ID: 969324555

View in Genome Browser
Species Human (GRCh38)
Location 4:6433638-6433660
Sequence CTGCATGTATAGTTGAACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 72}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969324555_969324556 18 Left 969324555 4:6433638-6433660 CCTGGGTTCAACTATACATGCAG 0: 1
1: 0
2: 0
3: 2
4: 72
Right 969324556 4:6433679-6433701 TGACTGTATTTTTTTGTGCCAGG 0: 1
1: 0
2: 2
3: 35
4: 407

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969324555 Original CRISPR CTGCATGTATAGTTGAACCC AGG (reversed) Intronic
902309389 1:15569430-15569452 CTCCAGGTATAGTGGACCCCAGG + Exonic
902786790 1:18738178-18738200 CTGCATGTATATTTGAGAGCAGG + Intronic
904658447 1:32067070-32067092 CTTCAGGTATAGTTGGATCCAGG + Intergenic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
908797159 1:67841974-67841996 CTGCAGGTAGAGTTGGAGCCAGG - Intergenic
912718155 1:111996941-111996963 CTGCTTGTAAAGCTGTACCCAGG - Intergenic
914238200 1:145831566-145831588 ATGCATCAATAGTTGAAGCCTGG + Intronic
922114411 1:222597617-222597639 GTGCATTAATAGTTGAACCATGG - Intergenic
922891891 1:229068017-229068039 CTGCATGTGTCCTTGCACCCGGG + Intergenic
924240058 1:242031840-242031862 CTGGAAATATTGTTGAACCCAGG + Intergenic
924358036 1:243204818-243204840 TTGAATGTAAAGTTGAATCCAGG - Intronic
1067552096 10:47243464-47243486 CTGCATCTGAATTTGAACCCAGG + Intergenic
1067765782 10:49085091-49085113 CTGGATGTCTTGTTAAACCCCGG + Intronic
1074955331 10:118383268-118383290 ATGCATGTATAGAAGATCCCTGG + Intergenic
1077440664 11:2567268-2567290 CTGCAAATACAGATGAACCCAGG + Intronic
1080399996 11:31925461-31925483 ATTCAGGCATAGTTGAACCCAGG + Intronic
1098789009 12:74796693-74796715 ATGCATGTATAGTTGTACTATGG + Intergenic
1103068596 12:117921051-117921073 CTGCATAGTTATTTGAACCCAGG + Intronic
1103333055 12:120168177-120168199 CTCCATGCTTAGTTGAACTCGGG - Intronic
1103393115 12:120588534-120588556 CTGAATGAAGACTTGAACCCAGG - Intergenic
1117007217 14:51433323-51433345 CTCCATGTATAAATGAACCATGG - Intergenic
1120491516 14:85184335-85184357 CTGCATGCATAGCAGAAACCAGG + Intergenic
1121467595 14:94126095-94126117 CTGCCTGCACAGCTGAACCCAGG - Intergenic
1124719226 15:32097522-32097544 CTGCCACTATGGTTGAACCCTGG - Intronic
1151265936 17:72954919-72954941 CTGAATGTATAGGTTAACCAGGG - Intronic
1153371462 18:4321577-4321599 CTGCATGGATACTTGAATTCTGG - Intronic
1156070549 18:33201986-33202008 CTGCGTTGATAGTTGAAACCAGG - Intronic
937573220 2:123389622-123389644 CTGCATGTTTAGTTAAGCCAGGG - Intergenic
941270756 2:163424842-163424864 CTGAATGTAATGTTGAATCCTGG + Intergenic
941906453 2:170719503-170719525 CTGAATCTATAGTTGATCCCAGG - Intergenic
942676144 2:178428564-178428586 CTGAGTGTGTAGTTGCACCCAGG + Intergenic
946059597 2:216930364-216930386 CTTCAGGTATAGCTGGACCCAGG + Intergenic
946098577 2:217298424-217298446 TTACATATATAGTTGAACCTTGG - Intronic
947640517 2:231705267-231705289 CTGCATTTTTAGATGAGCCCTGG - Intergenic
948013362 2:234668286-234668308 CAGCATTTATACTTGAACACTGG + Intergenic
1170436132 20:16331106-16331128 CTGAATGCATAGCTGGACCCAGG + Intronic
1171006785 20:21473960-21473982 CAGTCTGTATAGTTGAAGCCAGG - Intergenic
1173164759 20:40679606-40679628 ATGCATGTATAACTGAACACGGG - Intergenic
1174118532 20:48244813-48244835 CTGTATGTCTGGTTCAACCCAGG - Intergenic
1174492147 20:50907605-50907627 CTGGATGAAAAGTGGAACCCTGG - Intronic
1179125304 21:38584998-38585020 GTACATGTACAGTTGATCCCTGG - Intronic
1179445178 21:41425936-41425958 CTGCACGTATCCTTGAACCTAGG - Intronic
1183697315 22:39430693-39430715 CTGCATCCAGAGTGGAACCCAGG + Exonic
1184975491 22:48058647-48058669 CTGCAGAGATAGTTGCACCCAGG + Intergenic
949712052 3:6882451-6882473 CTGCATGTTTGCTTGAGCCCAGG + Intronic
951604278 3:24415187-24415209 CTGCATGTACAGGTGTTCCCTGG + Intronic
961669527 3:128518867-128518889 CTGCTTCTCTGGTTGAACCCTGG + Intergenic
962965862 3:140353853-140353875 CAGCCTGTTTAGTTGAACCCAGG - Intronic
963477394 3:145824347-145824369 CTGGAACTTTAGTTGAACCCAGG + Intergenic
964511252 3:157454540-157454562 CTGGGTGAATAGTTGAGCCCAGG + Intronic
967914018 3:194564802-194564824 CTGTTTCTGTAGTTGAACCCTGG - Intergenic
969324555 4:6433638-6433660 CTGCATGTATAGTTGAACCCAGG - Intronic
975717201 4:77216557-77216579 CTGCATGACTTGTTGAGCCCAGG + Intronic
979243775 4:118474664-118474686 TTGAATGTAAAGTTGAATCCAGG + Intergenic
986067119 5:4245483-4245505 TTTCATGTACTGTTGAACCCAGG - Intergenic
990987344 5:61652901-61652923 CTACATGTATACATGAACACTGG - Intronic
996795491 5:127342310-127342332 GTGCTTGTAAGGTTGAACCCAGG - Intronic
1005790270 6:29292934-29292956 CTCCATGTATAAATGAACCATGG - Intergenic
1006736741 6:36279083-36279105 CTGCAGGTGTAGTTGCCCCCCGG + Intronic
1009424891 6:63503543-63503565 CTGAATATATGGTTGAAACCAGG - Intergenic
1010048824 6:71479630-71479652 TTGCAAGTACAGCTGAACCCTGG + Intergenic
1013708098 6:112863287-112863309 CTGCATGTAAAGTTGCCCCTAGG + Intergenic
1029311068 7:99665358-99665380 CTGCATGTATAGTGGAAGGACGG - Intronic
1032503703 7:132419409-132419431 CTCCTTGTCTAGGTGAACCCAGG - Intronic
1041658347 8:60376496-60376518 CTGCATCTACCGTTGTACCCAGG - Intergenic
1043103548 8:76079307-76079329 CTGCATGTTTATTTTAATCCTGG + Intergenic
1043308906 8:78833675-78833697 CTCCATTTTTAGTGGAACCCAGG + Intergenic
1048161024 8:132022214-132022236 CTGCATGTGTAGGTGTCCCCTGG + Intergenic
1050879670 9:10683352-10683374 CTTTATGTGTAGTTGAAACCAGG - Intergenic
1052215075 9:25957171-25957193 CTGCCTGTATTCTTGAAACCTGG + Intergenic
1056486571 9:87064142-87064164 CTTCATTTTTAGTTGAACCAAGG - Intergenic
1058533365 9:105929395-105929417 CTTCAGGCATAGTTGAATCCAGG + Intergenic
1060139702 9:121199871-121199893 CTACATGTAGAGTTAAACCTGGG - Intronic
1193278341 X:79618246-79618268 CTGCATATATATTAGAACGCTGG - Intergenic
1195924428 X:110011599-110011621 CTTCCTGTCTACTTGAACCCTGG - Intronic