGGATGG - Intergenic
937446823 2:121965613-121965635 TTTTAGGTTCATTAAATGTAAGG - Intergenic
938149197 2:128867387-128867409 TTAATTGTTCATTAAGAGGAAGG + Intergenic
938560628 2:132469354-132469376 ATTTCTGTTCATTTAATGAAAGG + Intronic
939702972 2:145417315-145417337 TTTCCTTTTCATAAAGTGGGGGG + Intergenic
940060340 2:149558902-149558924 TTTACTCTTTATTAAGTGGAAGG - Intergenic
940065657 2:149625137-149625159 TTTTCTGCTCATACTGTGGAAGG + Intergenic
941613733 2:167694607-167694629 TTTTCTGTTCATCAAGGAGAAGG + Intergenic
942259786 2:174147988-174148010 TTTTCTGTACTTTCAGTAGACGG + Intronic
943878465 2:193105586-193105608 TTTTAAGTTCATTAGGTCGAAGG - Intergenic
943898571 2:193401974-193401996 TTTTTTTTTCATAAAGTGTAAGG + Intergenic
944361149 2:198858642-198858664 TTTCATGTTCATGGAGTGGAAGG + Intergenic
945655282 2:212615886-212615908 TTTTCTGTTTCTGAAGTGAAAGG + Intergenic
945766774 2:213990608-213990630 TTTACTATTCATTAAGTGGAAGG + Intronic
945855251 2:215061440-215061462 TTTTCTGTTCTATAAGTGAGGGG - Intronic
946469877 2:219948948-219948970 TTTACTGTACTTTAAGTAGATGG + Intergenic
946717061 2:222563846-222563868 TTTACCCTTCATTAAGTGGAAGG + Intergenic
947080787 2:226393812-226393834 TTTTCTGTTGATGAATTAGAAGG - Intergenic
947276598 2:228398462-228398484 TTTTGTGTTCATTTAGTCCAGGG + Intergenic
948250031 2:236519968-236519990 TTGACTGTTCATTAAATGGAAGG + Intergenic
948904534 2:240972332-240972354 TGTTCTGTTCCTGAAGTGGGCGG + Intronic
1169010368 20:2245175-2245197 TGTTCTGTGCAGGAAGTGGAGGG + Intergenic
1170210835 20:13844955-13844977 TCTTCTGGTCACTTAGTGGATGG - Intergenic
1170348092 20:15409295-15409317 TTTTCTGTATATTAAGTTGCAGG + Intronic
1170528949 20:17269880-17269902 TTTTATTTTCCTTAATTGGAGGG - Intronic
1171732674 20:28729570-28729592 GTTTCTTTTCATTGAGTAGATGG + Intergenic
1173398562 20:42703656-42703678 TTTTCTGTGTAGTAAATGGAAGG - Intronic
1173795407 20:45856299-45856321 TTTACAATTCCTTAAGTGGAAGG + Intronic
1174940120 20:54917716-54917738 TTATCTGTTCTTAAAGTGGGCGG - Intergenic
1176531072 21:7958642-7958664 GTTTCTTTTCATTGAGTAGATGG + Intergenic
1179001211 21:37460505-37460527 CATTCTTTTCATTAAGTGGTTGG + Intronic
1180894165 22:19316218-19316240 TTTTCTTCTCCTTATGTGGAGGG - Intergenic
1181614703 22:24045461-24045483 TTTTTTTTTCATTAACTGGGTGG + Intronic
1181719907 22:24766028-24766050 TTTTTTTTCCATTAAGTTGAAGG - Intronic
1182928358 22:34148975-34148997 TCTTCTATTCATTCAGTTGATGG - Intergenic
1185261854 22:49870762-49870784 TTTTCTGTTTATTCTGTCGATGG + Intronic
949716926 3:6943862-6943884 ATGTTTGTTCATTAAGTGTACGG + Intronic
950093481 3:10314014-10314036 TTTTCTGTGCATTCTGGGGAAGG + Intronic
950135508 3:10577892-10577914 TTTTCTGCACAGGAAGTGGATGG - Intronic
951547382 3:23840953-23840975 TTTTTTGTTGTTTAAGTGGTAGG + Intronic
954297297 3:49681360-49681382 TTTTCTGTTCCTCTTGTGGATGG + Intronic
954975831 3:54693546-54693568 TTTTCTTTTCAATAAGTAGATGG - Intronic
955649810 3:61181886-61181908 ATTTCTGTTCTATAAGTGTATGG + Intronic
956219694 3:66888877-66888899 TGGTCTGTTCATTCAGTGAAAGG + Intergenic
956339518 3:68206198-68206220 TTATGTGTTTATTAAGGGGATGG + Intronic
956829982 3:73037131-73037153 TCGTCTGTGTATTAAGTGGAGGG - Intronic
957019070 3:75103718-75103740 TTCTGTGTTCATTGATTGGAAGG - Intergenic
957235343 3:77581737-77581759 TTCTCTGTTTTTTCAGTGGAAGG + Intronic
957351791 3:79032934-79032956 ACTTCTGTTCATTAACTAGATGG + Intronic
957454801 3:80427803-80427825 TTTTATGTTCATGGATTGGAAGG + Intergenic
958760113 3:98296642-98296664 CTTTCTGCTCCTCAAGTGGAAGG - Intergenic
958974783 3:100655158-100655180 TTTTCATCTCATTAATTGGATGG + Exonic
959153872 3:102642126-102642148 TTTTCTGTTCACATAGTGGAAGG - Intergenic
959241368 3:103799263-103799285 TTTTCTGTTTATTTAGTCTATGG + Intergenic
960193813 3:114740642-114740664 TTTTTTGTTCATTAAATTCAAGG - Intronic
960405256 3:117252061-117252083 TTTTCTATAAATTAAGAGGAAGG - Intergenic
961874259 3:130009598-130009620 TTTTCTATTGATTAAGAGGCTGG + Intergenic
964664544 3:159157741-159157763 TTGTATGTGCATAAAGTGGAAGG - Intronic
964785931 3:160396495-160396517 TTTTCAGTTCTTTAAGTGCAAGG - Intronic
965019547 3:163210910-163210932 TTTGCTGTTCATTTATTGGGAGG + Intergenic
965490629 3:169331228-169331250 TTTTCTCTTTATTAACTGTATGG - Intronic
967382927 3:188880613-188880635 TTCTCTGGCCCTTAAGTGGATGG - Exonic
967604312 3:191426037-191426059 TCTTCTCTTCATAAAGTTGAAGG - Intergenic
968386575 4:144624-144646 TTTTATGTTCATGAATAGGAAGG - Intronic
969324450 4:6432961-6432983 TTTTCTGTTCATTAAGTGGAAGG - Intronic
970964091 4:21908008-21908030 TTTTTTGTTCATTAAATGGGAGG + Intronic
971914613 4:32851610-32851632 TTCTCTTCTCCTTAAGTGGAAGG + Intergenic
972236453 4:37139206-37139228 GTTCCTGCTCATTAAGTGGAAGG - Intergenic
972310220 4:37874701-37874723 ATTTCTGGTGATTAAGGGGAGGG - Intergenic
972931824 4:44081210-44081232 TTTCCTCTTCATCAAGGGGAAGG - Intergenic
974516915 4:62927710-62927732 TTTCAAGTTCAGTAAGTGGAAGG + Intergenic
974937729 4:68428419-68428441 TTTTCTGTTTATCAAGAGTAAGG - Intergenic
975241513 4:72065637-72065659 TTTGCTATTCATTAAATGCAGGG + Intronic
976090541 4:81452764-81452786 TTTTCTCTTCCTTAAGGGGCTGG - Intronic
976676533 4:87709796-87709818 CTTTCTGTTAATTAGGGGGAGGG - Intergenic
976681366 4:87759752-87759774 TTTTATGTTAATTCAGTGGTGGG - Intergenic
977232060 4:94463474-94463496 TTTACTGTTCATTAAGTGGAAGG + Intronic
977349624 4:95865306-95865328 TATTCTCTTTATAAAGTGGAGGG + Intergenic
977397314 4:96486766-96486788 TTTTCTGTTCAGGGAGGGGATGG + Intergenic
977650768 4:99466651-99466673 TTTTCTGGGCATAAAGAGGACGG - Intergenic
977753326 4:100635259-100635281 TTCTCTGCTCCTCAAGTGGAGGG - Intronic
977835589 4:101642416-101642438 TTTTCTGATCTTTAAATTGAAGG - Intronic
978246608 4:106579877-106579899 TTTGCTTTTCAGTAAGTTGAAGG + Intergenic
978714198 4:111822462-111822484 TTTCCTATTCATTAAGTTTATGG - Intergenic
978746330 4:112198429-112198451 ATTTCTGTTCATTAACTTGTTGG - Intergenic
979020048 4:115485746-115485768 TTTTCTGTTAAATAAGTGGATGG + Intergenic
980318623 4:131238836-131238858 TTTTCAGTTTATAAAGGGGAGGG - Intergenic
980500884 4:133651772-133651794 TTTTCTGTTTATTGAAAGGATGG - Intergenic
980549082 4:134309625-134309647 ATTTCTGTTCATTATGTTGAAGG + Intergenic
980607051 4:135106092-135106114 TTTTCTTTTCATTAAGTCTAAGG + Intergenic
982027909 4:151270333-151270355 ACTTCTGTTCATTAAGTGTATGG + Intronic
983370737 4:166854843-166854865 TTTTCTGTTGATCAAGTGCTAGG + Intronic
983689962 4:170456466-170456488 TTTTCTGTTTACTATGTTGATGG - Intergenic
986396921 5:7340170-7340192 TTAACTGTTCATTAGGTGCAGGG - Intergenic
987645634 5:20668875-20668897 ATTTCTGTTGCTCAAGTGGATGG + Intergenic
988278941 5:29119832-29119854 TTTTGTGTTCATGGATTGGAAGG + Intergenic
989105089 5:37855446-37855468 TTTGCTGTTCATTAAATACATGG - Intergenic
989408288 5:41086912-41086934 TTTTCAGTTGTTTCAGTGGAAGG + Intergenic
989850469 5:46202693-46202715 TTTTTTGTCCATTATGTGAATGG + Intergenic
990190505 5:53254722-53254744 CTGTCTTTTCATCAAGTGGATGG - Intergenic
990249440 5:53898043-53898065 TTTACTATTTATTAAGTGTAAGG + Intronic
990257607 5:53987378-53987400 TTTTCTGCAAATTATGTGGAAGG - Intronic
990363344 5:55043780-55043802 TTTTCTGTTCTTTCAGTACAAGG - Intergenic
990786836 5:59430596-59430618 TTTTCTGTTCATTCTGTTCATGG + Intronic
991366304 5:65871514-65871536 TTTTATGTCCATCAAGTGTATGG - Intronic
992153039 5:73925295-73925317 AATTCTGTTCATTGTGTGGAAGG + Intronic
992226892 5:74627397-74627419 TTTTCTCTTCATTATGTGTGTGG - Exonic
992748317 5:79839972-79839994 TTTTCTGTTAATTAAAGAGAAGG + Intergenic
993262457 5:85676288-85676310 TTGTCTGTTTATTGATTGGATGG + Intergenic
994491033 5:100444384-100444406 TTTCCTTTTCATCAAGTGCAAGG + Intergenic
994938391 5:106286638-106286660 TTTACTGTTTATTAAGCCGAAGG - Intergenic
994950233 5:106452429-106452451 TTTTCTGTTCATTAACAGGCAGG - Intergenic
995830555 5:116350349-116350371 TTTACTGTTCATTGAGTGGAAGG + Intronic
996109738 5:119551321-119551343 TTTTCTGTTCATTAAGGGTTTGG - Intronic
996814685 5:127561988-127562010 TTTTTTGTTCATTAAGGCAAAGG - Intergenic
996911090 5:128657469-128657491 TTTTCTGTTCTTTTAGTGTTTGG - Intronic
997717403 5:136052334-136052356 TTTTCTGTTCATTTAGCCCAAGG - Intronic
997781719 5:136666361-136666383 TTTCCAGTTCTTAAAGTGGAAGG + Intergenic
998320034 5:141220956-141220978 ATTTCTGTTCTATAACTGGAAGG + Intergenic
998682840 5:144489065-144489087 TTTTTTTTTCATTAAGGAGATGG + Intergenic
999750238 5:154623156-154623178 TTTTCTGTTTTTTTAGGGGAGGG - Intergenic
1000557844 5:162749037-162749059 TTTTTTATTCCTCAAGTGGAAGG - Intergenic
1000813339 5:165889792-165889814 TTTTGTGTTCAGTAGGTGGCAGG + Intergenic
1000847540 5:166300295-166300317 TTTACTATTTATTAAGTGGAAGG + Intergenic
1003667403 6:8124277-8124299 TTTTCAGATCAGTAACTGGAAGG - Intergenic
1003705067 6:8517962-8517984 TATTCTGCTCATTGAGTGTAGGG - Intergenic
1003714751 6:8633908-8633930 TTTTGTTTTCAGTTAGTGGAGGG + Intergenic
1004631404 6:17425267-17425289 TTTTCTGTTAATTAAAAGGCAGG + Intronic
1007232818 6:40360493-40360515 TTATTTCTTCATTAAGTGGCTGG - Intergenic
1008179650 6:48312583-48312605 CTTTCTGTTCATTAATGGAAAGG - Intergenic
1008884698 6:56419611-56419633 TTTCCTGTTGGGTAAGTGGAGGG - Intergenic
1009058875 6:58373555-58373577 TTTGCTATTCATTAAGTGGAAGG + Intergenic
1009231970 6:61073558-61073580 TTTGCTATTCATTAAGTGGAAGG - Intergenic
1009261332 6:61493183-61493205 GTTTCTGTCCATTATGTGAATGG - Intergenic
1009479683 6:64141083-64141105 TTTTAAGTTCATTTAGAGGAAGG + Intronic
1010224081 6:73473349-73473371 TTTTCTTGTTATTTAGTGGATGG + Exonic
1010313607 6:74418805-74418827 TTTTCTTTTCATTCTGTTGATGG + Intergenic
1010843943 6:80681658-80681680 TTTTCTGTACATTATATGTAAGG + Intergenic
1012011209 6:93788316-93788338 TTTTCTGATCATTGAGTCCATGG - Intergenic
1012735304 6:102932154-102932176 TTTTCCGTTCATTCATTGAAAGG + Intergenic
1013360091 6:109385829-109385851 TTTTTTTTTAATTAAGTGCAGGG - Intergenic
1014539307 6:122654359-122654381 TTTTGTGTTCAGGAAATGGAGGG - Intronic
1014857852 6:126424686-126424708 TTTTCTGTTCTTTTGTTGGATGG + Intergenic
1016823827 6:148370085-148370107 TTTTCTCTTTTGTAAGTGGAAGG + Intronic
1017316777 6:153040121-153040143 TTTTCTCTTCTTTAATTGCAAGG + Intronic
1017652156 6:156593539-156593561 TTTACTATTCATTAAGTGGAAGG - Intergenic
1017792801 6:157816133-157816155 TTGTGTGTTCATTGACTGGAGGG - Intronic
1018834642 6:167473748-167473770 TTTTATTTTCACTAAGTTGAGGG + Intergenic
1020495273 7:8844146-8844168 TTTCCTGTTCATAAAGTACAGGG - Intergenic
1020670942 7:11111278-11111300 TTGTCTTTTCATGAAGTAGATGG + Intronic
1021174708 7:17437809-17437831 TTTGATGTCCATTAAGAGGAAGG - Intergenic
1022108917 7:27215956-27215978 AGCTCTGTTCATTAAGGGGAGGG - Intergenic
1022847856 7:34228818-34228840 TTCTCTGCTCATTATGAGGAAGG - Intergenic
1024226605 7:47330398-47330420 TTTTCTGATGGGTAAGTGGAAGG - Intronic
1025522416 7:61754231-61754253 ATTTCTTTTCATTGAGAGGATGG - Intergenic
1025526236 7:61815317-61815339 TTTTTTGTCCATTCTGTGGATGG + Intergenic
1025546169 7:62173262-62173284 ATTTCTTTTCATTGAGAGGATGG - Intergenic
1025549627 7:62228049-62228071 TTTTTTGTCCATTCTGTGGATGG + Intergenic
1025579078 7:62687908-62687930 GTTTCTGTTGATTCAGTGAATGG + Intergenic
1025595629 7:62921402-62921424 GTTTTTGTTGATTAAGTGAATGG + Intergenic
1025598711 7:62966681-62966703 GTTTCTGTTCATTCTGTGAATGG + Intergenic
1026073742 7:67146573-67146595 TTTAATCTTCATTAAGTGAAAGG + Intronic
1026703143 7:72665598-72665620 TTTAATTTTCATTAAGTGAAAGG - Intronic
1027487624 7:78781498-78781520 TTTTTTGTTTATTTAGTAGATGG - Intronic
1028185149 7:87775057-87775079 TTTTTTGTTTTTTAAGTAGAAGG - Intronic
1028353464 7:89878617-89878639 TTCTCTTTTCATCAAGTGGAAGG + Intergenic
1028456054 7:91039374-91039396 ATTTCTGTTTATTACATGGATGG + Intronic
1028750184 7:94374244-94374266 TTTTCTCTTCATGAACTTGAAGG - Intergenic
1028881893 7:95889632-95889654 TTTTCTGTTTACTCTGTGGATGG - Intronic
1029875967 7:103752114-103752136 TTTTGTTTTCATAAAGTGTATGG - Intronic
1029889888 7:103916774-103916796 TATTCTGTTACTTAAGTGGCTGG - Intronic
1030654473 7:112150977-112150999 TTTTCTGGTTATTAAGTGGAAGG + Intronic
1031183732 7:118449357-118449379 ATTTCTGTTATTTAAGAGGATGG - Intergenic
1031807004 7:126318527-126318549 TTTACTCTTCATTGAGAGGAGGG - Intergenic
1032141571 7:129335966-129335988 TTTTCTCTTCATAGAGTAGATGG + Intronic
1032148547 7:129406741-129406763 TTTTCTGATCATTATTTGAAAGG - Intronic
1032430825 7:131860101-131860123 TTTTCTGCTCAGCCAGTGGATGG + Intergenic
1032837337 7:135686374-135686396 TTTTTTTTTAATTAAGAGGAGGG + Intronic
1034057682 7:148053229-148053251 TTTTCTTGTCAGTAAGTGCAGGG + Intronic
1034889059 7:154823409-154823431 TTTACTGTGCATTAAGTATAGGG - Intronic
1035376468 7:158410128-158410150 TTTTCTTTTTCTTAAATGGAGGG - Intronic
1035989624 8:4474819-4474841 TTTACTATTGATTAAGTGGAAGG - Intronic
1036459253 8:8937461-8937483 TTTACTAGTCATTAAGTGGAAGG + Intergenic
1037158552 8:15737695-15737717 TTTTTTGGTCATTAAATTGATGG - Intronic
1037612554 8:20488581-20488603 TTCTCTTTTCACAAAGTGGAGGG + Intergenic
1038243972 8:25837012-25837034 TCTTCTGTTCATGAAATGAATGG + Intergenic
1039768328 8:40655327-40655349 TTTTGTGTTCATAAATTGGAAGG + Intronic
1039791121 8:40876264-40876286 TTTACTATTCATTAAGTGAAGGG - Intronic
1040376336 8:46828338-46828360 TTTTTTGTTCAATTAGTGTAAGG + Intergenic
1042575660 8:70215647-70215669 TTTACTGTCCATTAGGTAGAAGG + Intronic
1043595195 8:81877645-81877667 TTTCCTGATAATTAAGTTGATGG - Intergenic
1045258332 8:100548632-100548654 TTTTCTGTTAAGTGAATGGATGG + Intronic
1045510911 8:102811084-102811106 TTTTTTTTTTTTTAAGTGGATGG - Intergenic
1045719820 8:105095675-105095697 TTTGATGTTCATTAACTGGATGG - Intronic
1046262941 8:111794396-111794418 ATTGCTTTTCATTATGTGGATGG - Intergenic
1047227946 8:122972399-122972421 AATTCTGTTTATTAAGTGCACGG + Intronic
1048111077 8:131469674-131469696 TTTTCTTTTCATTATGGGTATGG - Intergenic
1049024683 8:139980275-139980297 TTCTCTGTTCACTAAGCGGGTGG + Intronic
1050882063 9:10714052-10714074 TTTTCTCTTCATTAAGTTTATGG + Intergenic
1052094979 9:24373064-24373086 GTTTCTATTCATAAAGTAGAAGG + Intergenic
1055691845 9:78840654-78840676 TTTCATTTTCATTAAGTGGATGG - Intergenic
1055933473 9:81583336-81583358 TTTTCTGGTGATTCATTGGAAGG - Intergenic
1056508212 9:87277624-87277646 TTCTCTCTTGATTATGTGGAGGG - Intergenic
1057241005 9:93409065-93409087 TTTTCTTTTCATTTTGTTGATGG + Intergenic
1058349697 9:104007241-104007263 ATCTCTGCTCATCAAGTGGAGGG + Intergenic
1058895446 9:109396993-109397015 TTTTCTGTTCATAGAGTTGACGG - Intronic
1059411305 9:114134040-114134062 TGTTTTGATCATTAAATGGAAGG - Intergenic
1059517891 9:114912868-114912890 TTTTCTTTTTAGCAAGTGGAGGG + Intronic
1059590989 9:115661801-115661823 TATTGTGTTTATTAAATGGAAGG - Intergenic
1060457226 9:123810029-123810051 TTTTCGCTTCATTATCTGGAGGG + Intronic
1203385343 Un_KI270438v1:45594-45616 ATTTCTTTTCATTGAGTAGATGG - Intergenic
1203395142 Un_KI270512v1:20686-20708 GTTTCTTTTCATTGAGTAGATGG - Intergenic
1185976779 X:4730252-4730274 ATTTCTGGCTATTAAGTGGATGG - Intergenic
1186151513 X:6679485-6679507 GTTTCTGTTGCTTATGTGGAAGG + Intergenic
1186175309 X:6920420-6920442 TCTTCTGTGCATTCTGTGGAAGG + Intergenic
1187173922 X:16878447-16878469 TTTTCTGTTCCTTAGTTTGAAGG + Intergenic
1188193915 X:27207334-27207356 TTTTCTGTTGATTATGTTCAAGG + Intergenic
1189174430 X:38940892-38940914 TTTTCTGTTTTTCATGTGGATGG - Intergenic
1192626683 X:72735965-72735987 TTTTCTGTTTATTCTGTTGATGG + Intergenic
1192763581 X:74121130-74121152 TTCTCTGTTCCTTAAGTGAGGGG - Intergenic
1194735287 X:97505691-97505713 TTATCTTTTCAGTAAGTTGAGGG + Intronic
1195385266 X:104308198-104308220 TTTACTATTCATTAAGTGGAAGG - Intergenic
1195502362 X:105616629-105616651 TTTTCTTTTTATTATGTTGAAGG + Intronic
1196156541 X:112436510-112436532 TTTTCTGTTCATAAAGAGACTGG - Intergenic
1196616664 X:117774074-117774096 TTTTCTTTTCATTTCCTGGATGG - Intergenic
1197469107 X:126845570-126845592 TTTTTTGTTCCTTAACTAGATGG + Intergenic
1197691518 X:129505772-129505794 TTTTATTTTCATTAAGTTGAAGG - Intronic
1198129164 X:133676674-133676696 TCTTCTGATCATAAAGTAGATGG + Intronic
1198816652 X:140598660-140598682 TTTACTATTCATTAAGTGGGAGG - Intergenic
1199844825 X:151683776-151683798 TTTTCTGTGCATTAACTGTGTGG - Intergenic
1200053232 X:153445634-153445656 TTTTCTGTTCAGTAGGTGACAGG - Intronic
1200788700 Y:7281010-7281032 TTCTCTATTCATGCAGTGGATGG - Intergenic
1201016080 Y:9603218-9603240 TTTTCTTTTCATTAAGTCTATGG - Intergenic