ID: 969326014

View in Genome Browser
Species Human (GRCh38)
Location 4:6444274-6444296
Sequence CGCGGAGATCAGGGAGGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 170}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969326006_969326014 -2 Left 969326006 4:6444253-6444275 CCATTACAGGAGGTCTGCTCCCG 0: 1
1: 0
2: 0
3: 4
4: 52
Right 969326014 4:6444274-6444296 CGCGGAGATCAGGGAGGCCTGGG 0: 1
1: 0
2: 0
3: 22
4: 170
969326005_969326014 7 Left 969326005 4:6444244-6444266 CCTTTGACACCATTACAGGAGGT 0: 1
1: 0
2: 0
3: 1
4: 98
Right 969326014 4:6444274-6444296 CGCGGAGATCAGGGAGGCCTGGG 0: 1
1: 0
2: 0
3: 22
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969326014 Original CRISPR CGCGGAGATCAGGGAGGCCT GGG Intronic
900192802 1:1358595-1358617 CGGTGACATCACGGAGGCCTGGG + Intronic
900236534 1:1594274-1594296 GGAGGTGAGCAGGGAGGCCTAGG + Intergenic
900372870 1:2340039-2340061 CGCTGACATCAGGGTGGCCCTGG + Intronic
903740870 1:25557623-25557645 ATGGGAGATCAGGGGGGCCTAGG + Intronic
904702871 1:32368521-32368543 CACGGACATCAGTGAGGACTGGG - Exonic
905865771 1:41375789-41375811 CCCGGAGATCTGGCAGGCCCTGG + Intronic
907437075 1:54456799-54456821 TGCTGAGATGAGGGAGGCCCGGG - Intergenic
910674514 1:89803087-89803109 CCCAGAGATCTGGGAGGCCAAGG + Intronic
914803538 1:150976521-150976543 CTGGGAGATCAGGCAGGCCTGGG - Intergenic
915603964 1:156939381-156939403 CGCCGATATCAGGCAGGCTTTGG - Intronic
917222652 1:172748433-172748455 CGCAGAGGTCAGAGAGCCCTTGG + Intergenic
917452322 1:175157406-175157428 GGCGGTGACCAGGGAGGGCTGGG + Intronic
919155024 1:193753352-193753374 TGAGGAGCTCAGGGAGGCCATGG + Intergenic
919483771 1:198121264-198121286 TGAGGAGACCAGGGAGGCCTGGG - Intergenic
919804542 1:201373344-201373366 TACAGAGATCAGCGAGGCCTAGG + Exonic
920390721 1:205598976-205598998 CACGGGGAGGAGGGAGGCCTTGG - Intronic
922792372 1:228317459-228317481 CTGGGGGATCAGGGAGGCCTGGG - Exonic
923888276 1:238181746-238181768 CCCGGTGATCAGGCAGGCCCTGG + Intergenic
1064336582 10:14448593-14448615 GAAGGGGATCAGGGAGGCCTGGG + Intronic
1067006853 10:42672589-42672611 CGCGGACATCAGGGAGGGGCAGG - Intergenic
1067202423 10:44184846-44184868 GCAGGAGAACAGGGAGGCCTGGG + Intergenic
1070351047 10:75592473-75592495 CGCGGAGATCTGGGACGGCAAGG + Intronic
1071508922 10:86249269-86249291 CTGGGAGATCAGAGAGGGCTTGG + Intronic
1073319234 10:102604229-102604251 CGCAGGGAGCAGAGAGGCCTGGG - Intronic
1076760764 10:132604919-132604941 AGCGGAGGGCAGGGAGGCCACGG + Intronic
1076923410 10:133467274-133467296 CGAGGAAATCATGGAGGCCGAGG + Intergenic
1079148993 11:17881122-17881144 CTTGGAGATCAGGCAGACCTGGG - Intronic
1080592719 11:33737273-33737295 CACGGAGATCAGGGAGAACAGGG + Intergenic
1080648812 11:34206815-34206837 GGAGGAGAGCGGGGAGGCCTGGG - Intronic
1081993422 11:47349592-47349614 CAGGGAGATCCCGGAGGCCTGGG - Intronic
1083171311 11:60925203-60925225 CGCCAAGGTCAGGGAGCCCTGGG - Intronic
1084155662 11:67311289-67311311 GGAGGAGGGCAGGGAGGCCTGGG + Intronic
1084184379 11:67464045-67464067 CGCAGAGATGACGCAGGCCTGGG - Exonic
1085452366 11:76642314-76642336 CAGGGAGACCAGGGAGGTCTGGG + Intergenic
1085645579 11:78220247-78220269 GGCAGAGATCATGGAGGCCAGGG - Intronic
1088896178 11:114080096-114080118 CCCGGGGAGTAGGGAGGCCTGGG + Intronic
1094833024 12:34309090-34309112 CACGCAGAAGAGGGAGGCCTGGG + Intergenic
1098409952 12:70170806-70170828 AGCTTAGATGAGGGAGGCCTGGG - Intergenic
1099996662 12:89786379-89786401 TGCACAGAGCAGGGAGGCCTTGG - Intergenic
1101582485 12:106054221-106054243 CACAGAGATCAGGGAGGCCAGGG + Intergenic
1103433041 12:120904162-120904184 CGCGGAGAACAAGGGGGCCCTGG + Exonic
1103480155 12:121245477-121245499 GGTGGAAAGCAGGGAGGCCTGGG - Intronic
1111672621 13:91348555-91348577 CGCCGAGATCGGCGCGGCCTGGG + Intergenic
1112400959 13:99077899-99077921 CACTGAGATCTGGGAGTCCTTGG + Intronic
1113428341 13:110228470-110228492 CAGGGAGAACAGGGAAGCCTTGG + Intronic
1118808081 14:69255016-69255038 CGGGAAGGTCAGAGAGGCCTTGG + Intergenic
1119438508 14:74612734-74612756 CGCGGAGCGCAGGGAGGTCCCGG + Intergenic
1121337103 14:93084112-93084134 TTCTGAGGTCAGGGAGGCCTCGG - Intronic
1121511458 14:94515994-94516016 AGTGGGGTTCAGGGAGGCCTCGG + Exonic
1122359527 14:101151245-101151267 CCAGGAGCTCAGGGAGGCCGCGG + Intergenic
1123216402 14:106813044-106813066 CCCGGTGCTCAGGGAGGCCCGGG - Intergenic
1123473507 15:20571356-20571378 CCTGGAGAGCAGGGAGGCCATGG + Intergenic
1123644502 15:22428997-22429019 CCTGGAGAGCAGGGAGGCCATGG - Intergenic
1123665818 15:22608905-22608927 CCTGGAGAGCAGGGAGGCCATGG - Intergenic
1123733805 15:23166367-23166389 CCTGGAGAGCAGGGAGGCCATGG + Intergenic
1123751942 15:23363748-23363770 CCTGGAGAGCAGGGAGGCCATGG + Exonic
1124284308 15:28387672-28387694 CCTGGAGAGCAGGGAGGCCATGG + Exonic
1124298389 15:28523942-28523964 CCTGGAGAGCAGGGAGGCCATGG - Exonic
1124319641 15:28703318-28703340 CCCGGAGAGCAGGGAGGCCATGG - Exonic
1124482870 15:30092112-30092134 CCCGGAGAGCAGGGAGGCCATGG + Exonic
1124489324 15:30144183-30144205 CCTGGAGAGCAGGGAGGCCATGG + Exonic
1124520706 15:30405106-30405128 CCCGGAGAGCAGGGAGGCCATGG - Exonic
1124537953 15:30561113-30561135 CCTGGAGAGCAGGGAGGCCATGG + Exonic
1124544413 15:30613174-30613196 CCCGGAGAGCAGGGAGGCCATGG + Exonic
1124564375 15:30800610-30800632 CCTGGAGAGCAGGGAGGCCATGG + Intergenic
1124594076 15:31079432-31079454 CAAGGAGTTAAGGGAGGCCTGGG - Intronic
1124754205 15:32394144-32394166 CCTGGAGAGCAGGGAGGCCATGG - Exonic
1124760699 15:32446473-32446495 CCCGGAGAGCAGGGAGGCCATGG - Exonic
1124777934 15:32602590-32602612 CCTGGAGAGCAGGGAGGCCATGG + Exonic
1124922343 15:34039012-34039034 CGAGGAGCTCGGGGAGGCCGTGG - Exonic
1127433241 15:58933070-58933092 CGCGGAGACCTGGGAGGCGCTGG - Intronic
1131072854 15:89476964-89476986 TGCAGAGATCAGGGATTCCTGGG + Intronic
1131223565 15:90605632-90605654 CGCTGAGATCAGAGAGACCTGGG - Intronic
1131329074 15:91479684-91479706 CCCGGAGGTCAGGGAGGCCCAGG - Intergenic
1132547238 16:538906-538928 TTTGGAGCTCAGGGAGGCCTGGG - Intronic
1132897295 16:2235095-2235117 TGCGGAGACCAGTGAGGCCACGG + Exonic
1132953467 16:2578195-2578217 CGCAGAGCGCAGGGAGGCCCTGG + Intronic
1132960885 16:2621973-2621995 CGCAGAGCGCAGGGAGGCCCTGG - Intergenic
1135417583 16:22280365-22280387 CGCAGAGATCAGGTAGGGCCTGG + Exonic
1135821481 16:25690441-25690463 CTCGGAGCACAGGGAGGGCTGGG + Intergenic
1137554427 16:49461663-49461685 CGTGCAGATCAGGGAGGACCTGG + Intergenic
1137705994 16:50536143-50536165 GGTGGAGCTCAGGGAGGCCTGGG + Intergenic
1139318088 16:66090519-66090541 TGCTGAAATCAGGGAGGCCGAGG - Intergenic
1139671686 16:68496763-68496785 GGCGGAGGTCAGGAAGGCTTTGG - Intergenic
1142260655 16:89041121-89041143 GGAGGAGCCCAGGGAGGCCTGGG + Intergenic
1144353299 17:14420206-14420228 ATCGGGGATCAGGGAGGCCATGG - Intergenic
1146664086 17:34685297-34685319 CACAGAGACCAGGGAGGGCTGGG + Intergenic
1147762771 17:42811208-42811230 CGCCAAGTTCAGGGATGCCTAGG - Intronic
1148052141 17:44774660-44774682 GGCGGATATGAGGGAGGCCAAGG - Intronic
1148084853 17:44987897-44987919 GGCAGAGGACAGGGAGGCCTTGG + Intergenic
1148792226 17:50179875-50179897 TGCTGAGTTCACGGAGGCCTAGG - Intergenic
1151662455 17:75525885-75525907 CGGGGAGGCCAGGGAGGCCCAGG + Intronic
1151888845 17:76940363-76940385 CGCAGTGATCAGGGAGGGCTGGG - Intronic
1152407946 17:80108161-80108183 CGAGGAGCTCAGAGTGGCCTGGG - Intergenic
1153666338 18:7370338-7370360 ACCAGAGATCAGAGAGGCCTGGG + Intergenic
1156363416 18:36404134-36404156 CCAGGAGGTCAGAGAGGCCTGGG - Intronic
1156395965 18:36700233-36700255 CCCTGAGCTCAGGGAGGCCAAGG - Intronic
1156852809 18:41747712-41747734 TGGGGCAATCAGGGAGGCCTTGG - Intergenic
1157592432 18:48843611-48843633 CCAGGGGATCTGGGAGGCCTGGG + Intronic
1159739787 18:72153143-72153165 CGGGGAGTTCAGGGAGGCCAAGG - Intergenic
1161256741 19:3314093-3314115 CCCGGAGCTAACGGAGGCCTTGG + Intergenic
1161619041 19:5288885-5288907 CGCAGACATCAGGGAGGTGTGGG - Intronic
1162771185 19:12950192-12950214 TGCAGAGATCGGGGAGGACTGGG - Intronic
1163007474 19:14405968-14405990 CTCTGGGGTCAGGGAGGCCTGGG + Intronic
1165077786 19:33290405-33290427 GGTGGAGCTCAGGGAGGCCCTGG + Intergenic
1165396018 19:35563836-35563858 CCCTGAGATCAGGGAGCCCCTGG + Intergenic
1167577311 19:50323960-50323982 CCCGGGGATCGGGGAGGCCTGGG + Exonic
1168549623 19:57282012-57282034 CGCAGTGGTTAGGGAGGCCTGGG + Intronic
925120762 2:1415975-1415997 CTCTGAGATCAGGGAAGCCGTGG + Intronic
927509576 2:23635983-23636005 CATGGAAATCAGGGTGGCCTGGG + Intronic
927654693 2:24935354-24935376 GGGGCAGAGCAGGGAGGCCTAGG + Intergenic
932344276 2:70985453-70985475 TGCAGAGAAAAGGGAGGCCTGGG - Intronic
937132362 2:119523320-119523342 CCCGGAGCTCAGAGAGGCCCGGG + Intronic
947750248 2:232528378-232528400 AGGGGAGGTCAGGGAGGGCTTGG - Intronic
948405809 2:237718093-237718115 CGAGGAGATCAGGGCGGCTGTGG - Intronic
948625640 2:239266368-239266390 TGCGGAGGTCATGGAGGGCTGGG - Intronic
948803522 2:240443347-240443369 TGTAGAGATGAGGGAGGCCTGGG + Intronic
1168810987 20:704487-704509 CGGTGAGATCAGGCAGCCCTGGG - Intergenic
1169235545 20:3927029-3927051 TGCAGAGCTCAGGGAGGCCAGGG + Intronic
1169255237 20:4091904-4091926 GGCTGAGATAAGGGAGGCCCCGG - Intergenic
1171033862 20:21701350-21701372 AGCGAACATCATGGAGGCCTAGG + Intergenic
1171567569 20:26208954-26208976 AGAGGCGCTCAGGGAGGCCTGGG + Intergenic
1173131468 20:40398041-40398063 GGTGGAGATCAGGGAGTCCCAGG - Intergenic
1174092565 20:48060988-48061010 CATGGAGAGAAGGGAGGCCTAGG - Intergenic
1177792279 21:25734598-25734620 CGCGGGGGGCAGGGAGGCCCGGG - Exonic
1179483205 21:41691719-41691741 GGCAGAGATAAGGGAGGACTTGG - Intergenic
1179712925 21:43273470-43273492 CCAGGAGATCAGGGAAGCCTGGG - Intergenic
1179810048 21:43864850-43864872 CGCGGGGATCAGGGGGGTCGGGG - Intergenic
1180050639 21:45329557-45329579 CACGGAGCCCAGGGAGGCCCGGG - Intergenic
1181170074 22:21003069-21003091 CACGGCCATCACGGAGGCCTGGG - Intergenic
1181343656 22:22201606-22201628 CGCTGGGATAAGAGAGGCCTGGG + Intergenic
1182698205 22:32210332-32210354 CATGGAGATGAGGGAGACCTGGG - Intergenic
1183728613 22:39604389-39604411 TTGGGAGATCAGGGAGGGCTGGG + Intronic
1184443783 22:44535453-44535475 CACGGTGGTCAGGGAGGCCTGGG + Intergenic
1184494031 22:44826916-44826938 GGAGGAGCTCAGGGAGGCCAGGG + Intronic
1184547856 22:45184283-45184305 CCCTGAGAACTGGGAGGCCTCGG - Intronic
1184668515 22:46000993-46001015 AGGGGAGACCAGGGAAGCCTTGG + Intergenic
951551511 3:23879652-23879674 CGTGGGCACCAGGGAGGCCTGGG + Intronic
953769765 3:45771169-45771191 CTCAGAGCTCAGGGAGGCCTGGG + Intronic
953795694 3:45984345-45984367 CGCTGAGCTCAGGGAAGTCTGGG + Intronic
954379231 3:50210872-50210894 TGGGGAGATCACGGTGGCCTTGG - Intronic
961435303 3:126912649-126912671 CGGGGGAGTCAGGGAGGCCTGGG - Intronic
962648393 3:137463249-137463271 TGAGGGGAACAGGGAGGCCTAGG + Intergenic
968427203 4:531970-531992 TGGGGAGACCAGGGAGGGCTGGG - Intronic
968892897 4:3380755-3380777 TGCATAGAGCAGGGAGGCCTTGG + Intronic
969326014 4:6444274-6444296 CGCGGAGATCAGGGAGGCCTGGG + Intronic
970194690 4:13542651-13542673 AGCGGAGGTCTGGGAGGCCCTGG + Intronic
972568707 4:40291665-40291687 CACAGAAATCAGGGAGGCCATGG - Intergenic
974270599 4:59646567-59646589 CCCAGAGATTTGGGAGGCCTAGG - Intergenic
976083202 4:81379498-81379520 AGCTTAGATCAGGGAGGGCTTGG - Intergenic
978618059 4:110615119-110615141 CGCTGAGGCCAGTGAGGCCTGGG + Intergenic
983006365 4:162490254-162490276 CGCAAAGAGCAGGGGGGCCTTGG - Intergenic
989205885 5:38808914-38808936 CGCGGATTTCAGGGAAGGCTGGG + Intergenic
990431418 5:55738442-55738464 CTCGGTGAAGAGGGAGGCCTTGG - Intronic
997377753 5:133409479-133409501 GGAGGAGATCTGGGAGGGCTGGG - Intronic
997646114 5:135483096-135483118 CGGAGAGATCAGGGTGGACTAGG - Intergenic
998936682 5:147236404-147236426 CCTGGAGATCAGGAAGGGCTGGG + Intronic
999279192 5:150353831-150353853 CCCTGAGATCAGAGAGGGCTGGG - Intergenic
1003622310 6:7711606-7711628 CAAGGAGAACAAGGAGGCCTAGG - Intergenic
1004243691 6:13952164-13952186 CGAGGAGCTCAGGGAGACCAGGG + Intronic
1004432386 6:15556695-15556717 CGAGGAGCTCAGGGAGGCCAGGG - Intronic
1006295183 6:33167096-33167118 CCCGGAGACCAGGCAGCCCTGGG + Exonic
1006373686 6:33660015-33660037 CTGGGAGAGAAGGGAGGCCTGGG + Intronic
1006443874 6:34068194-34068216 CCTGGAGAACAGGGAGGCTTGGG + Intronic
1006836894 6:37004456-37004478 TCCTGGGATCAGGGAGGCCTGGG + Intergenic
1009832117 6:68951269-68951291 AGTGGAGGTCAGGGAGGCTTTGG + Intronic
1012548421 6:100447214-100447236 CGCAGAGAGCAGGGTCGCCTGGG + Intronic
1016756811 6:147696462-147696484 TGTGGTGACCAGGGAGGCCTGGG - Intronic
1017531011 6:155292187-155292209 CCTGGAGATCTGGGAGGCCTCGG + Intronic
1018394447 6:163366825-163366847 CACGGAGAACAGGGCAGCCTGGG + Intergenic
1019536652 7:1532938-1532960 CGCGGAGAGCAGGGAGGGTGGGG - Intronic
1020080413 7:5283324-5283346 CGCGGTGCTCAGGGAGGCGGTGG - Intronic
1024270571 7:47638491-47638513 AGCAGAGATCAGGGACTCCTAGG - Intergenic
1026015328 7:66667183-66667205 CCCGGGGATCAGGAAGGGCTTGG + Intronic
1029611248 7:101627700-101627722 CTCGGAGATCCTGGAGGCTTAGG - Intronic
1029821135 7:103149006-103149028 CTCCGAGATGAGGGAGGGCTCGG + Intronic
1035472273 7:159118052-159118074 CGGGGAGCTCAGAGAGGCCGGGG + Intronic
1036585960 8:10123962-10123984 CGATGAGATCAGGGAGGAGTAGG + Intronic
1038035153 8:23681287-23681309 CACGGAGACCAGGGAGGCCCGGG + Exonic
1038575582 8:28701371-28701393 CGCGGAGCTGCGGGAGGCCTCGG + Exonic
1042860388 8:73307342-73307364 CGTGGAGGGCAGGGAGGACTAGG + Intronic
1048851511 8:138649727-138649749 CTGGTAGACCAGGGAGGCCTGGG + Exonic
1048906652 8:139095628-139095650 CATGGAGAGGAGGGAGGCCTTGG + Intergenic
1051636392 9:19184408-19184430 TGCCGAGAACAGGAAGGCCTGGG - Intergenic
1054839417 9:69719987-69720009 CTCAGGGAACAGGGAGGCCTGGG - Intronic
1055405901 9:75973572-75973594 CCCGGAGATCCAGGAGGCCAAGG - Intronic
1057219264 9:93247249-93247271 CTGGGAGCTCAGGGAGCCCTTGG + Intronic
1057605718 9:96496690-96496712 CGGGGACTTCAGGGTGGCCTGGG - Intronic
1057834135 9:98430532-98430554 CTCAGAGCTCAGGCAGGCCTGGG - Intronic
1057955861 9:99407280-99407302 CTCTGAAATCAGGAAGGCCTGGG + Intergenic
1061839145 9:133347692-133347714 CGCGGTGCTCAGGGAGGGCCCGG + Exonic
1185456378 X:312856-312878 GGCCAAGATCAGGAAGGCCTTGG - Exonic
1193246583 X:79237161-79237183 TGCAGAGAGCAGGGAGGCCCTGG + Intergenic