ID: 969325543

View in Genome Browser
Species Human (GRCh38)
Location 4:6441878-6441900
Sequence TGCGGTCAAAATTAAATGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 71}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969325535_969325543 13 Left 969325535 4:6441842-6441864 CCTTCATCTGTATTACTGGGTAT 0: 1
1: 0
2: 2
3: 11
4: 264
Right 969325543 4:6441878-6441900 TGCGGTCAAAATTAAATGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 71
969325532_969325543 27 Left 969325532 4:6441828-6441850 CCTTGAGTCTCAGTCCTTCATCT 0: 1
1: 0
2: 2
3: 39
4: 347
Right 969325543 4:6441878-6441900 TGCGGTCAAAATTAAATGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 71
969325531_969325543 28 Left 969325531 4:6441827-6441849 CCCTTGAGTCTCAGTCCTTCATC 0: 1
1: 0
2: 1
3: 24
4: 209
Right 969325543 4:6441878-6441900 TGCGGTCAAAATTAAATGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 71

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969325543 Original CRISPR TGCGGTCAAAATTAAATGCC TGG Intronic
908056264 1:60290466-60290488 TGCGTTCATAATTTAAAGCCAGG - Intergenic
910507142 1:87962303-87962325 TGAGGTAAAAATTCAATGCCTGG + Intergenic
911948704 1:104144041-104144063 TGCTGTCAAAACTTAAAGCCTGG - Intergenic
1066754182 10:38693298-38693320 TGCTGTCAAAATTTCATGCTGGG + Intergenic
1069970713 10:72166070-72166092 TGAGGTCAAAATTCAAACCCAGG + Intronic
1072968478 10:99995467-99995489 TGAGGTCAAACTTGTATGCCGGG - Intronic
1084430565 11:69108477-69108499 TGGGCTCAAAATCCAATGCCAGG + Intergenic
1087294823 11:96359002-96359024 GGCGGTCAAAAGAAAATGGCTGG - Exonic
1088227531 11:107637816-107637838 TGCTGCCATAATTAAAAGCCTGG - Intronic
1093809827 12:23478136-23478158 TGCAGACAAAATTAAATACTTGG + Intergenic
1097647251 12:62251354-62251376 TGAGCTCAAAATGAACTGCCTGG + Intronic
1098353027 12:69583520-69583542 TGTGGGCAAAATTACATACCTGG - Intergenic
1104518131 12:129446730-129446752 TGCTGTCAAAAATATATTCCAGG + Intronic
1124185640 15:27526077-27526099 TGCAGTGAAAATAGAATGCCAGG - Intronic
1126540988 15:49823723-49823745 TGCAGACAGAATTAAAAGCCAGG - Intergenic
1130636107 15:85621732-85621754 TGGGGTAAAAAGTAACTGCCTGG - Intronic
1130772670 15:86940481-86940503 AGTGGTCAACATTATATGCCAGG - Intronic
1131596547 15:93803758-93803780 TCCCTTCTAAATTAAATGCCAGG - Intergenic
1136728550 16:32383837-32383859 TGCTGTCAAAATTTCATGCTGGG - Intergenic
1138692984 16:58786310-58786332 TGCTTTCAAAATAAAATGGCAGG + Intergenic
1202997888 16_KI270728v1_random:133919-133941 TGCTGTCAAAATTTCATGCTGGG + Intergenic
1146243385 17:31252460-31252482 TAGGATCATAATTAAATGCCAGG + Intronic
1155158165 18:23175384-23175406 TGAGGTCAAAAATGAAAGCCAGG - Intronic
1156612749 18:38746100-38746122 TCCAGTCAACATTAAATGGCAGG + Intergenic
1164623259 19:29710238-29710260 TGGGCTCAAAATTATATCCCAGG - Intronic
1165159665 19:33808607-33808629 TGCATTCAGAGTTAAATGCCAGG - Intronic
926463523 2:13163084-13163106 TAGGATCAAAATTATATGCCAGG + Intergenic
934317479 2:91937553-91937575 TGCTGTCAAAATTTCATGCTGGG + Intergenic
938569437 2:132548833-132548855 TGCAGTCTAAATTCTATGCCTGG + Intronic
940105139 2:150091042-150091064 AGTGGTCAAAATTAAAAGCTTGG - Intergenic
941996248 2:171604538-171604560 TGGGCTCTAAATTAAATGACTGG + Intergenic
943661532 2:190564380-190564402 TGCTGACAAGATAAAATGCCAGG - Intergenic
945030158 2:205655875-205655897 CTCGGTCAAAATCAAATGCCAGG + Intergenic
946523765 2:220495748-220495770 TGGGGAGAAAATTAAATGCCTGG + Intergenic
948341900 2:237260033-237260055 TGGGGTCAAATTTTAATGTCTGG + Intergenic
1169071617 20:2736261-2736283 AGCAGGCACAATTAAATGCCAGG - Intronic
1169842311 20:9953317-9953339 TGCTGTCAACAATAATTGCCAGG + Intergenic
1175213932 20:57380036-57380058 TGCAGTCAATATTTAATGGCAGG - Intergenic
1180305658 22:11121388-11121410 TGCTGTCAAAATTTCATGCTGGG + Intergenic
1180544177 22:16483571-16483593 TGCTGTCAAAATTTCATGCTGGG + Intergenic
950100825 3:10355674-10355696 TGCTGTCAACAGAAAATGCCAGG + Intronic
950586959 3:13899617-13899639 TGTGGACAATATTGAATGCCAGG + Intergenic
954122953 3:48511013-48511035 TGGGTTCAAAATGTAATGCCCGG - Intergenic
954974142 3:54676855-54676877 GGGGGTCAAAGTTAAATGCAAGG - Intronic
958173569 3:89966963-89966985 TGATTTCAAAATGAAATGCCTGG - Intergenic
967413237 3:189188274-189188296 AGAGGTCAAAAGAAAATGCCTGG - Intronic
969325543 4:6441878-6441900 TGCGGTCAAAATTAAATGCCTGG + Intronic
971926623 4:33018053-33018075 TACGGTCAACTTTGAATGCCAGG - Intergenic
972238982 4:37168326-37168348 TGCTGTGATAATTAAATGACAGG + Intergenic
974351144 4:60748227-60748249 TGAGGGCAAAATGAAATGGCAGG - Intergenic
974631511 4:64495486-64495508 TGAGGTAAAAAGTAAATGCCAGG + Intergenic
977949716 4:102956141-102956163 TGCTGTCAAAATTTCATGCTGGG + Intronic
983997343 4:174199608-174199630 TGCTGTCAAAATAAAATTTCAGG - Intergenic
984414626 4:179441749-179441771 AGCCATCAAAATTAAGTGCCAGG + Intergenic
990151989 5:52829000-52829022 TGGGGCCAAAATTCAATGACTGG - Intronic
991249464 5:64543902-64543924 TGTGGCCAAAATAAAATCCCTGG + Intronic
995850688 5:116542508-116542530 TGCAGTCTAAAGTAAATGACAGG - Intronic
996825021 5:127672924-127672946 TGAGGTCTGAATTAAATGACGGG - Intergenic
1002562930 5:180094557-180094579 TGCCATCAAAATTACAGGCCGGG - Intergenic
1006640727 6:35488334-35488356 TGTGGTCCAAATTAATAGCCTGG - Intronic
1009748305 6:67848483-67848505 TTCAGTGAAAATTAAAGGCCAGG + Intergenic
1012245076 6:96917187-96917209 TGCAAACAAAATTAAATGCTGGG + Intergenic
1014927550 6:127291601-127291623 TGCAGTCAAAATAAAACGCATGG - Intronic
1021396783 7:20159168-20159190 TGTGGACACAATTATATGCCAGG - Exonic
1038094723 8:24295412-24295434 TCAGGTCAATGTTAAATGCCTGG - Intronic
1044317485 8:90766671-90766693 TGTGTTCAAAATTCCATGCCAGG + Intronic
1044435549 8:92158478-92158500 TGAGGGCAAAATAAAATGCCTGG - Intergenic
1050105610 9:2163392-2163414 TGCGGTCAAAATTTCCTTCCTGG - Intronic
1055917646 9:81422325-81422347 AGTGATCAAAATTAAATGCTAGG - Intergenic
1057631367 9:96721335-96721357 TGAGGTCAGAATAAAATCCCTGG - Intergenic
1058351126 9:104025399-104025421 TGCTGTATAAATTAAAAGCCTGG - Intergenic
1060134516 9:121139531-121139553 AGCAGTAAAAATTAAATTCCAGG - Intronic
1185828766 X:3278179-3278201 TGCTGTCAAAATTAAATCTATGG - Intronic
1186551450 X:10510208-10510230 TGCGGTAAAATTTACATGCAAGG + Intronic
1191923915 X:66287937-66287959 TGAGGTAAAAGTTAGATGCCTGG + Intergenic
1201184786 Y:11389974-11389996 TGCTGTCAAAATTTCATGCTGGG + Intergenic
1201250380 Y:12051889-12051911 TGCTGTCAAAATTAAATCTATGG + Intergenic