ID: 969326507

View in Genome Browser
Species Human (GRCh38)
Location 4:6447402-6447424
Sequence TCCGGAGCTCTTCCTCCGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 3, 3: 4, 4: 79}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969326507_969326516 2 Left 969326507 4:6447402-6447424 CCCTGCGGAGGAAGAGCTCCGGA 0: 1
1: 0
2: 3
3: 4
4: 79
Right 969326516 4:6447427-6447449 AATGTGAGGGAGGAAGGCAGGGG 0: 1
1: 1
2: 6
3: 108
4: 924
969326507_969326517 27 Left 969326507 4:6447402-6447424 CCCTGCGGAGGAAGAGCTCCGGA 0: 1
1: 0
2: 3
3: 4
4: 79
Right 969326517 4:6447452-6447474 CACTGACACCCAGAATGTTGTGG 0: 1
1: 0
2: 2
3: 17
4: 365
969326507_969326513 -4 Left 969326507 4:6447402-6447424 CCCTGCGGAGGAAGAGCTCCGGA 0: 1
1: 0
2: 3
3: 4
4: 79
Right 969326513 4:6447421-6447443 CGGATAAATGTGAGGGAGGAAGG No data
969326507_969326514 0 Left 969326507 4:6447402-6447424 CCCTGCGGAGGAAGAGCTCCGGA 0: 1
1: 0
2: 3
3: 4
4: 79
Right 969326514 4:6447425-6447447 TAAATGTGAGGGAGGAAGGCAGG 0: 1
1: 0
2: 2
3: 46
4: 563
969326507_969326511 -8 Left 969326507 4:6447402-6447424 CCCTGCGGAGGAAGAGCTCCGGA 0: 1
1: 0
2: 3
3: 4
4: 79
Right 969326511 4:6447417-6447439 GCTCCGGATAAATGTGAGGGAGG No data
969326507_969326515 1 Left 969326507 4:6447402-6447424 CCCTGCGGAGGAAGAGCTCCGGA 0: 1
1: 0
2: 3
3: 4
4: 79
Right 969326515 4:6447426-6447448 AAATGTGAGGGAGGAAGGCAGGG 0: 1
1: 0
2: 5
3: 115
4: 1214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969326507 Original CRISPR TCCGGAGCTCTTCCTCCGCA GGG (reversed) Intronic
901654147 1:10759740-10759762 GCCTGCGCTCTTCCTCCCCATGG - Intronic
901803171 1:11721088-11721110 TCTGGAGCACTTCCCCCCCAGGG + Exonic
905029312 1:34870812-34870834 CCCCGTGCTCTTCCTCTGCAGGG - Intronic
913543653 1:119845344-119845366 TCCAAAGCTCTTCCTCTACATGG + Intergenic
914689208 1:150010592-150010614 ACCGCAGCTGTTGCTCCGCACGG + Exonic
915680029 1:157572475-157572497 TCCTGAGATCTTCCTCAGTAAGG - Intergenic
916587710 1:166163152-166163174 TCAGGAGCCCTTCCTCCCCGAGG + Intronic
921049046 1:211498190-211498212 TGGGGAGCTCTTCTTCTGCAGGG - Intergenic
922209107 1:223474076-223474098 TCCTGAGCCCATCCTCCCCAGGG + Intergenic
922992777 1:229929565-229929587 TCCAGAGCTCTCCCTCCGTGTGG - Intergenic
923843126 1:237696319-237696341 ACTGGATCTCTTCCTCCTCATGG + Intronic
1066484481 10:35830171-35830193 TCCAGGGTTCTTCCTCTGCATGG + Intergenic
1070707909 10:78655018-78655040 TTCGAACCTCTTCCTCAGCAAGG - Intergenic
1073306815 10:102509342-102509364 TCCTGAGGTCTTCCTGAGCAGGG + Intronic
1073352627 10:102830860-102830882 CCAGGAGCTCTTCCTCATCATGG - Exonic
1076306239 10:129467330-129467352 TGCGGAGCTCTCCCTCGGGACGG + Intronic
1076749670 10:132536509-132536531 TCCGGAGTGCCTGCTCCGCATGG + Intergenic
1076891771 10:133288230-133288252 TCCGGAGCTCCTCCTCCGCGAGG + Exonic
1079080602 11:17411053-17411075 TCCTGAGCTGTTCCTCTGCCTGG + Intronic
1081716262 11:45252561-45252583 TGGGGAGCTCCTCCTCCGCCAGG + Exonic
1083665373 11:64271406-64271428 TCCCCAGCTCTTCCCCCGCCTGG - Intronic
1084483376 11:69434609-69434631 TCTGGAGCCCTCCCTCCCCAGGG - Intergenic
1084599086 11:70134185-70134207 TCATGAGCGCTTCCTCCACATGG + Intronic
1088645015 11:111911108-111911130 TCCTGAGCTGTTCATCCCCATGG - Intronic
1089839584 11:121403972-121403994 TCTGGAGCTCCTTCTCTGCATGG - Intergenic
1091993790 12:4977149-4977171 TCCCGTGCTGTTCCTCAGCATGG + Intergenic
1096078673 12:48819667-48819689 TCCTGAGCTCTTGCCCAGCATGG + Intronic
1096146869 12:49284436-49284458 TCCTAAGCTCTTCCTTCTCAGGG - Intergenic
1104399311 12:128462592-128462614 TTCGGAGCTCTTCCTCCTGAAGG + Intronic
1105699789 13:22927075-22927097 TCCGCAGCTCGTCCTCCGTGCGG - Intergenic
1113587065 13:111472871-111472893 TCAGGAGCTCATTCTCTGCAGGG - Intergenic
1118190277 14:63573790-63573812 TCAGGAGCTCTTCCTTCTAAAGG + Intergenic
1119756619 14:77124499-77124521 TTCTGAGCTCTTCCCCAGCAGGG - Intronic
1128110103 15:65070969-65070991 TCCAGTGCTCTTCCTCCTCTAGG + Intronic
1129515598 15:76155231-76155253 TGCCTAGCTCTTCCTCAGCAAGG + Intronic
1130699784 15:86166629-86166651 TCCTGAGCTCCTCCTCCTGAAGG - Intronic
1131021453 15:89102710-89102732 TCAGGAGCTCTTCCTCCGCTGGG - Intronic
1138124883 16:54430532-54430554 TCCGGAGCCCAGCCTCCTCAGGG - Intergenic
1140208870 16:72955269-72955291 ACTGGAGCTCTTCCTCCCAAAGG - Intronic
1142011255 16:87715459-87715481 TCCGCAGCTCATCCTGCCCAGGG + Intronic
1147218323 17:38913612-38913634 TCCTGAGCTCTTACTGCGCCAGG - Intronic
1148618013 17:49014519-49014541 TGTGGAGGTCTTCCTCCCCAGGG - Intronic
1151214518 17:72568552-72568574 TGCGTGGCTCTTCCTCCTCAGGG - Intergenic
1151570030 17:74921483-74921505 TCCGGAGCTCTCCCTCCCTTGGG + Intronic
1155431353 18:25762822-25762844 TCTGGAGCTCTTGTTCTGCATGG + Intergenic
1160737574 19:671003-671025 GCCTGAACTCCTCCTCCGCAGGG - Intergenic
1163173906 19:15551402-15551424 GCCGGAGCTCATACTGCGCACGG + Exonic
1163510825 19:17734020-17734042 GACGGAGCTCCTCCTCTGCAAGG - Intronic
1164424628 19:28130345-28130367 TCCGGATCTCTTTCTGCTCAAGG - Intergenic
1166497088 19:43311382-43311404 TCCGGAGTTCTTCCTCCGAAAGG + Intergenic
1167590760 19:50403120-50403142 GCCGGAGCCCTTCCTACGCCTGG + Exonic
931883248 2:66588852-66588874 AACGGAGCTATTCCTCAGCAGGG + Intergenic
939954297 2:148512916-148512938 TCTGGAGATCTTCCTCCTCTTGG - Exonic
947385016 2:229582386-229582408 TCCCGAGCTCTTCCTGGGGAGGG - Intronic
949031007 2:241797547-241797569 TCAGGAACTCTTCCTGGGCAGGG + Intronic
1179876745 21:44272565-44272587 TCGGGGGCTCTTCCTGCCCAGGG + Intergenic
1181548088 22:23616059-23616081 TCAAGAGCTCTTCCTGGGCATGG - Intronic
1182085270 22:27556916-27556938 TCCTGAGCTCTCCCTCCACCTGG + Intergenic
950155192 3:10716621-10716643 TCTGGAGCTCTTCCTCCTGTTGG + Intergenic
951325389 3:21296793-21296815 TCTGGAGATCTTCCTGGGCATGG - Intergenic
954617634 3:51977762-51977784 GCTGGAGCTCTTCCTCTGCTGGG + Intronic
966587172 3:181639653-181639675 TCTGGAACTCTTCCTCCACATGG + Intergenic
969326507 4:6447402-6447424 TCCGGAGCTCTTCCTCCGCAGGG - Intronic
969475179 4:7418298-7418320 TCCGCAGCACTTCCTCCCTATGG - Intronic
985230596 4:187811815-187811837 TCATGAGCACTTCCTCCTCAGGG - Intergenic
988941895 5:36155177-36155199 TCCGCATGTCTTCCTGCGCAGGG - Intronic
997516431 5:134493112-134493134 TCCAGTTCTCTTCCTCCTCATGG - Intergenic
999420419 5:151437043-151437065 TCCAGAGCTCTTCATCCGCCTGG + Intronic
999987963 5:157022712-157022734 TCCTGAGTCCTTCCTCCGCAGGG - Intergenic
1001632048 5:173182688-173182710 TCCGGAGCTCTTCCTGCAGTGGG + Intergenic
1003625208 6:7735111-7735133 TCCGGGGCTCTGCCTCCGAGGGG - Intronic
1004878089 6:19976507-19976529 TCCTGGGCTTTTCCTCCGAAAGG - Intergenic
1005947342 6:30604012-30604034 TCAGGAGCTCTTCCTGAACAAGG - Exonic
1006146137 6:31960765-31960787 GCCTGGGCTCTTCCTCCTCAAGG - Intronic
1013792425 6:113852937-113852959 TGCTGAACTCTTCCTCCTCATGG + Intergenic
1020144880 7:5634672-5634694 TCTGGAGCACTTCCCCCACAAGG + Intronic
1027180012 7:75932047-75932069 TCTGCAGCTCTTCCTCTTCAAGG - Intronic
1031051990 7:116953900-116953922 GGCGCAGCTCTTCCTCCGCGGGG - Exonic
1031382766 7:121108629-121108651 TCTAGAGCTCTTTCTCCTCAAGG + Intronic
1035571780 8:677104-677126 CCCGGAGCTCACCCTCTGCAGGG - Intronic
1056496437 9:87160059-87160081 TCAGGGGCTCTTCCTCCTCGTGG - Intergenic
1059416645 9:114166657-114166679 TCCTGAGCTCTGACTCAGCAGGG - Intronic
1061661652 9:132134184-132134206 ACCTGAGCTCTTCCTCTGAAAGG + Intergenic
1062147059 9:134995411-134995433 GCCGTAGCTCTTCATCAGCAGGG - Intergenic
1062574380 9:137199672-137199694 TCCGGGGCTCCTCCTCCTGAGGG - Exonic
1196519693 X:116658874-116658896 TAAGGAGCTTTTCCTCTGCATGG - Intergenic
1200236440 X:154469972-154469994 TCCAGAGAGCTTGCTCCGCACGG + Exonic