ID: 969325704

View in Genome Browser
Species Human (GRCh38)
Location 4:6442644-6442666
Sequence GAGTTAATTCATATAAAACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 374}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969325704_969325707 6 Left 969325704 4:6442644-6442666 CCGTGTTTTATATGAATTAACTC 0: 1
1: 0
2: 0
3: 25
4: 374
Right 969325707 4:6442673-6442695 GTTCCAACACCCCTAGGGTGTGG 0: 1
1: 0
2: 0
3: 6
4: 82
969325704_969325709 8 Left 969325704 4:6442644-6442666 CCGTGTTTTATATGAATTAACTC 0: 1
1: 0
2: 0
3: 25
4: 374
Right 969325709 4:6442675-6442697 TCCAACACCCCTAGGGTGTGGGG 0: 1
1: 0
2: 2
3: 14
4: 175
969325704_969325708 7 Left 969325704 4:6442644-6442666 CCGTGTTTTATATGAATTAACTC 0: 1
1: 0
2: 0
3: 25
4: 374
Right 969325708 4:6442674-6442696 TTCCAACACCCCTAGGGTGTGGG 0: 1
1: 0
2: 0
3: 9
4: 105
969325704_969325706 1 Left 969325704 4:6442644-6442666 CCGTGTTTTATATGAATTAACTC 0: 1
1: 0
2: 0
3: 25
4: 374
Right 969325706 4:6442668-6442690 CTTAAGTTCCAACACCCCTAGGG 0: 1
1: 0
2: 0
3: 4
4: 62
969325704_969325705 0 Left 969325704 4:6442644-6442666 CCGTGTTTTATATGAATTAACTC 0: 1
1: 0
2: 0
3: 25
4: 374
Right 969325705 4:6442667-6442689 ACTTAAGTTCCAACACCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969325704 Original CRISPR GAGTTAATTCATATAAAACA CGG (reversed) Intronic
901615328 1:10534928-10534950 GATTACATTCATATAAAATATGG + Intronic
902580918 1:17407031-17407053 GGGTTAAATCCTTTAAAACAAGG - Exonic
904568681 1:31444321-31444343 GAGTTAGTTGAGATAACACATGG - Intergenic
906760297 1:48371134-48371156 CAGTTTATTCAAATAATACAAGG + Intronic
906860053 1:49349786-49349808 GAGGTAATTAAAATAAAATAAGG + Intronic
907322490 1:53613890-53613912 AGGCAAATTCATATAAAACATGG - Intronic
907380366 1:54082206-54082228 GAGATAATTCATACAAAGCCTGG + Intronic
908896650 1:68908596-68908618 AAGTTAATTTATATAAACAAAGG - Intergenic
908928809 1:69290694-69290716 AAGTTAAAGCACATAAAACAAGG - Intergenic
908979924 1:69943361-69943383 AAGTAAAATCATATAACACATGG - Intronic
909244369 1:73258702-73258724 GAGATAATTCATATTATTCAGGG + Intergenic
909427787 1:75547111-75547133 GAGTTAACTCATTTTAAAAAGGG + Intronic
909571280 1:77114292-77114314 CAGTTAATTCATGTATAAAATGG + Intronic
910026249 1:82657998-82658020 GAGTTAGGTCATACAAAATAGGG + Intergenic
910225198 1:84929377-84929399 GAATTATTTCTTCTAAAACAGGG - Intronic
910679623 1:89849003-89849025 CAGTTTCTTCACATAAAACAGGG - Intronic
912340914 1:108914302-108914324 AAATTAATTCAAATAAACCAGGG - Intronic
913317050 1:117562442-117562464 GAGTAAGTTCAAATAAAAGAAGG - Intergenic
913458716 1:119060897-119060919 GAGTTAATACATAGAATATAAGG - Intronic
919163008 1:193855861-193855883 GTGTGAATACATTTAAAACAAGG - Intergenic
919940008 1:202279827-202279849 GAGTCAATAAATTTAAAACAAGG - Intronic
920044311 1:203123728-203123750 GAGCTGCTTCATCTAAAACAGGG + Intronic
922883822 1:229003020-229003042 GAGGTAATTGAGTTAAAACAGGG - Intergenic
923057794 1:230440606-230440628 GAAGTAATTCAATTAAAACAGGG - Intergenic
923772795 1:236952002-236952024 GAGGTAATTAAGTTAAAACAAGG - Intergenic
924485865 1:244483303-244483325 GATTTAATGCATATAAATGAAGG + Intronic
924701301 1:246456309-246456331 GATTTAATTTATATGACACAGGG - Intronic
1063174647 10:3540370-3540392 GAGTTAACTGAGTTAAAACAGGG - Intergenic
1063803441 10:9609222-9609244 GGGTTAAGTGATATAATACAGGG + Intergenic
1063926553 10:10983433-10983455 GAGTAAACACATATATAACATGG + Intergenic
1065148789 10:22800416-22800438 GAGTTAAGTCACAAGAAACAAGG - Intergenic
1065186896 10:23177138-23177160 GAGTTATTTCATAGAAAACGTGG - Intergenic
1065566552 10:27016786-27016808 AATTTAATTTATATAAAACCTGG + Intronic
1066030245 10:31414123-31414145 TAGTTTTTTCATATATAACATGG + Intronic
1066121354 10:32290566-32290588 GAAATAATTCATACAAAATATGG - Intronic
1066668856 10:37816060-37816082 AATTTACTTCATCTAAAACATGG + Intronic
1068062599 10:52087581-52087603 GAGTAAATTTCTCTAAAACATGG - Intronic
1068227086 10:54119169-54119191 CAGATAAATAATATAAAACATGG + Intronic
1068419857 10:56777484-56777506 GATTTATTGCATATAAAATACGG - Intergenic
1068566911 10:58586315-58586337 GCTTGACTTCATATAAAACAGGG - Intronic
1068990767 10:63148015-63148037 TAGGGAATCCATATAAAACATGG - Intronic
1069119562 10:64552039-64552061 GAGTTAAAACCTAGAAAACAAGG - Intergenic
1072072592 10:91933710-91933732 AATTTAATCCATATAAATCAAGG - Intronic
1072574251 10:96685775-96685797 GAGTTAATTCTGACAACACAGGG + Intronic
1072920096 10:99569630-99569652 GAGTTAATTCATGAAAAGAATGG - Intergenic
1073747175 10:106482411-106482433 GAGTTAATGCATATAAAGGAAGG - Intergenic
1074632119 10:115270132-115270154 GAGTTAAATAAAATAAGACATGG + Intronic
1074739754 10:116474277-116474299 GAGTTAATTCTTGTAATATATGG - Intronic
1075929227 10:126280809-126280831 GAGTAAATCCATCAAAAACAAGG - Intronic
1078185870 11:9051740-9051762 GAGATAATGCATTTAAAAAAAGG + Intronic
1078412886 11:11142221-11142243 GAAATAATACATACAAAACATGG + Intergenic
1079349556 11:19680774-19680796 GTGGTAATTATTATAAAACACGG + Intronic
1081023507 11:37978502-37978524 CATTTTATTCATATAATACATGG - Intergenic
1081488984 11:43552908-43552930 GTGTTTATTGACATAAAACAAGG - Intergenic
1084071266 11:66737312-66737334 GATTTGATTCATACAAAACTTGG + Intergenic
1086254885 11:84863878-84863900 GAGTTACTTCATATTTAAAATGG + Intronic
1086620282 11:88879669-88879691 GAATTATTTCATATTAATCAAGG - Intronic
1086814503 11:91352173-91352195 GAGTTGATTAATATTAATCAGGG + Intergenic
1086996055 11:93357179-93357201 AAATCAATGCATATAAAACAGGG - Intronic
1088581267 11:111319236-111319258 AAATAAATTCATAAAAAACATGG + Intergenic
1088663029 11:112067361-112067383 GAGTTAAAAAATATAAGACATGG + Intronic
1088971528 11:114778784-114778806 TAGATAATTGAAATAAAACAGGG + Intergenic
1089445146 11:118546052-118546074 GAGATAATTAAATTAAAACAAGG + Intronic
1089893685 11:121906241-121906263 GAGGTAATTCAGTTAAAACGAGG + Intergenic
1090883913 11:130859571-130859593 GAGTTAATCCACATAGAGCACGG + Intergenic
1091957853 12:4662952-4662974 GAATCAATACATATAACACAGGG - Intronic
1093445010 12:19246853-19246875 GAGTTACTTCAAATTATACAAGG - Intronic
1093947035 12:25120776-25120798 GTGTTACTACTTATAAAACAGGG + Intronic
1094396445 12:30011652-30011674 TAGTGAAGTCATATAAAACAAGG + Intergenic
1095208355 12:39464040-39464062 GAGTTAATATATTTAAAATATGG - Intergenic
1096134029 12:49184788-49184810 GACTGAATTCATTTAAGACAGGG + Exonic
1097337675 12:58402064-58402086 AAATTACTTAATATAAAACAAGG - Intergenic
1097444971 12:59659560-59659582 TAGTTAATTAATTAAAAACAAGG + Intronic
1097670629 12:62533086-62533108 AAGTAAGGTCATATAAAACAAGG - Intronic
1097807432 12:63981140-63981162 CAGTTAATTTTTGTAAAACAAGG + Intronic
1097926830 12:65137506-65137528 TAGTCAATTAATCTAAAACAAGG + Intergenic
1099583145 12:84479478-84479500 AAGTTAATTAATATAACAAAGGG + Intergenic
1099743888 12:86677224-86677246 GGGTTAATTAATATGAAATAAGG - Intronic
1100735735 12:97528009-97528031 CAGTTAATGTATATAAAACTCGG - Intergenic
1101238374 12:102813003-102813025 GGGTTAATATATATAAAACTTGG + Intergenic
1101313378 12:103606065-103606087 GAATTAATTAATACAAAAGAAGG - Intronic
1101332744 12:103770082-103770104 AAAGTAATTCATAGAAAACATGG + Intergenic
1102397239 12:112597233-112597255 GTTTTAATTCTTATAAAAAAGGG + Intronic
1104510221 12:129370560-129370582 GAGTGAACTCATATAAAATCTGG - Intronic
1105235502 13:18548242-18548264 GAATTTATTCATATAACATATGG + Intergenic
1105761697 13:23521281-23521303 GAGTTAAACCATGTAAACCATGG + Intergenic
1105904407 13:24791754-24791776 AGGTAAATTCATATAAACCAAGG + Intronic
1106873319 13:34044968-34044990 GAGGTAATTCAGATAAAATGAGG + Intergenic
1106954472 13:34920786-34920808 GAGCTAAATAACATAAAACAGGG - Intergenic
1107699275 13:43031878-43031900 AACTTAAATAATATAAAACAAGG + Intronic
1107943894 13:45399860-45399882 GGGTTAATTGATATAAAGTATGG - Intronic
1107993053 13:45835129-45835151 GAGTATATTCAAATAAATCAGGG - Intronic
1108159633 13:47624947-47624969 GAGTTAATAGATATAACACTGGG - Intergenic
1108198658 13:48020559-48020581 GGGTTAAATCCTTTAAAACAAGG - Intergenic
1108243024 13:48486891-48486913 GAGTTAATTCATAAATTAGAGGG + Intergenic
1108521080 13:51247450-51247472 GAGTTCATACATGTAGAACATGG + Intronic
1109315999 13:60750405-60750427 GAGTTTCTTCTTATAAAAAATGG + Intergenic
1109555505 13:63969805-63969827 GAGTTACTTCACTTAAAAAATGG - Intergenic
1109556233 13:63979481-63979503 GAATTAATTTATTTAAAAAAAGG - Intergenic
1109588339 13:64440781-64440803 TAGATAATTAATATAGAACATGG + Intergenic
1110061860 13:71051269-71051291 GAGTAAAATCATATACAGCAAGG - Intergenic
1110555828 13:76858070-76858092 GGGGTCATTCATATAAGACAAGG - Intergenic
1110645156 13:77874154-77874176 GTGTTCATTGCTATAAAACATGG - Intergenic
1111584417 13:90265902-90265924 GACTTATTTCATATAAGACTTGG + Intergenic
1113000846 13:105634349-105634371 CAGTTAATGCAGATCAAACAGGG + Intergenic
1113000887 13:105635124-105635146 GAGTTGAATCATAAAACACATGG + Intergenic
1113174491 13:107546446-107546468 GAGTTATTTCATTTTAAACTAGG + Intronic
1113179973 13:107613565-107613587 AAGGTAGTTCAAATAAAACATGG - Intronic
1114737675 14:25059461-25059483 GAGTATATTAATATATAACAGGG + Intergenic
1114818523 14:25988199-25988221 GTGTTGCTACATATAAAACATGG - Intergenic
1114902511 14:27082152-27082174 GAATTGCTTGATATAAAACAGGG - Intergenic
1115013341 14:28577675-28577697 AAGTTAATTCATACATAAAATGG - Intergenic
1115108718 14:29794183-29794205 TATTTTATTCATACAAAACAAGG + Intronic
1115840629 14:37465983-37466005 GAGTTAAATTAGATAAAACAAGG + Intronic
1116333288 14:43622839-43622861 GAGTCAGTTCAAATAAAACAAGG - Intergenic
1116402867 14:44530609-44530631 GAGATAATTCAGATAAAGCTTGG + Intergenic
1117016884 14:51527291-51527313 GAGTTAATGTTTATAAACCATGG - Intronic
1117815016 14:59588469-59588491 GAGTTCATTTATATATAAAATGG + Intergenic
1117949174 14:61063845-61063867 GAGTTAATGCCTATTATACAGGG + Intronic
1120320182 14:82949903-82949925 GAGCTAATTCATGCAAAAGAGGG - Intergenic
1120380493 14:83772588-83772610 TAATTAATTCACATAAAACATGG - Intergenic
1121799647 14:96764004-96764026 CATTTAATTCATATAAGCCAGGG + Intergenic
1124403299 15:29369874-29369896 GAGTTAATTGTTATAAAATGAGG + Intronic
1126059779 15:44769237-44769259 AAGTGAATTCAAAAAAAACAAGG - Intergenic
1129824953 15:78628868-78628890 CAGTTAATTCATAGGAGACAAGG - Intronic
1131883938 15:96888869-96888891 CAGTTTCTTCACATAAAACAGGG - Intergenic
1132334077 15:101032499-101032521 GACTTCATTAATATAAAAAAAGG - Intronic
1132345765 15:101107835-101107857 GAGGTAATTAAGATAAAACAAGG + Intergenic
1135166865 16:20147067-20147089 GAGTTAATTGCTCTAAAGCATGG - Intergenic
1138695311 16:58807554-58807576 GAGTAAATTCATATAATCCATGG - Intergenic
1139010232 16:62622840-62622862 GACCTAATTCATATAAAATATGG - Intergenic
1140039816 16:71398787-71398809 GGGTTAAATCCTTTAAAACAAGG + Intergenic
1140628547 16:76823849-76823871 AAATTAAAGCATATAAAACATGG - Intergenic
1140919182 16:79520943-79520965 CAGTTTATTCATCTAAAATATGG - Intergenic
1141902351 16:86999807-86999829 TATTTAATTCATCTTAAACATGG + Intergenic
1143044635 17:4067652-4067674 GAGTTTATATATTTAAAACATGG + Intronic
1144013119 17:11169319-11169341 GAGTTAATTCCTCCAAGACAAGG - Intergenic
1149101398 17:52910653-52910675 AATTTAATTCATATAGATCATGG + Intergenic
1149158312 17:53660919-53660941 GACTTAAAGCATGTAAAACACGG + Intergenic
1149947976 17:60952093-60952115 GAATTAATTCAAATAGAACTTGG - Intronic
1150039095 17:61839103-61839125 GAGGTAATTTATTTAAAAAATGG - Intronic
1151183643 17:72348059-72348081 GAGGTAATTAAGGTAAAACAAGG + Intergenic
1152010216 17:77708418-77708440 GAGGTAATTAAGTTAAAACAAGG - Intergenic
1155130726 18:22932375-22932397 GAGTTAAGTCTTATAAAATGGGG + Intronic
1155321885 18:24627388-24627410 TAGTTAATATCTATAAAACAAGG + Intergenic
1155811603 18:30243147-30243169 TAGATGATTCATAGAAAACATGG + Intergenic
1155887534 18:31226282-31226304 GAATTCATTGATATAAAAAAGGG - Intergenic
1156553092 18:38039258-38039280 GAGGTTATTCATGTTAAACATGG + Intergenic
1156963149 18:43057352-43057374 GAGTTATTGCAAATAAGACAAGG + Intronic
1156972385 18:43171716-43171738 GAGATAATTAATAGAAAACATGG + Intergenic
1157681881 18:49613785-49613807 GATTTATTAAATATAAAACAAGG - Intergenic
1158886548 18:61833324-61833346 GAGTAACTTAAAATAAAACAAGG + Intronic
1159429456 18:68332541-68332563 AATTAAATTGATATAAAACAAGG - Intergenic
925585373 2:5459621-5459643 GAATTAATTCATTTAACCCATGG + Intergenic
925676463 2:6367442-6367464 ATGTGAATTCATATAACACAAGG + Intergenic
927050247 2:19321147-19321169 GAGTTAAAACATCTAAAAGATGG - Intergenic
928473441 2:31598170-31598192 GAGTTACTTCATTTAAATAATGG - Intergenic
928520876 2:32087399-32087421 GAGGTAATACATAAAAAACAGGG - Intronic
928782333 2:34839045-34839067 AATTTAATTCATATACACCATGG - Intergenic
928847667 2:35697356-35697378 GGGTTAATTCTTGTAATACAAGG - Intergenic
929136751 2:38631915-38631937 GAGATAATTCTTATATATCAAGG + Intergenic
929735012 2:44538495-44538517 GAGTTAGTTCACTTAAAAAATGG - Intronic
931708050 2:64964177-64964199 AAATTAAGCCATATAAAACATGG + Intergenic
931821894 2:65960491-65960513 GATTGAATTCATCTAAAACCTGG - Intergenic
933195836 2:79388509-79388531 AAGTTAAGAAATATAAAACAAGG + Intronic
935007935 2:99099710-99099732 GAAGTAATTCACATATAACAAGG + Intronic
937693490 2:124781859-124781881 AAATTAATTCATCAAAAACATGG + Intronic
938514278 2:131986370-131986392 GAATTTATTCATATAACATATGG - Intergenic
938716151 2:134023683-134023705 GAGATAATACATCTAGAACAGGG - Intergenic
938920943 2:135994123-135994145 GAGTTTATGCAAATAATACATGG + Intergenic
940201953 2:151161751-151161773 TGGTTAATTCTTGTAAAACAAGG + Intergenic
940506959 2:154567727-154567749 GAGGAAATTTATAAAAAACAGGG + Intergenic
941497304 2:166221825-166221847 TAGTTAACTCATATTCAACAGGG + Intronic
942756014 2:179342454-179342476 GAGATAATGCAGGTAAAACATGG - Intergenic
943144844 2:184030034-184030056 AAGTTATTTCATTTAAAACTTGG + Intergenic
943709072 2:191069914-191069936 GAGCTAATTCATATAAAAGTTGG + Intronic
943859649 2:192844520-192844542 GTGGTAATTAAAATAAAACAAGG - Intergenic
946541752 2:220691827-220691849 GAGTTTAATCATATAAAAAGTGG - Intergenic
947272303 2:228350370-228350392 GAGTTGATAAATATTAAACAAGG + Intergenic
947476664 2:230455382-230455404 GAATCAAATAATATAAAACAAGG - Intronic
947632184 2:231661339-231661361 AAGTTAATGCACTTAAAACAGGG + Intergenic
947790440 2:232864100-232864122 GATCTAATTCACAGAAAACATGG - Intronic
1168991411 20:2099081-2099103 GAGGTAATTAAGATAAAATAAGG + Intergenic
1169330184 20:4710178-4710200 AAGTTAATTAACATAAAGCAGGG + Intergenic
1169416617 20:5422730-5422752 GAGGTAATTAAGTTAAAACAAGG + Intergenic
1172904389 20:38358139-38358161 GAGTGACTTCATCTAGAACAGGG - Intronic
1173506066 20:43588269-43588291 TAGATAATGCATATAAAACTTGG - Intergenic
1173634398 20:44542285-44542307 GAGTTAATTGTTATAAAGCTTGG + Intronic
1175143187 20:56875589-56875611 GAGTTAATTGAGATAATTCATGG + Intergenic
1176704724 21:10105361-10105383 TATTTAATTCATAGAAAAGAAGG + Intergenic
1176779501 21:13176527-13176549 GAATTTATTCATATAACATATGG + Intergenic
1177413578 21:20764860-20764882 GAGTAAATTGATAAAAGACACGG + Intergenic
1177977133 21:27865565-27865587 GAATTTATTCATATAACATATGG + Intergenic
1178043204 21:28664527-28664549 CAGTTTATTCTTATAAAATAGGG + Intergenic
1178480833 21:32978223-32978245 GAGATAATTAACAAAAAACATGG + Intergenic
1179174201 21:38995651-38995673 GAGGTAATTAAGATAAAAGAAGG - Intergenic
1179427504 21:41293558-41293580 AACTTGAATCATATAAAACATGG - Intergenic
1181379650 22:22491230-22491252 GAGTAAATTCATAGAAAATGTGG - Intronic
1184923833 22:47623961-47623983 CAGTGAATTTATATATAACACGG + Intergenic
949663892 3:6314309-6314331 GAGTTAAAGAATATAGAACAAGG - Intergenic
949852205 3:8430597-8430619 GAGATAATTAATATTAAATAAGG + Intergenic
950444621 3:13029360-13029382 GGGTTAATACAGATAGAACATGG + Intronic
951082697 3:18470219-18470241 GAGTTTATTCTTATACATCAAGG + Intergenic
951374124 3:21891520-21891542 GAGGTAAATGATATAAGACATGG + Intronic
951804976 3:26633952-26633974 GAACTAATTCAATTAAAACATGG + Intronic
952599387 3:35061095-35061117 CAGTTTCTTCATATAAAAAATGG + Intergenic
952632540 3:35486963-35486985 GAATGAGTTCATATAAAAAAGGG - Intergenic
952754418 3:36853770-36853792 GAGTGTAATCATATAATACATGG - Intronic
955003877 3:54951758-54951780 GAGTTAAGTAAGATAACACAGGG + Intronic
955096556 3:55804512-55804534 GAAATAATGCAAATAAAACAGGG - Intronic
955283344 3:57615200-57615222 GAGTTATTTCATTTAAGATAAGG - Intergenic
956515452 3:70041473-70041495 CAGTTTCTTCATCTAAAACATGG + Intergenic
957209627 3:77242889-77242911 CATTTAATTCATGTAAACCAGGG - Intronic
957370761 3:79291380-79291402 GTGTTATTTCATAAATAACACGG - Intronic
957700962 3:83711358-83711380 GAGTTGTGTCATGTAAAACAAGG - Intergenic
958000039 3:87739129-87739151 AAGTTAATTTAGACAAAACAAGG - Intergenic
958187019 3:90135025-90135047 GAGGTAACTAAGATAAAACAAGG + Intergenic
958209168 3:90446706-90446728 AAGTATCTTCATATAAAACAAGG - Intergenic
958616294 3:96496955-96496977 GAAGTAAGTCATATGAAACAAGG - Intergenic
959760627 3:109959701-109959723 GAGATAATGTATATAAATCAAGG - Intergenic
959850462 3:111080948-111080970 GAGTTTAGACAGATAAAACAGGG + Intronic
959871062 3:111329062-111329084 GAGTGACTTCACATAAAACAAGG - Intronic
961180946 3:124876903-124876925 GAGTGAATTCATTTAAAATTAGG - Intronic
961416695 3:126764440-126764462 GGGTTAAATCCTTTAAAACAAGG - Intronic
962855304 3:139339784-139339806 CAGTTTATGCATATAAAAGATGG + Intronic
963636062 3:147797891-147797913 GAGTTAAAGAATATAATACATGG + Intergenic
963753234 3:149204401-149204423 GAGATAGTTTCTATAAAACAAGG + Intronic
964707080 3:159630555-159630577 GAGTTACTTCATTTAGAATAAGG - Intronic
965055479 3:163708247-163708269 GAGTTGATTCATATCAGAAATGG - Intergenic
965056668 3:163726117-163726139 ATGTTAATTTATAGAAAACAGGG + Intergenic
965238924 3:166167526-166167548 GACATAATTCATACAAAACATGG + Intergenic
965764938 3:172120508-172120530 GATTTAATTCATCTATATCAGGG + Intronic
966310548 3:178588881-178588903 GAGATAATGGATATGAAACAAGG + Intronic
966645585 3:182243386-182243408 GAGTTAATACATATGAATGAAGG - Intergenic
967607239 3:191461543-191461565 TAGATATTTCATATATAACAAGG - Intergenic
969325704 4:6442644-6442666 GAGTTAATTCATATAAAACACGG - Intronic
970199088 4:13583813-13583835 GGGTCAATTCAATTAAAACAAGG + Intronic
970404478 4:15749077-15749099 GAGTTAATTAATCAAAGACATGG + Intergenic
970452430 4:16183673-16183695 GAATTAATTTAAAAAAAACATGG + Intronic
970823122 4:20242501-20242523 GAGTTAATTCAAATATTACTAGG + Intergenic
971233849 4:24823702-24823724 AAGTCAATTCAGGTAAAACAAGG - Intronic
971279088 4:25226504-25226526 GAGTTAATACAGACGAAACAAGG - Intronic
972192068 4:36605972-36605994 AAATTCTTTCATATAAAACATGG + Intergenic
972881264 4:43426121-43426143 GAATTAATTTATATAAAAGGAGG + Intergenic
973024893 4:45255728-45255750 TAGTTTATTCATCTAAAAAATGG + Intergenic
975305484 4:72844992-72845014 TAGTTTCTTCATGTAAAACAAGG - Intergenic
976244424 4:82993145-82993167 TAGTTAATTTAAATAAAAAATGG - Intronic
976349240 4:84042210-84042232 GAGTTAATTAAGTTAAAATAAGG + Intergenic
977139354 4:93348209-93348231 AAGTTATTTTATATAACACAAGG + Intronic
978083806 4:104625140-104625162 GAGATAATTAAGATTAAACAAGG + Intergenic
978446571 4:108786369-108786391 GGGTTAAATCCTTTAAAACAAGG - Intergenic
978552425 4:109941688-109941710 GATTTTATACAGATAAAACAGGG - Intronic
978553157 4:109949717-109949739 GAGATAATTGACTTAAAACATGG + Intronic
978879489 4:113684281-113684303 GTGTTAATTTATATGATACATGG - Intronic
979797170 4:124860683-124860705 AAGTAAATGCATGTAAAACATGG + Intergenic
980225374 4:129977075-129977097 GATTTCATACCTATAAAACAGGG - Intergenic
980376945 4:131961805-131961827 TATTTAATTCATAGAAAAGAAGG + Intergenic
980712279 4:136585226-136585248 GAGTTTATTTGTCTAAAACATGG - Intergenic
982926212 4:161339952-161339974 GAGTTAATTCAAGCAAAACCTGG + Intergenic
984701891 4:182823761-182823783 GACTTTATTGTTATAAAACAGGG - Intergenic
984861015 4:184238541-184238563 GAGTTAATTTATGTAAAGCAAGG + Intergenic
985290484 4:188381530-188381552 GAGTTATTTCACCTAAAACACGG + Intergenic
985813247 5:2106109-2106131 AAGTTACTCTATATAAAACATGG + Intergenic
986188643 5:5471597-5471619 GAGTTTATCCTGATAAAACAAGG + Intronic
986437133 5:7745499-7745521 GAGTGGATTCATATTAACCAAGG - Intronic
986510392 5:8500255-8500277 GAGGTAATTAAGATAAAATAAGG + Intergenic
987202937 5:15595634-15595656 GTGTTAATTCATAGAAAATCTGG + Intronic
987456086 5:18148632-18148654 GACGTAATTCATCTAAAATAAGG - Intergenic
987551690 5:19390826-19390848 GAGTAAATTCCTACAAAATATGG + Intergenic
987606485 5:20142606-20142628 AAGTTAATTCAGTTAAAATAAGG + Intronic
988053616 5:26062823-26062845 GAGTTAAATCATAGAGGACATGG + Intergenic
988106702 5:26759470-26759492 GAGGTATATCATATAAGACATGG + Intergenic
988439634 5:31218348-31218370 TAGTTAATTAAAGTAAAACATGG + Intronic
992858289 5:80886651-80886673 GATTAAAATCATATAAAATAGGG - Intergenic
993829214 5:92732737-92732759 ATGTGAATTCATAAAAAACAGGG + Intergenic
994212997 5:97106811-97106833 GAGGTAATTGATATTAACCATGG + Intronic
994708200 5:103231836-103231858 GAGATAATTAAAGTAAAACAAGG + Intergenic
994934662 5:106238748-106238770 GAGGTAATACATATAATACTTGG + Intergenic
994966193 5:106674692-106674714 GATTTATGTCATATAAAACTAGG + Intergenic
995002512 5:107151596-107151618 TAGTAAATTCATACAAAACCTGG - Intergenic
995313215 5:110737646-110737668 GAGGCAATTCATACAAAAAAAGG - Intronic
997006952 5:129828458-129828480 GTGTTTCTTAATATAAAACAAGG + Intergenic
997573435 5:134953166-134953188 GAGTTTAGTCTTATAAAACATGG + Intronic
997737882 5:136227860-136227882 GAGTTAATGCATAGATGACACGG + Intronic
997882332 5:137601998-137602020 GAGATAATGCATGTAAAACCTGG + Intergenic
999333664 5:150696243-150696265 GAGTCAACTCATTTAAACCATGG + Intronic
999396413 5:151231856-151231878 GAGTCAGTTCATGTAAATCATGG + Intronic
999468461 5:151829795-151829817 TATTTCATTCATATAAAATATGG - Intronic
1000121652 5:158203517-158203539 GAGATCATTCATGTAAAACATGG - Intergenic
1000359639 5:160435033-160435055 GAGTTAATCAAGTTAAAACAGGG - Intergenic
1000785022 5:165532456-165532478 GAGGTAATTAATATAAAATAAGG + Intergenic
1001118372 5:168958420-168958442 GAGAGAATGCATATAAAACCTGG - Intronic
1001996812 5:176168198-176168220 GAGTGGATTCAGATTAAACATGG - Intergenic
1003024518 6:2542400-2542422 GAGGTAATTAAATTAAAACAAGG + Intergenic
1004045059 6:12015130-12015152 GAGTTAACTCAGTTAATACAAGG - Intronic
1004246916 6:13987099-13987121 GGGTTTAATCATTTAAAACAAGG - Intergenic
1004673821 6:17822519-17822541 GAGTTAATTTATATATAAGAAGG + Intronic
1004697349 6:18045887-18045909 GAGTTAAATTATATAATACTAGG - Intergenic
1004741535 6:18465843-18465865 GAATTGTTTCATATAAAATACGG + Exonic
1004985843 6:21081280-21081302 GAGTGAATTTATATTAAATAAGG + Intronic
1005314563 6:24592189-24592211 GAGTTAATTTTTTTAAAATAAGG + Intronic
1006110494 6:31741680-31741702 GAGTTAATGTAAGTAAAACATGG - Intronic
1006301726 6:33197043-33197065 GCTTAAATTCATATAATACATGG + Intronic
1006443074 6:34063939-34063961 GAGTTAATTGCTCTCAAACAGGG + Intronic
1008157515 6:48034737-48034759 GAGTTTATTCTGATAAAATATGG - Intronic
1008178368 6:48296399-48296421 AAGTTAATTCATATTTAAAAAGG - Intergenic
1008208595 6:48693291-48693313 TATATAACTCATATAAAACATGG - Intergenic
1008601801 6:53103474-53103496 GAGATAATCCATATAAAAGAAGG - Intergenic
1008885664 6:56429919-56429941 GGGTTAAATCCTTTAAAACAAGG - Intergenic
1009542658 6:64982273-64982295 GAATTAATTCAAAGAAAAAAAGG + Intronic
1010709016 6:79150864-79150886 GGCATAATTCATATACAACAAGG + Intergenic
1010884736 6:81222203-81222225 GAGTCACTTCATATAAGACCTGG - Intergenic
1010976874 6:82325324-82325346 CAGTTTATTCATATATAAAAAGG + Intergenic
1012105245 6:95149018-95149040 GATTTAATTCATCTAAAGTAGGG + Intergenic
1013559317 6:111289096-111289118 AAGTTAATTTATACTAAACAAGG - Intergenic
1014134747 6:117875723-117875745 GAGTTAGTACATTAAAAACAGGG - Intergenic
1015004504 6:128262895-128262917 TAGATAATTCATAAAAAACTGGG + Intronic
1015770126 6:136760351-136760373 GAGCTAATTAATATATAAGATGG - Intronic
1016725022 6:147353997-147354019 CATGTAATACATATAAAACATGG + Intronic
1017292739 6:152760266-152760288 GACTCTATTAATATAAAACAAGG + Intergenic
1018151205 6:160941032-160941054 GAGTCAATTGATATTCAACAGGG - Intergenic
1018766832 6:166940533-166940555 GACTTAGTTTCTATAAAACAGGG + Intronic
1019073340 6:169367595-169367617 GAGTTGATTAAGTTAAAACAAGG + Intergenic
1020587221 7:10084195-10084217 GAGTTACTTAACAAAAAACAAGG + Intergenic
1020712791 7:11629767-11629789 GAGTTAATTAATTTTCAACATGG - Intronic
1021181460 7:17510701-17510723 GAGTTAATTCATATAGTTCTAGG - Intergenic
1021462894 7:20909196-20909218 GATTTAATTCATCTGAAATAGGG + Intergenic
1021964972 7:25908374-25908396 GAGCTCATGCATATAAACCAGGG - Intergenic
1022792397 7:33701978-33702000 GAGTTTCCTAATATAAAACAGGG - Intergenic
1023521729 7:41056348-41056370 GAGTTAGTGCATATCAGACATGG + Intergenic
1024409315 7:49021156-49021178 GAGTCCATTCATATAAAACCAGG - Intergenic
1024849152 7:53689976-53689998 GAGTAAATTCAAATAATAAAAGG - Intergenic
1026469383 7:70681864-70681886 AAGTAAATTCACACAAAACATGG - Intronic
1027645249 7:80789775-80789797 GAGTTATCTCATATACAAGATGG - Intronic
1030468133 7:109928373-109928395 TTGTTATTTTATATAAAACAAGG - Intergenic
1030630574 7:111891121-111891143 GAATTAAATAGTATAAAACAAGG + Intronic
1030717961 7:112832919-112832941 AAGTAAATATATATAAAACAAGG - Intronic
1031067980 7:117128081-117128103 GAATTATTTACTATAAAACAAGG - Intronic
1031768998 7:125818739-125818761 ATGTTAATATATATAAAACATGG - Intergenic
1031933677 7:127713563-127713585 CAATTAATTCCTAAAAAACAGGG - Intronic
1032241271 7:130161112-130161134 GAGCAAATTCATATAAAAGTAGG - Intergenic
1032971378 7:137167837-137167859 GACTTAATGCTTAGAAAACATGG - Intergenic
1033009367 7:137603920-137603942 GCTTTAATTTATAGAAAACAAGG + Intronic
1033181276 7:139181333-139181355 CAGTTAATTCATAAAAAGAATGG - Intronic
1034909383 7:154981402-154981424 GAATTAGTTCATGTAAAACTGGG + Intronic
1035689532 8:1550715-1550737 GAGTGAAATCACATAAAACAGGG - Intronic
1035823667 8:2621401-2621423 AAGTTAACACATATAAAATAAGG - Intergenic
1038630848 8:29242407-29242429 GATATAATTCAAATAAAATAAGG + Intronic
1038774072 8:30512358-30512380 GATTTAGTTTAGATAAAACATGG + Intronic
1039684808 8:39788466-39788488 GACTTAAATTATATAAAGCATGG - Intronic
1041226968 8:55709989-55710011 AAGTTAATTTAGACAAAACAAGG + Intronic
1041611051 8:59850093-59850115 CAATTAATTCAACTAAAACATGG - Intergenic
1041620882 8:59967655-59967677 CATTTAATTAATTTAAAACATGG + Intergenic
1042303104 8:67307242-67307264 GAGTTTATTCATTTAAAAGGAGG - Intronic
1042318106 8:67445847-67445869 GAGTGAATTCAAAAAATACATGG + Intronic
1042846446 8:73173835-73173857 GAGTTAATGCAGATAAGGCATGG + Intergenic
1043046507 8:75330306-75330328 GAATTAATGCAGATAAAATACGG - Intergenic
1043228935 8:77773370-77773392 AAATTAATTAATATAAAAAAGGG + Intergenic
1043238789 8:77904066-77904088 GACTTAATTCATCACAAACAAGG - Intergenic
1043420063 8:80088726-80088748 GAGGTAATTAAGATTAAACAGGG + Intronic
1043743227 8:83840912-83840934 GGGTGAGTTCATGTAAAACATGG - Intergenic
1044032793 8:87259252-87259274 AAGATAATTCATATAATTCATGG - Intronic
1044139774 8:88636234-88636256 GAGGTGATTAATCTAAAACAAGG + Intergenic
1045539228 8:103066613-103066635 GATATAATTAGTATAAAACAGGG - Intronic
1046234915 8:111411033-111411055 GAGTTCATTTACACAAAACATGG + Intergenic
1046530371 8:115437669-115437691 TAGCTACTTCATATAAAAGATGG - Intronic
1046640413 8:116723391-116723413 GAGGTAATTCAAATGAAATAGGG + Intronic
1046713984 8:117547230-117547252 GAGTTACTACATTTAGAACAGGG - Intergenic
1047185858 8:122632827-122632849 TAGTCAATTTATATAAAACAAGG + Intergenic
1047204962 8:122795665-122795687 GGATTAAATAATATAAAACAAGG - Intronic
1048314501 8:133352152-133352174 GAGGTAATTAAGATAAAATAAGG - Intergenic
1049875087 8:145012236-145012258 GGGTTAACTCCTTTAAAACAAGG + Intergenic
1049975586 9:858509-858531 AAGTTAATTAATATAAAAAGAGG - Intronic
1050024740 9:1322195-1322217 AAGTCCATTCATATAAAACTAGG - Intergenic
1051675459 9:19554039-19554061 GAGGTAATTAAGTTAAAACAAGG + Intronic
1052791687 9:32880865-32880887 GATTTTGTTCATATCAAACAAGG - Intergenic
1053641994 9:40092488-40092510 TATTTAATTCATAGAAAAGAAGG + Intergenic
1054322885 9:63689882-63689904 TATTTAATTCATAGAAAAGAAGG + Intergenic
1054542757 9:66284157-66284179 TATTTAATTCATAGAAAAGAAGG - Intergenic
1056485910 9:87058081-87058103 GAGTGAATGCAGAAAAAACAGGG + Intergenic
1057736462 9:97666336-97666358 TAGTTAAATAATATAAAGCATGG + Intronic
1057984673 9:99700566-99700588 GAGATAATAGATATAAAAAATGG + Intergenic
1058275391 9:103035594-103035616 GAGTAAAATAATATAATACATGG + Intergenic
1059978481 9:119743507-119743529 GAGCAAATTCTTATAAAAGAAGG - Intergenic
1060398641 9:123334155-123334177 GAGTAAATTAATATACGACAGGG - Intergenic
1202789756 9_KI270719v1_random:75460-75482 TATTTAATTCATAGAAAAGAAGG + Intergenic
1186077306 X:5894648-5894670 GAGATAATTCATAAAACATAGGG + Intronic
1187348659 X:18491119-18491141 GAGTAAATTCATTCTAAACAAGG - Intronic
1188692549 X:33148482-33148504 GAGTTAAATTAAATAAAAGAAGG + Intronic
1188722326 X:33538382-33538404 GAGAGGACTCATATAAAACAAGG - Intergenic
1191801981 X:65091860-65091882 TTATTAATTCAAATAAAACAGGG + Intergenic
1192385972 X:70670248-70670270 GAGTTCCCTCATATAGAACAAGG - Intronic
1194181847 X:90720202-90720224 GAGTTACTTCATTTAGAATAAGG - Intergenic
1194627781 X:96245873-96245895 GAATTAATGCATAAAAAATAGGG - Intergenic
1195070256 X:101272534-101272556 AAGTGAAATCATATAATACATGG - Intronic
1195859035 X:109360987-109361009 GAGTTAATAGCTATACAACAAGG + Intergenic
1197161912 X:123333307-123333329 GAGGTAATTCATATAGAAGAAGG + Intronic
1197542848 X:127787969-127787991 GAGGTAATACATATAACACTTGG - Intergenic
1198475213 X:136990050-136990072 GAGTTAAATCATGGAAAACCAGG + Intergenic
1199503068 X:148530521-148530543 GAATTAATTCATATCAAAAGAGG - Intronic