ID: 969326219

View in Genome Browser
Species Human (GRCh38)
Location 4:6445821-6445843
Sequence CACACCAACATGATGTTCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 189}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969326213_969326219 21 Left 969326213 4:6445777-6445799 CCAAGAGGTGCTTTCTAAGCAGG 0: 1
1: 0
2: 1
3: 18
4: 152
Right 969326219 4:6445821-6445843 CACACCAACATGATGTTCTAAGG 0: 1
1: 0
2: 1
3: 17
4: 189
969326218_969326219 -6 Left 969326218 4:6445804-6445826 CCTGGCTCTAAATGTCTCACACC 0: 1
1: 0
2: 3
3: 11
4: 124
Right 969326219 4:6445821-6445843 CACACCAACATGATGTTCTAAGG 0: 1
1: 0
2: 1
3: 17
4: 189
969326212_969326219 22 Left 969326212 4:6445776-6445798 CCCAAGAGGTGCTTTCTAAGCAG 0: 1
1: 0
2: 0
3: 19
4: 154
Right 969326219 4:6445821-6445843 CACACCAACATGATGTTCTAAGG 0: 1
1: 0
2: 1
3: 17
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969326219 Original CRISPR CACACCAACATGATGTTCTA AGG Intronic
900274492 1:1815277-1815299 CACAGCACAATGCTGTTCTAAGG + Intronic
901200070 1:7461762-7461784 CAGACCAACTAGAAGTTCTAGGG + Intronic
901344585 1:8528624-8528646 AGCACCAACATGATGCTCAAAGG + Intronic
902970083 1:20042052-20042074 TACACCACCATGCTGTTATATGG - Intronic
907174642 1:52507673-52507695 AACACCAACATGATGCTCAAAGG + Intronic
908409928 1:63853433-63853455 CATGCCAACATGATGCTCAAAGG + Intronic
908686046 1:66721353-66721375 CAGGCCAACGTGATTTTCTAAGG - Intronic
910921723 1:92355739-92355761 AGCACCAACATGATGCTCAAAGG + Intronic
910952283 1:92662865-92662887 CACACAAAAATTATGTCCTAAGG - Intronic
911092122 1:94025820-94025842 CTCACCAAAATGATATCCTACGG - Intronic
912554661 1:110507582-110507604 CACCCCTACCTGTTGTTCTATGG - Intergenic
914837786 1:151222418-151222440 CACACAAACATGTAGCTCTAGGG - Intronic
915433462 1:155885259-155885281 GACTCCAAAAGGATGTTCTAGGG + Intergenic
916240752 1:162636607-162636629 CCCACCACCATCATTTTCTAGGG + Intronic
916251325 1:162741385-162741407 AACACCAGCATGACGTTCAAAGG - Intronic
918378786 1:183934476-183934498 CACGCCCACATGATGTTTTGTGG - Intronic
918604960 1:186413175-186413197 AGCACCAACATGATGCTCAAAGG + Intronic
921242961 1:213205953-213205975 AGCACCAACATGATGTTCAAAGG - Intronic
921372779 1:214442317-214442339 AGCACCAACATGATGCTCAAAGG - Intronic
921666647 1:217880803-217880825 CTCACCAACAGGATGTTTTGGGG + Intergenic
922845123 1:228678616-228678638 TACACCACCATGCTGTTTTATGG - Intergenic
923217315 1:231860428-231860450 AGCACCAACATGATGCTCAAAGG - Intronic
1064491647 10:15863940-15863962 CTCACCAACATCATATTCAAGGG + Intergenic
1065291442 10:24234161-24234183 AGCACCAACATGATGCTCAAAGG + Intronic
1066447286 10:35494982-35495004 AGCACCAACCTGATGTTCAAAGG + Intronic
1068361052 10:55975306-55975328 TACACCACCATGCTGTTATATGG + Intergenic
1076358211 10:129868049-129868071 CACATCAACATGCTGATCTACGG - Intronic
1078701804 11:13692183-13692205 AGCACCAACATGATGCTCAAAGG + Intronic
1078773229 11:14370393-14370415 AACACCAACATGATGTTCAAAGG + Intergenic
1080335703 11:31193385-31193407 AGCACCAACATGATGCTCAAGGG + Intronic
1081193099 11:40128361-40128383 CAGACCCACATTATGTTTTAAGG - Intronic
1083327743 11:61881763-61881785 AACACCTACATGATCTACTAGGG + Intronic
1091435385 12:468651-468673 CACCTCAACATGAAGATCTATGG + Intronic
1092927334 12:13283313-13283335 ATCACCAACATGATGCTCAAAGG - Intergenic
1094427621 12:30331674-30331696 AACACCAAAATAATCTTCTAAGG - Intergenic
1097213325 12:57389863-57389885 CACACCATCATCTTGTGCTATGG + Intronic
1098422986 12:70323797-70323819 CACACAAAAAGGATGTTTTATGG - Intronic
1098475758 12:70901082-70901104 CATACCAACATGATGCTCAAAGG - Intronic
1098920234 12:76296017-76296039 TACACCACCATGCTGTTATATGG + Intergenic
1101669161 12:106850850-106850872 AGCACCAACATGATGCTCAAAGG + Intronic
1102105639 12:110319889-110319911 AGCACCAACATGATGCTCAAGGG + Intronic
1102116456 12:110406815-110406837 TACACCACCATGCTGTTATATGG - Intergenic
1103163002 12:118745854-118745876 TCCACCAACATGATCCTCTAGGG - Intergenic
1106045344 13:26134591-26134613 CTCACCACCATGTTGTTCTATGG + Intronic
1106418060 13:29562420-29562442 AGCACCAACATGATGCTCAAAGG + Intronic
1106774711 13:32997728-32997750 TAGACCAACATGTTGTTCAAGGG - Intergenic
1107223447 13:38016312-38016334 AGCACCAACATGATGCTCAAAGG - Intergenic
1108281736 13:48868421-48868443 TGCACCAGCATGATGTTATATGG - Intergenic
1110446733 13:75591941-75591963 AGCACCAACAGGATGTTCAAAGG - Intronic
1110522535 13:76497703-76497725 CACAACTACAAGATTTTCTAAGG + Intergenic
1111209673 13:85061683-85061705 CACACAAACATGATGTAGGAAGG + Intergenic
1112691300 13:101897823-101897845 AACACTGACATGATGTTCAATGG + Intronic
1114052802 14:18935873-18935895 CACACCTCCATGATGTTGGAAGG + Intergenic
1114109756 14:19466052-19466074 CACACCTCCATGATGTTGGAAGG - Intergenic
1117950258 14:61075761-61075783 CACACAAACAGGTTGATCTATGG - Intronic
1119559987 14:75582276-75582298 TACACCACCATGCTGTTATATGG - Intronic
1121123158 14:91389052-91389074 CAGCCCAACATGAGGTTCAAGGG + Intronic
1123979735 15:25589780-25589802 CACAACAACAGGATTGTCTAAGG + Intergenic
1124890581 15:33728648-33728670 GGCACCAACATGATGCTCAATGG - Intronic
1125156571 15:36593474-36593496 CACACTGACGTGATGATCTAGGG - Intronic
1125826101 15:42677891-42677913 CACAACACCATGATGTACTCTGG - Intronic
1126055638 15:44727403-44727425 AGCACCAACATGATGCTCAAAGG - Intergenic
1126458455 15:48889954-48889976 CAAACCAACAAAATATTCTAGGG + Intronic
1126608788 15:50507358-50507380 AGCACCAACATGATGCTCAAGGG - Exonic
1127939254 15:63677133-63677155 AGCACCAACATGATGCTCAATGG + Intronic
1128257098 15:66204943-66204965 CACACCACCATGTTGTTCCTTGG - Intronic
1131951104 15:97682884-97682906 CAAACAAACATGGTGTTCAAGGG + Intergenic
1132427096 15:101726834-101726856 GACACCAGCATGATATCCTATGG - Intergenic
1133308298 16:4825508-4825530 CACATCAGCATCATGTTCTATGG - Intronic
1133453212 16:5920718-5920740 CACACCGACATCATTGTCTAGGG - Intergenic
1133732134 16:8587034-8587056 GACACCAACATGATGTTACCTGG - Intronic
1134892089 16:17850301-17850323 CACAACGATATGATGTGCTAGGG + Intergenic
1138176834 16:54907860-54907882 GACAACAACCTGATGTTCTTTGG + Intergenic
1140922947 16:79555633-79555655 CACACCAACATGATGCTGAAAGG + Intergenic
1143410702 17:6706735-6706757 GACACCAACATGCTGTTCCTGGG - Exonic
1146174020 17:30653390-30653412 CCCACCAGCATCATGTTCTGGGG + Intergenic
1146347475 17:32069417-32069439 CCCACCAGCATCATGTTCTGGGG + Intergenic
1147126946 17:38377310-38377332 CACACTGACATGATGCTCAAAGG + Intronic
1151135505 17:71942715-71942737 CTCATCAACATGAAGTTCAAAGG + Intergenic
1155135019 18:22982116-22982138 AACACAAACATGAAGCTCTAAGG - Intronic
1155467190 18:26150061-26150083 AGCACCAACATGATGCTCAAAGG + Intronic
1156108391 18:33693063-33693085 AACCCCAACATGATTTTCTTCGG - Intronic
1157268891 18:46254376-46254398 CACACCAACTTGATGTCTTGTGG - Intronic
1158241917 18:55387188-55387210 CACACCTATATCATGTTCCATGG - Intronic
1158886571 18:61833559-61833581 CACACAAACATGATTTCCTGAGG + Intronic
1159506258 18:69340629-69340651 CACACATACATGATGATGTAGGG - Intergenic
1165949463 19:39465977-39465999 AGCACCAACATGATGCTCGAAGG - Intronic
1166071250 19:40389466-40389488 TCCACCAGCATGATGTTCTCAGG + Exonic
925485823 2:4329561-4329583 CACACCAACATGGTGACCTGTGG - Intergenic
926239663 2:11075197-11075219 CTGACCAACATGGTGTTCTTTGG - Intergenic
926551515 2:14307083-14307105 CAGACCCACATGATGTTTTAAGG + Intergenic
926635700 2:15176713-15176735 AACACCAACATGACATTCAAAGG - Intronic
928372319 2:30749221-30749243 AACACCAACATGATACTCAAAGG + Intronic
929205139 2:39282850-39282872 CACACAAACACTATTTTCTATGG - Intronic
929841119 2:45464393-45464415 CACAGAAAAACGATGTTCTAGGG + Intronic
930035720 2:47083941-47083963 CACTCCTACATGATTTTCTGGGG - Intronic
930318837 2:49829225-49829247 TAGACCATCATGATATTCTATGG + Intergenic
930645851 2:53905971-53905993 AGCACCAACATGATGCTCAAAGG - Intronic
935083113 2:99818149-99818171 AGCACCAACATGATGCTCAAAGG + Intronic
936310926 2:111382641-111382663 CAGTGTAACATGATGTTCTATGG - Intergenic
936605898 2:113953409-113953431 AGCACCAACATGATGTTCAAAGG - Intronic
939584092 2:143986061-143986083 CACACCAACTAGAGGTTTTAAGG + Intronic
939625359 2:144470644-144470666 CACACAATAATGATGTTTTACGG - Intronic
940183254 2:150957242-150957264 TGCACCACCATGCTGTTCTATGG + Intergenic
941512537 2:166431110-166431132 CACTCCAACATGCTGTGCTGTGG + Intronic
942233457 2:173881326-173881348 AACACCAATATGATCTACTAGGG - Intergenic
942578902 2:177395269-177395291 CACACCAAGATGATGGTTGAAGG + Intronic
944011741 2:194981864-194981886 CACACCAACATGGTGTGCATGGG + Intergenic
944251375 2:197582674-197582696 CACACCACCATGCTGTTATATGG + Intronic
945357637 2:208857924-208857946 CACACCCACATGAAGTGCTGTGG - Intergenic
945963261 2:216158094-216158116 CCCTCCAAAATGAGGTTCTAGGG - Intronic
947842503 2:233217164-233217186 TGCACCACCATGATGTTTTATGG - Intronic
948401248 2:237687100-237687122 CATTCCATCATGATGTGCTAAGG + Intronic
1169689737 20:8316988-8317010 CCCACCAAGATGAAGTTCTTTGG + Intronic
1169892508 20:10468811-10468833 CACCTCAAGATGATGTTCTTAGG - Intronic
1169955658 20:11099927-11099949 TAGACTAACATTATGTTCTATGG + Intergenic
1170277848 20:14612632-14612654 CACACTAACACAATGTTATAGGG - Intronic
1171061140 20:21961630-21961652 AGTACCAACATGATGTTCAAAGG + Intergenic
1172826534 20:37792566-37792588 AACATCAACATGATCTTCAAAGG + Intronic
1176875907 21:14127754-14127776 CTCACCAACATTCTGTACTAAGG + Intronic
1177093030 21:16793969-16793991 CAAACTAACTTGAAGTTCTAAGG + Intergenic
1177187466 21:17813754-17813776 AACACCTACATGATGCTCAAAGG - Intronic
1177592994 21:23197073-23197095 AACACCAACCTGCTGTTCTAGGG - Intergenic
1178622466 21:34188518-34188540 CACCCCACCATTATGTTCCAAGG + Intergenic
1180471276 22:15658247-15658269 CACACCTCCATGATGTTGGAAGG + Intergenic
1180883741 22:19224943-19224965 CACACCAAAAAAGTGTTCTAGGG - Intronic
1183647907 22:39137273-39137295 AGCACCAAAATGATGTTCAAAGG - Intronic
1185230237 22:49676315-49676337 CTGACCAGCATGATGTTCTGTGG + Intergenic
949558518 3:5181351-5181373 CACATCAACGTGACGTTCCAGGG - Intergenic
951395795 3:22164755-22164777 CACAGCCACATGAGGTCCTATGG - Intronic
951894902 3:27601325-27601347 TGCACCAACATGCTGTTATATGG + Intergenic
952286538 3:31975025-31975047 CACACCAAAATGGTTTTCTTTGG - Intronic
954705985 3:52480753-52480775 CCCACAAACATGGTGTTCTGGGG - Intronic
958674654 3:97252448-97252470 CACACCCACACGATGCTCCAGGG + Intronic
960351049 3:116593422-116593444 AACACCAACATGATACTCAAAGG - Intronic
962086850 3:132200233-132200255 CACACCTACATAATGTGTTATGG + Intronic
965570689 3:170169046-170169068 CACACCAACATGACATTCAAAGG - Intronic
967938695 3:194749465-194749487 CATATCAAAATGATGGTCTATGG - Intergenic
968412928 4:404884-404906 TGCACCAACATGCTGTTATATGG - Intergenic
969326219 4:6445821-6445843 CACACCAACATGATGTTCTAAGG + Intronic
970889022 4:21021063-21021085 CACACCTACACGATGTGATATGG + Intronic
972492708 4:39603033-39603055 AGCACCAACATGATGATCAAAGG + Intronic
974668905 4:65002722-65002744 CATAGCAACATGTTTTTCTATGG - Intergenic
976780777 4:88756369-88756391 CACACAAAAATGATGTTCATTGG - Intronic
976966947 4:91054819-91054841 AGCACCAACATGCTGTTCAAAGG - Intronic
977791211 4:101105856-101105878 CACTCCAACATGATAGTCTTGGG + Intronic
978457896 4:108915253-108915275 CACACCAAGTTTATGTGCTAAGG + Intronic
978722725 4:111931352-111931374 CACACCTACATTATGTGCCAGGG + Intergenic
979955573 4:126949850-126949872 CACAGCAACTTGATGATCAAAGG - Intergenic
980554135 4:134381092-134381114 GCCACCAAAATGATGTCCTAGGG + Intergenic
982454824 4:155596483-155596505 CACACCAATAGGATGTTTAAGGG + Intergenic
982645287 4:158016460-158016482 CATAAAAACAAGATGTTCTACGG + Intergenic
983335962 4:166392794-166392816 TGAACCAACATGATGTTCTATGG - Intergenic
984320173 4:178185489-178185511 CTCACAAACATGCTGGTCTAGGG - Intergenic
984687213 4:182683382-182683404 AACACCAACATGATGCTCAAAGG + Intronic
986897776 5:12391579-12391601 AATTTCAACATGATGTTCTAAGG + Intergenic
989050851 5:37318531-37318553 CACATCAGCATGATGCTCAAAGG + Intronic
989612316 5:43306558-43306580 AGCACCAACATGATGCTCAAAGG + Intronic
991986678 5:72294873-72294895 AGCACCAACATGATGTTCAAAGG + Intronic
992559712 5:77938872-77938894 CACACTCACATGATTTTGTATGG - Intergenic
994368742 5:98945913-98945935 CACACAAGAATGATGTTCCATGG - Intergenic
994415381 5:99463421-99463443 CACACTTACATTGTGTTCTATGG + Intergenic
994739825 5:103603868-103603890 CACTCCAACTAGGTGTTCTATGG - Intergenic
994856688 5:105130651-105130673 TACACCTACATGAAGCTCTATGG + Intergenic
996412538 5:123174184-123174206 AACAGCAACATGATGCTCAAAGG - Intronic
998859910 5:146432439-146432461 CACTCCAACATTTTGTTCCAGGG - Intergenic
999149649 5:149418254-149418276 CACACCTACATGATGTGGTGGGG - Intergenic
999717386 5:154372353-154372375 CACAGCAACATGTAGTTCTTCGG - Intronic
1003899697 6:10642739-10642761 AGCACTAACATGATGTTCAAAGG + Intergenic
1004077788 6:12361076-12361098 CAGACCAACATCATGGCCTAAGG - Intergenic
1005578061 6:27208424-27208446 GAGACCAGTATGATGTTCTATGG - Intergenic
1005771606 6:29078702-29078724 CACACCAGCAGGATGATGTAAGG - Intergenic
1006595899 6:35192361-35192383 CACACTCTCATGAGGTTCTAAGG - Intergenic
1010051856 6:71514039-71514061 AAGACCAACATGATGATCAAAGG + Intergenic
1013061237 6:106636055-106636077 AGCACCAACATGATTTTCAAAGG + Intronic
1013800909 6:113941583-113941605 CACCTCATAATGATGTTCTAAGG + Intronic
1014075131 6:117226831-117226853 CAAACCAATATGATATTCTGTGG + Intergenic
1014787648 6:125636773-125636795 AGAACCAACATGATGTTCTGAGG + Intergenic
1017416348 6:154225180-154225202 AGCACCAACATGATGCTCAAAGG - Intronic
1018876926 6:167828726-167828748 CACACCAAGAAAATGTTTTATGG - Intronic
1019861513 7:3662793-3662815 AACATCAACATGATGCTCAAAGG + Intronic
1024538237 7:50456332-50456354 CACACCCTCATGATGATCAAGGG + Intronic
1025760999 7:64391482-64391504 TACAACAACATGCTTTTCTAAGG - Intergenic
1026065492 7:67068396-67068418 CACAACAACATGAGCTGCTATGG - Intronic
1031537993 7:122958814-122958836 TAGACCAGCATGATGTCCTATGG + Intergenic
1031830572 7:126620465-126620487 CACTCCAACATGGTTTTGTAGGG + Intronic
1035155368 7:156907906-156907928 CAAAGCAACATGAGGTTCTCAGG - Intergenic
1038585734 8:28787482-28787504 GGCACCAACATGATGCTCAAAGG + Intronic
1038739554 8:30205060-30205082 ACCACCAACATGATGCTCAAAGG - Intergenic
1039046135 8:33451257-33451279 AGCACCAACGTGATGTTCAAAGG - Intronic
1039113942 8:34071380-34071402 CACAACTTCATGTTGTTCTAGGG + Intergenic
1039230064 8:35435880-35435902 CACACCAAAATTATGTTGCAGGG + Intronic
1040985512 8:53290150-53290172 CACACCCAGGTGATGTTCCAAGG + Intergenic
1042954943 8:74239775-74239797 AGCACCAACATGATGCTCAAAGG - Intronic
1043185942 8:77149958-77149980 TACAGCCACATGATATTCTATGG - Intergenic
1043326402 8:79057228-79057250 CGGGCCAACATGATGTTCCATGG + Intergenic
1044250953 8:90003209-90003231 CACAAAAACATGATGTTCCCTGG - Intronic
1046701358 8:117404505-117404527 TAGACCAATATGATGTTCTGAGG - Intergenic
1048018197 8:130516113-130516135 AGCACCAACATGATGCTCAACGG + Intergenic
1050383024 9:5051067-5051089 AACGTCAACATGATGTTCAAAGG - Intronic
1055115691 9:72602731-72602753 CACACCAACAAAATGTTCTCAGG - Intronic
1059291186 9:113225501-113225523 CACAACAACCTCATGTTCTAGGG - Intronic
1059387432 9:113975570-113975592 AGCACCAACATGATGCTCAAAGG + Intronic
1193773055 X:85610425-85610447 AGCACCAACATGATGCTCAAAGG - Intergenic
1193797533 X:85894603-85894625 AGCACCGACATGATGCTCTAAGG + Intronic
1195290878 X:103431158-103431180 TACACCACCATGCTGTTATATGG - Intergenic
1196976798 X:121167168-121167190 GACACCAAAATGAAGTCCTAAGG - Intergenic
1202062745 Y:20904610-20904632 AACACCACCATGCTGTTATATGG - Intergenic