ID: 969325415

View in Genome Browser
Species Human (GRCh38)
Location 4:6441290-6441312
Sequence TCACTGTGGTGTCGGTGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 227}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969325415_969325419 -2 Left 969325415 4:6441290-6441312 CCTCCACACCGACACCACAGTGA 0: 1
1: 0
2: 0
3: 26
4: 227
Right 969325419 4:6441311-6441333 GACCCTTCTAAACCCAACTCTGG 0: 1
1: 0
2: 1
3: 12
4: 102
969325415_969325428 30 Left 969325415 4:6441290-6441312 CCTCCACACCGACACCACAGTGA 0: 1
1: 0
2: 0
3: 26
4: 227
Right 969325428 4:6441343-6441365 CCATGGCTTAAAGCCCTTCCTGG 0: 1
1: 0
2: 0
3: 17
4: 125
969325415_969325424 13 Left 969325415 4:6441290-6441312 CCTCCACACCGACACCACAGTGA 0: 1
1: 0
2: 0
3: 26
4: 227
Right 969325424 4:6441326-6441348 AACTCTGGTCCCTCACTCCATGG 0: 1
1: 0
2: 0
3: 13
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969325415 Original CRISPR TCACTGTGGTGTCGGTGTGG AGG (reversed) Intronic
904880798 1:33695384-33695406 TCACTGTGGTGGCAGTATGATGG + Intronic
906180555 1:43814805-43814827 TCCCTGTGGTCTAGGTCTGGGGG + Intronic
906218937 1:44062021-44062043 TTACTGAGGTGGCAGTGTGGTGG - Intergenic
909438481 1:75672018-75672040 TCAGTTTGGTGTTGCTGTGGTGG - Intergenic
911037462 1:93566003-93566025 TTACTCTGGTGTCTGTGTGGAGG - Intronic
911191625 1:94954496-94954518 TCACTGTGTTGTCTGTGTTCTGG + Intergenic
917228864 1:172814282-172814304 TCACCGTGGGGTCTCTGTGGGGG + Intergenic
917902014 1:179552073-179552095 TAACTGAGGTGTGGGTGAGGGGG - Intronic
918364747 1:183795733-183795755 TCACTGTGGTCACTGTGTGGAGG + Intronic
919937385 1:202263588-202263610 GCACGGGGGTGTGGGTGTGGTGG + Intronic
920102843 1:203528782-203528804 TCACGGTGGTGGCGGTGGGGTGG - Intergenic
920497998 1:206469067-206469089 TCACTGTGTGGTTGGTGAGGTGG - Intergenic
920498023 1:206469211-206469233 TCACTGTGTGGTTGGTGAGGTGG - Intergenic
921259135 1:213370016-213370038 TCACTATGGTGCCTGTGTTGAGG + Intergenic
921436158 1:215125499-215125521 TCACTGTGGGGTCTGTGTTTAGG - Intronic
1062910680 10:1209724-1209746 ACAGTGTGGTGTGGGTGTGTGGG - Intronic
1065685743 10:28282826-28282848 TCACTATGTTGTTGTTGTGGGGG - Intronic
1070740432 10:78899674-78899696 TTGCTGTGTTGTCAGTGTGGAGG + Intergenic
1071601208 10:86959527-86959549 AAACTGTGGGGTCGGTGGGGGGG - Intronic
1071729431 10:88233126-88233148 CAACTGTGGAGGCGGTGTGGTGG - Intergenic
1072919070 10:99560192-99560214 TAACTGTGGGGCCGGCGTGGTGG - Intergenic
1074765153 10:116694960-116694982 TCACTGTGGGGTGGGGGTTGAGG - Intronic
1077378304 11:2215791-2215813 CCACTGTGGGGTAGGTGAGGGGG + Intergenic
1077992398 11:7423737-7423759 TCACTGGGGTGCAGGAGTGGTGG - Intronic
1079153692 11:17924581-17924603 GCACTGTGGTGGCAGTGTGGAGG + Intronic
1082126271 11:48434739-48434761 TCACTGTGTTGTGGGTGGGGAGG - Intergenic
1082559857 11:54605567-54605589 TCACTGTGTTGTGGGTGGGGAGG - Intergenic
1082765119 11:57161446-57161468 TCAGTCTGGGGTGGGTGTGGAGG - Intergenic
1084379035 11:68798872-68798894 TCACTGTAGGCTGGGTGTGGTGG + Intronic
1085756103 11:79202569-79202591 TCCCTGTGGTGTTTGTTTGGCGG + Intronic
1087063762 11:94008819-94008841 TCAGCGTGATGTCTGTGTGGAGG - Intergenic
1087161721 11:94954583-94954605 TCACTGAGGGCTGGGTGTGGTGG - Intergenic
1088914945 11:114220322-114220344 CCACTGTGGTGTTGGAGTGGGGG + Intronic
1090147224 11:124338400-124338422 TCACTGTGTTGTCAGAGGGGTGG - Intergenic
1091018142 11:132072821-132072843 TCACTGTGGTGCCTGTGTGTGGG + Intronic
1091750386 12:3018473-3018495 GCCCTGTGGTGTGGGGGTGGGGG - Intronic
1094277227 12:28691492-28691514 TCACTGAGGTGTTGCTGGGGTGG - Intergenic
1095695662 12:45141538-45141560 TCACTGTTGTGTTGTTATGGTGG + Intergenic
1096076473 12:48808867-48808889 TCACTGTGGTATCTGGGTGTGGG + Intergenic
1096503718 12:52080482-52080504 TAACTGTGGGGTGGTTGTGGAGG + Intergenic
1100367582 12:93935799-93935821 TCACTGTGGGGATGGAGTGGAGG + Intergenic
1100549459 12:95633507-95633529 CCTCTGTGATGTGGGTGTGGTGG + Intergenic
1103048761 12:117761183-117761205 TCACGGTGGTGACGATGTTGGGG + Exonic
1103637150 12:122316493-122316515 TGACTTTGGGGTGGGTGTGGTGG - Intronic
1103668193 12:122588493-122588515 TCACTGTGGTGTTGGTGACAAGG - Intronic
1104628652 12:130380472-130380494 CCACTAAGGTGTCGGGGTGGAGG + Intergenic
1104722585 12:131053205-131053227 TCACTGTGATGACGGAGTGCAGG + Intronic
1105947520 13:25202462-25202484 TGCCTGTGGTGACAGTGTGGTGG - Intergenic
1105968324 13:25404732-25404754 TGATTGAGGTGTCTGTGTGGGGG + Intronic
1108643405 13:52404231-52404253 TAACTGTGGGCTGGGTGTGGTGG - Intronic
1117941133 14:60966405-60966427 TCATTGTTGTCTGGGTGTGGTGG - Intronic
1119054353 14:71403990-71404012 TCACTGTGATGTGGGTGGGTGGG - Intronic
1121608441 14:95258763-95258785 TATCTGTGGTGTGTGTGTGGAGG + Intronic
1121608452 14:95258874-95258896 TATCTGTGGTGTGTGTGTGGAGG + Intronic
1121660312 14:95630422-95630444 ACAGTGTGGGCTCGGTGTGGTGG + Intergenic
1123004964 14:105316680-105316702 CCACTCTGGTGTCTGTGGGGAGG + Intronic
1124877983 15:33613416-33613438 TCACAGTGGTGGCGGGGAGGTGG - Intronic
1126141358 15:45442161-45442183 TATATGTGGGGTCGGTGTGGAGG - Intronic
1129171624 15:73811609-73811631 TCCCTGTGGGGTGGGTGGGGGGG - Intergenic
1130899246 15:88194646-88194668 TCATTGGGGTTTCTGTGTGGAGG - Intronic
1131225921 15:90624336-90624358 TCACTGTGGTTCCAGTGTGGAGG - Intronic
1131832062 15:96360514-96360536 GCACTGTGGGGTGGGGGTGGGGG + Intergenic
1131841839 15:96445697-96445719 GCACAGTGGTGCCGGTGGGGAGG + Intergenic
1132574820 16:659504-659526 ACACAGTGGGGTCGGGGTGGGGG + Intronic
1134066906 16:11234100-11234122 TCACTTTGGTGGAGGTGGGGTGG + Intergenic
1134443015 16:14310620-14310642 TCCCAGTGGTGTCGGTGAGCAGG - Intergenic
1135828982 16:25756318-25756340 TCACTCTGGTGGCAGTGAGGAGG + Intronic
1137296982 16:47104137-47104159 TAACGGGGGTGTGGGTGTGGGGG - Intronic
1137305204 16:47192064-47192086 TAACTGTGGGCTAGGTGTGGTGG - Intronic
1139613952 16:68077897-68077919 TCACTGTGGTGGGGGTGGGGGGG - Intronic
1141174731 16:81711242-81711264 TGACTGTGGGGTAGGTTTGGAGG - Exonic
1141713166 16:85711879-85711901 CCACTGTAGGGTCAGTGTGGGGG + Intronic
1141957660 16:87383423-87383445 TCCAGATGGTGTCGGTGTGGAGG + Exonic
1143026387 17:3944168-3944190 TCACTGAGGCTTCCGTGTGGAGG - Intronic
1143119768 17:4599516-4599538 TCACCCTGGGGTGGGTGTGGGGG - Intronic
1149610014 17:57953293-57953315 TCATTTTGCTGTCTGTGTGGTGG - Intronic
1151307838 17:73274855-73274877 TCACTGGGGGCTGGGTGTGGTGG - Intergenic
1151603062 17:75118459-75118481 TCACCGTCGTCTCTGTGTGGCGG + Intronic
1152294766 17:79460389-79460411 TGACTGTGGTGGGAGTGTGGTGG - Intronic
1155522179 18:26679674-26679696 TTACTGTGGTATAGTTGTGGTGG - Intergenic
1156850829 18:41724333-41724355 TCATCATGGTGTCAGTGTGGTGG - Intergenic
1157264121 18:46202200-46202222 TCACTGTTGTGTCTGTTGGGAGG + Intronic
1159307395 18:66661974-66661996 TCATGTTGGTGTCTGTGTGGTGG - Intergenic
1159453378 18:68630993-68631015 TCACTGTATTTTGGGTGTGGGGG - Intergenic
1159889202 18:73938754-73938776 TCAGTGTGGTGATGGAGTGGCGG + Intergenic
1163232833 19:16015763-16015785 TCAGTGAGGTGTGGATGTGGGGG + Intergenic
1164825925 19:31284787-31284809 TAACTGGGGTGTGGGTGTGTGGG - Intronic
1165070112 19:33250833-33250855 TGAGTGTGGTGTCTGTGTGTGGG - Intergenic
1165494726 19:36145799-36145821 TGCCTGTGGTGTCGCTCTGGTGG - Exonic
1165698300 19:37918048-37918070 TTACATTGGTGTCGGTGTGCTGG + Intronic
1165845724 19:38816618-38816640 TCACTGGGGTGAAGGTGGGGCGG - Intronic
1165953338 19:39486956-39486978 TCTGTGTCGTGTCGGGGTGGGGG + Intronic
1166588787 19:43976182-43976204 TTACTGTGGGCTGGGTGTGGTGG - Intronic
1167482106 19:49739350-49739372 TCACAGTGGGCTGGGTGTGGTGG + Intergenic
927145820 2:20165213-20165235 TGAATGTGGTGTGTGTGTGGTGG - Intergenic
928156498 2:28881718-28881740 TCACTGAAGCCTCGGTGTGGTGG + Intergenic
928161387 2:28928960-28928982 CAACTGTGGTCTGGGTGTGGTGG - Intronic
929570287 2:43018644-43018666 TCACAGTGGCATGGGTGTGGAGG + Intergenic
931674395 2:64679551-64679573 TTACTGTGGTGTGGGTGTTGGGG + Intronic
932399696 2:71471473-71471495 TCACTCTGTGGTTGGTGTGGGGG - Intronic
932518039 2:72373834-72373856 CCACTATGGAGACGGTGTGGTGG + Intronic
933670844 2:85005795-85005817 TCACTATGGGCTGGGTGTGGTGG - Intronic
936383093 2:112004959-112004981 TCACTTTGATGTCAGTGTGGAGG + Intronic
936703831 2:115045801-115045823 TCACTTTGGTGTTGCTGTTGTGG + Intronic
936899901 2:117470698-117470720 TCACTGTGGTGGTGGTGGGTGGG + Intergenic
938097132 2:128471355-128471377 TCACTGTGGTGTGTGGGAGGAGG + Intergenic
938097139 2:128471389-128471411 TCACTGTGGTGTGTGGGAGGAGG + Intergenic
938097217 2:128471683-128471705 TCACTGTGGTGTGTGGGAGGAGG + Intergenic
939158488 2:138555558-138555580 TCACTTTGGAGCCGGTGTGGTGG + Intronic
939529788 2:143343554-143343576 TCACTGTGTTGGCAGTGTGGGGG + Intronic
941227205 2:162864963-162864985 CCAGTGGGGTGTCTGTGTGGGGG + Intergenic
945689491 2:213015579-213015601 GCACAGTGGTGGTGGTGTGGTGG + Intronic
946944547 2:224807243-224807265 TCACTGTGGTGCCTCAGTGGAGG + Intronic
947697211 2:232201670-232201692 TGACTGTGGTGTTAGTGTTGTGG + Intronic
948182789 2:235995918-235995940 TCACTGTGCAGTAGGTCTGGAGG + Intronic
948304742 2:236938274-236938296 TGTGTGTGGTGTGGGTGTGGTGG + Intergenic
948516133 2:238505002-238505024 TCACTGCGGGGTCTGGGTGGGGG - Intergenic
949074159 2:242044635-242044657 CCCCTGTGGGGTCTGTGTGGAGG - Intergenic
1170830182 20:19833050-19833072 TCACTGTGGTTTCCGTGGGGAGG - Intergenic
1171354278 20:24532240-24532262 TCACTGTGCTTTCATTGTGGGGG - Intronic
1171449663 20:25226602-25226624 TCAGTGTGGCGTCAGTGTCGGGG + Exonic
1174240515 20:49130748-49130770 TCCCTGAGGGGTGGGTGTGGTGG + Intronic
1176245083 20:64093598-64093620 TCAGTGTGGGGGCAGTGTGGGGG + Intronic
1176245091 20:64093621-64093643 TCAGTGTGGGGGCAGTGTGGGGG + Intronic
1176245135 20:64093772-64093794 TCAGTGTGGGGGCAGTGTGGGGG + Intronic
1176245147 20:64093807-64093829 TCAGTGTGGGGGCAGTGTGGGGG + Intronic
1176245168 20:64093867-64093889 GCAGTGTGGGGTCAGTGTGGGGG + Intronic
1176245176 20:64093890-64093912 TCAGTGTGGGGGCAGTGTGGGGG + Intronic
1176245198 20:64093951-64093973 GCAGTGTGGGGTCAGTGTGGGGG + Intronic
1176245205 20:64093974-64093996 TCAGTGTGGGGTCAGTGTGGGGG + Intronic
1176245209 20:64093985-64094007 TCAGTGTGGGGGCAGTGTGGGGG + Intronic
1176245221 20:64094021-64094043 TCAGTGTGGGGGCAGTGTGGGGG + Intronic
1176245320 20:64094313-64094335 TCAGTGTGGGGGCAGTGTGGGGG + Intronic
1176245330 20:64094347-64094369 TCAGTGTGGGGGCAGTGTGGGGG + Intronic
1176245366 20:64094463-64094485 TCAGTGTGGGGGCAGTGTGGGGG + Intronic
1176245384 20:64094510-64094532 TCAGTGTGGGGGCAGTGTGGGGG + Intronic
1178409510 21:32351800-32351822 TCACTGTGGCCTACGTGTGGGGG + Intronic
1180027105 21:45172211-45172233 TCTCTCTGGTGCCGGGGTGGTGG + Intronic
1182061187 22:27399004-27399026 TCTCTGGGGTGTTGGTTTGGGGG - Intergenic
1182144240 22:27987377-27987399 TCCCTTTGGTGTGGGGGTGGTGG - Intronic
1182698923 22:32216818-32216840 TCACTGTGGTGTAGATGAGAAGG + Intergenic
1183392232 22:37552249-37552271 TCACTGTGAGGTGGGTGGGGTGG - Intergenic
1183831020 22:40418445-40418467 TCCCTGTGGAGTCGGTGATGAGG + Exonic
1184239841 22:43206297-43206319 TGACTGTGGTGTGTGTGTAGGGG - Intronic
1184752910 22:46499251-46499273 CCTCTGTGGTTTCTGTGTGGGGG - Intronic
1184803913 22:46779857-46779879 TCAGAGTGGTGTGGGTGTCGGGG + Intronic
1184880639 22:47302277-47302299 TCACTGTGGCTTGGGTGTGGAGG + Intergenic
949498238 3:4653965-4653987 TCACTGTGGTCACGGAGTGCTGG + Intronic
950230846 3:11274540-11274562 TCACTGGAGTGCCAGTGTGGAGG + Intronic
952410877 3:33048709-33048731 ACACAGTGGGGTGGGTGTGGGGG + Intronic
954371290 3:50170800-50170822 TCACTGTGGAAACAGTGTGGGGG - Intronic
955333251 3:58064850-58064872 TCTGTGTGGTGTGTGTGTGGCGG - Intronic
956872424 3:73431010-73431032 TAACTGTGGTGTCCAGGTGGTGG - Intronic
958048130 3:88310592-88310614 TCACTGTGATGTCAGGGAGGTGG - Intergenic
958693443 3:97497876-97497898 TCACTATAATGTCAGTGTGGAGG + Intronic
959171342 3:102847892-102847914 TCAGTGGGGATTCGGTGTGGAGG + Intergenic
961462732 3:127062979-127063001 CCACCGTGGTGTGGGGGTGGTGG + Intergenic
963797991 3:149650215-149650237 TAACTGTGGTGGTGGAGTGGTGG - Intronic
963829341 3:149990352-149990374 TTACTATGGTGTGGCTGTGGGGG - Intronic
964477753 3:157111750-157111772 TCTCTGTGGTTTGGCTGTGGTGG + Intergenic
964526735 3:157622665-157622687 TCACTTTTGTGTGTGTGTGGTGG + Intronic
964662740 3:159138644-159138666 TCACTCTGGGCTCTGTGTGGTGG + Intronic
966252961 3:177887452-177887474 TCTCTGTGGTGGCAGAGTGGAGG - Intergenic
966990579 3:185226207-185226229 ACACTGTGGTGTCTTTCTGGAGG + Intronic
967056788 3:185836179-185836201 TCAGTGTGGGCTGGGTGTGGTGG - Intergenic
967878201 3:194281004-194281026 TCCCTGGGGTGCCTGTGTGGAGG + Intergenic
968646899 4:1745737-1745759 TCACCTGGGTGTGGGTGTGGAGG + Intergenic
969325415 4:6441290-6441312 TCACTGTGGTGTCGGTGTGGAGG - Intronic
969676832 4:8619001-8619023 TAACTGTGGGGTGGGTATGGGGG + Intronic
971287203 4:25302187-25302209 CCACTGTGGGGGCGGTGGGGTGG - Intergenic
972640444 4:40920519-40920541 TCCCTGTGGGGTTGTTGTGGTGG - Intronic
976172874 4:82322789-82322811 TCACTCTGGTGCCAGTGTGGAGG - Intergenic
978157948 4:105510689-105510711 TCACTTTGGCTTCTGTGTGGAGG + Intergenic
980048775 4:128017960-128017982 TCACTGTAGTTAGGGTGTGGAGG - Intronic
980916102 4:139034561-139034583 TTGCTGTGGTGTTGTTGTGGTGG + Intronic
981510122 4:145547370-145547392 TCAATTTGGTGTCCCTGTGGGGG - Intronic
984759055 4:183348268-183348290 TCTCTGCGGGGTCGGTCTGGAGG + Intergenic
985504978 5:273677-273699 TCACTGCGCTGTGGGTGGGGGGG + Intronic
985743140 5:1631949-1631971 TCACTGCGCTGTGGGTGGGGGGG - Intergenic
985821958 5:2166546-2166568 TGACTGTGGTGGGAGTGTGGGGG + Intergenic
986847206 5:11769203-11769225 TCACTGTGGTTTCTGTGTCTGGG - Intronic
986974931 5:13382945-13382967 ACACTGGGGTTTCTGTGTGGTGG - Intergenic
990318672 5:54608669-54608691 TGACTGGTGTGTCTGTGTGGGGG + Intergenic
990744195 5:58942216-58942238 TCACTCTGGGCTCTGTGTGGTGG - Intergenic
991914122 5:71588993-71589015 TCAGTGTGGTGGCAATGTGGAGG + Intronic
998298703 5:140997129-140997151 TCACTGTGGCGGGGGTGTGGGGG - Intronic
999079125 5:148826704-148826726 CGGCTGTGGTGTGGGTGTGGTGG - Exonic
999493387 5:152073309-152073331 TCAGAGTGGTCTCTGTGTGGGGG + Intergenic
1000303792 5:159977721-159977743 TCACTGAAGTGTGGGTGTTGGGG + Intergenic
1001226727 5:169951040-169951062 TCACTGTGGTGTGGGAATGCAGG - Intronic
1001615946 5:173043688-173043710 TATCTGTGGTCTGGGTGTGGTGG - Intergenic
1002538247 5:179890136-179890158 TCACTCTGCTGTGGGTGTAGTGG - Intronic
1002799430 6:507246-507268 TCACTGCTGTGTGTGTGTGGGGG - Intronic
1002939090 6:1700069-1700091 ACACTTTGGTGTCGGTGCGGAGG - Intronic
1003904070 6:10682774-10682796 GCACTGTAGTGTCAGTCTGGTGG - Intronic
1004290677 6:14364082-14364104 TACCTGTGGTGTCTGTGTCGGGG + Intergenic
1006174126 6:32111618-32111640 TCACTGAGGTGTCTGGGTGGTGG + Intronic
1007430446 6:41773475-41773497 TCAATGTGGTGTGGGCGTGCTGG - Intronic
1008485728 6:52033349-52033371 ACTCTGTGTTGTGGGTGTGGGGG - Intronic
1008639805 6:53450171-53450193 TCTCTGGGGTGTGGGTGTGGTGG + Intergenic
1011297694 6:85841220-85841242 TCCCTGTGGGGTGGGGGTGGGGG + Intergenic
1011346102 6:86370888-86370910 CCACTGTGGTCTCTGTGTGGGGG + Intergenic
1012448941 6:99334702-99334724 TCCCTCTGGTGGCAGTGTGGAGG - Intronic
1015633299 6:135252405-135252427 TCACTTTGGTGGCAGGGTGGTGG - Intergenic
1018703315 6:166445220-166445242 TCACAGTGGGGTGGGGGTGGGGG + Intronic
1019216563 6:170447619-170447641 TCCTTGTGGAGTCAGTGTGGAGG - Intergenic
1019436585 7:1025370-1025392 TCACTGGGGTGTGGGTGCTGGGG + Intronic
1019918041 7:4145756-4145778 CCACGGTGGTGAAGGTGTGGGGG - Exonic
1024632273 7:51259653-51259675 TCACTGTGTTGTCTGTCTGAGGG + Intronic
1024721168 7:52138927-52138949 TCACTGGGGACTCTGTGTGGGGG + Intergenic
1026238485 7:68550580-68550602 TCACCGTGGGCTAGGTGTGGTGG + Intergenic
1026461853 7:70621300-70621322 TCACTGTGGGGGCAGGGTGGGGG + Intronic
1027699804 7:81455981-81456003 TCAGTCTGGTGTGTGTGTGGGGG + Intergenic
1028023522 7:85807659-85807681 TCACTGTGGTATCAATGTGAAGG - Intergenic
1030272568 7:107686087-107686109 TCTCTGTGGTGTGTGTGTGTGGG + Intronic
1033185323 7:139222489-139222511 GCACTGTGGTGGTGGTGGGGTGG + Intergenic
1033871106 7:145753272-145753294 TGCCTGTGGTGTCGCGGTGGAGG + Intergenic
1034428087 7:151025129-151025151 TCACTGTAGTGTGTGTGTGGAGG - Intergenic
1035257853 7:157643490-157643512 GCACTGTGGCGGAGGTGTGGGGG + Intronic
1035295612 7:157865416-157865438 TCTCTGTGGTTTAGGTGAGGTGG - Intronic
1037510715 8:19579084-19579106 TCACTCTGGACTGGGTGTGGTGG - Intronic
1039121971 8:34157641-34157663 TCAGTGAGGAGTCTGTGTGGGGG - Intergenic
1043680781 8:83022302-83022324 TCACTGGGGACTCTGTGTGGGGG + Intergenic
1045026061 8:98087931-98087953 ACAATGTGGGGTGGGTGTGGTGG + Intronic
1046957029 8:120072331-120072353 CCACTGTGGTGAGTGTGTGGTGG + Intronic
1047753260 8:127898705-127898727 TCCCTGTGGTGGGGGTGAGGCGG + Intergenic
1049363880 8:142227129-142227151 TCACTGGGGTGTGGGTGCAGTGG - Intronic
1049363911 8:142227271-142227293 TCACTGTTGTGTGGGTGCAGTGG - Intronic
1049384934 8:142338407-142338429 TCACTGTGGAGTGGCTGTGTGGG - Intronic
1049504747 8:142990185-142990207 TCTGTGTGGTGTGGGTGTGTGGG + Intergenic
1049621535 8:143600411-143600433 TCACTGTGGAGTGGGAGGGGTGG + Exonic
1052663123 9:31461254-31461276 TCAGTGAGGTGTATGTGTGGGGG - Intergenic
1055277610 9:74636756-74636778 TCACGGGGGTGTGGGTGGGGTGG + Intronic
1056582180 9:87897244-87897266 TCACTGAGGTGTGGGCATGGAGG + Intergenic
1059160376 9:112028987-112029009 TCACAGTGGTGTCTGGCTGGTGG - Intergenic
1060804484 9:126565862-126565884 TCCCTGAGATGTCTGTGTGGCGG - Intergenic
1060960248 9:127675753-127675775 TCTCTCTGGTGACAGTGTGGAGG - Intronic
1061185780 9:129052408-129052430 TCACTGTAGGCTGGGTGTGGTGG - Intronic
1061674528 9:132208280-132208302 TCAGTGTGATGTGGCTGTGGTGG + Intronic
1061894835 9:133641848-133641870 TCACTGGGGACTGGGTGTGGGGG - Intronic
1062333537 9:136055047-136055069 TGGCTGTGGTGTCGGAGTGGGGG + Intronic
1186605578 X:11086672-11086694 TCAGTGTGGTATCAGTGTTGTGG - Intergenic
1187567011 X:20460721-20460743 TTTCTGGGGTGTCGGTGGGGGGG + Intergenic
1187908323 X:24087739-24087761 TCACTGTGTTGCCCGTGTTGGGG + Intergenic
1188425125 X:30037315-30037337 TCAATTTGGTGTTGCTGTGGGGG + Intergenic
1189354911 X:40303279-40303301 TCACTGTGTTGTTTGTGGGGAGG + Intergenic
1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG + Intergenic
1191857322 X:65637527-65637549 TCACTGTGGGGTGGGGGTTGGGG - Intronic
1194192988 X:90859977-90859999 CCACTGTGGTGTGGGTGATGGGG + Intergenic
1194206271 X:91015260-91015282 TCAGTGTGGACTCTGTGTGGGGG + Intergenic
1198257041 X:134932883-134932905 AAACTGTGGTGCTGGTGTGGGGG - Intergenic
1199216571 X:145266119-145266141 TGATGGTGGTGTTGGTGTGGGGG - Intergenic
1200539612 Y:4442427-4442449 CCACTGTGGTGTGGGTGATGGGG + Intergenic
1200552025 Y:4590081-4590103 TCAGTGTGGACTCTGTGTGGGGG + Intergenic