ID: 969326603

View in Genome Browser
Species Human (GRCh38)
Location 4:6447884-6447906
Sequence TACGATTCTCACTGTGGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 109}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969326603_969326607 9 Left 969326603 4:6447884-6447906 CCTTTCCCACAGTGAGAATCGTA 0: 1
1: 0
2: 2
3: 9
4: 109
Right 969326607 4:6447916-6447938 CTAATCACCCTAAATGTGATAGG 0: 1
1: 0
2: 0
3: 10
4: 151
969326603_969326610 19 Left 969326603 4:6447884-6447906 CCTTTCCCACAGTGAGAATCGTA 0: 1
1: 0
2: 2
3: 9
4: 109
Right 969326610 4:6447926-6447948 TAAATGTGATAGGAAGTTTCTGG 0: 1
1: 1
2: 4
3: 22
4: 228
969326603_969326611 20 Left 969326603 4:6447884-6447906 CCTTTCCCACAGTGAGAATCGTA 0: 1
1: 0
2: 2
3: 9
4: 109
Right 969326611 4:6447927-6447949 AAATGTGATAGGAAGTTTCTGGG 0: 1
1: 2
2: 3
3: 29
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969326603 Original CRISPR TACGATTCTCACTGTGGGAA AGG (reversed) Intronic
904917104 1:33977942-33977964 CACGATTCACAATGTGGGAAGGG + Intronic
905491452 1:38347019-38347041 TGTGATTGGCACTGTGGGAAGGG + Intergenic
907496861 1:54851226-54851248 TAGGATTCTCACCGTGGGGCTGG - Exonic
917454320 1:175172928-175172950 TACTATTCACATTGTGTGAAAGG + Intronic
918479464 1:184962396-184962418 CATGATTCTCAGTGTGGAAAAGG + Intronic
919933103 1:202234346-202234368 TGCTGATCTCACTGTGGGAATGG - Intronic
923352376 1:233121686-233121708 TAAGTTTCTCACTATTGGAATGG + Intronic
924790187 1:247239127-247239149 TAAAATTATCACTGTGAGAAGGG + Intergenic
1064761488 10:18626049-18626071 TAAGAGTCACACTTTGGGAAAGG + Intronic
1065132554 10:22636783-22636805 TACCAGAGTCACTGTGGGAAGGG - Intronic
1067909804 10:50334855-50334877 TGAGAGTCTCACTGGGGGAAGGG + Intronic
1068072736 10:52216291-52216313 TAAGCTTCTCACTCTGGGAGAGG + Intronic
1070279754 10:75039878-75039900 GCCGATTTTCACTGTTGGAAGGG - Intronic
1074228519 10:111511554-111511576 TAGGAGACTCACTGTGTGAAAGG + Intergenic
1079522039 11:21339700-21339722 TACAATTTTGATTGTGGGAATGG - Intronic
1086093532 11:83027759-83027781 TAGGATTTTCATTGGGGGAATGG - Intronic
1087790736 11:102404139-102404161 TACTGCTCTCACTGGGGGAAAGG - Intronic
1088170035 11:106986179-106986201 TACGATACTCACAGTGGGAATGG - Intronic
1091323818 11:134669519-134669541 TAAGATGCTAACTGTGGGTAGGG + Intergenic
1095139697 12:38646324-38646346 TATGAATTTGACTGTGGGAAAGG - Intergenic
1097045495 12:56184981-56185003 TTAGATTCTCACTGAGGGAAGGG + Intronic
1099945453 12:89238824-89238846 TAGGATTCTGACTGAAGGAAAGG - Intergenic
1106436646 13:29729338-29729360 TACTATTTTCTCTCTGGGAAGGG + Intergenic
1109058827 13:57586369-57586391 TACGATTCTTACTCAGGGATGGG - Intergenic
1112569510 13:100580985-100581007 CACGTTTCTCACTGTTGGAATGG + Intronic
1113801353 13:113088077-113088099 GCCGATTCTCACGGTGGGGAGGG + Intronic
1115772730 14:36683215-36683237 GCCGATTCTCCCTGTGGGAATGG + Intronic
1123702421 15:22925190-22925212 TAAAATCCTCACTGTGGGATGGG + Intronic
1128680642 15:69648985-69649007 CTTGATTCTCACTGTGGGTAAGG - Intergenic
1135955778 16:26955225-26955247 TGGGCTTCTCCCTGTGGGAATGG + Intergenic
1137035257 16:35564584-35564606 TACAATCCTCACTGGGGGCAGGG + Intergenic
1137035320 16:35565013-35565035 CACGATTCTCCCTGTGGGCAGGG + Intergenic
1137036201 16:35572096-35572118 TACAATGCCCTCTGTGGGAAGGG + Intergenic
1138430651 16:56966452-56966474 TCCGGCTCTCACTGTGAGAAGGG - Intronic
1140395934 16:74626909-74626931 TGAGGTTCTCACTGGGGGAAGGG - Intronic
1140432889 16:74919820-74919842 TTTGATTTTCACTGTGGGGAAGG - Intronic
1140995186 16:80252298-80252320 TGCAATTTTCACTGTGTGAAGGG + Intergenic
1142438079 16:90075939-90075961 TCCAATTCTGAGTGTGGGAAGGG + Intronic
1144232035 17:13217161-13217183 CAGGTTTCTTACTGTGGGAATGG + Intergenic
1147126967 17:38377614-38377636 TATGATTCTCACTTTTGGGAGGG - Intronic
1152792259 17:82287457-82287479 CAGGTTTCTCACTATGGGAATGG + Intergenic
1157111465 18:44824436-44824458 TTCTATTCTCTCTGTGGTAAGGG + Intronic
1157525784 18:48380363-48380385 CAGGTTTCTCACTGTTGGAATGG + Intronic
1158843045 18:61409229-61409251 GACGGTTCTCACTGTGGAGAAGG + Intronic
1163527339 19:17829894-17829916 TACTATTCTCATTTTGGAAAAGG + Intronic
1164079085 19:21847240-21847262 CACAATGCTCCCTGTGGGAAGGG + Intronic
1164082942 19:21876242-21876264 CACAATTTTCACTGTGGGCAGGG - Intergenic
1166878593 19:45913498-45913520 TATGCTTCTCGCTGGGGGAAAGG + Exonic
925758520 2:7159556-7159578 CAAGTTTCTCACTGTTGGAAAGG - Intergenic
925936395 2:8765960-8765982 TGAGACTCTCACGGTGGGAAGGG - Intronic
929577973 2:43064209-43064231 CAGGTTTCTCACTGTGGGAGTGG - Intergenic
929942931 2:46348526-46348548 GAGGGTTCTCACTGTGGGGAAGG - Intronic
937107836 2:119335006-119335028 CACGTTTCTCACTGTTGGTATGG + Intronic
938154913 2:128927273-128927295 CATGTTTCTCACTGTTGGAATGG - Intergenic
939625349 2:144470445-144470467 TACAAATATCACTGTGTGAAAGG - Intronic
942239702 2:173949511-173949533 TACTATTCTCACGGTTGGATAGG - Intronic
944954407 2:204791244-204791266 TATGATTTTCACTGTGGTCAAGG - Intronic
948643740 2:239391085-239391107 TACGAATCACACTGTGGCCAAGG + Intronic
1174485361 20:50857742-50857764 CATGAGTCTCACTGAGGGAATGG + Intronic
1176379871 21:6106928-6106950 TTCGAAGTTCACTGTGGGAAGGG - Intergenic
1179116172 21:38494474-38494496 TAAGATTCCCTCTGTGGGAGTGG - Intronic
1179743603 21:43431309-43431331 TTCGAAGTTCACTGTGGGAAGGG + Intergenic
1181527352 22:23497612-23497634 TACGAGTCGCAGTGTGGGACAGG - Intergenic
952733869 3:36668476-36668498 CAGGTTTCTCACTGTTGGAATGG + Intergenic
954840099 3:53503953-53503975 TTCCTTTCCCACTGTGGGAAGGG + Intronic
955792898 3:62606866-62606888 TTCGATTCTCACTGTGGGTTTGG - Intronic
957378270 3:79389439-79389461 CGAGATTCTCACTATGGGAAAGG + Intronic
959153608 3:102638941-102638963 TAGGATTCTGACTTTTGGAATGG + Intergenic
963081638 3:141400608-141400630 TATGATTCTCACTGTTTGGATGG + Intronic
965450188 3:168829066-168829088 AATGCATCTCACTGTGGGAAAGG - Intergenic
969195352 4:5558878-5558900 CACGATTTTCACTGTTGGAATGG + Intronic
969245134 4:5927039-5927061 TACGATGCCCACTGTGGAAGGGG + Intronic
969326603 4:6447884-6447906 TACGATTCTCACTGTGGGAAAGG - Intronic
971181953 4:24337097-24337119 AACGATTCTTAGTGTGGTAAGGG - Intergenic
974467804 4:62279415-62279437 TACTATTCTCTCTCGGGGAATGG - Intergenic
979491706 4:121335686-121335708 AACTATTCACACTGAGGGAAGGG + Intronic
979823638 4:125205359-125205381 GAAGATTCACACAGTGGGAACGG + Intergenic
980274406 4:130630899-130630921 TATGTTTCTCACTGTTGGAGTGG + Intergenic
980313444 4:131164892-131164914 TAAGATTATCACTCTGGCAAGGG + Intergenic
981689035 4:147485945-147485967 TACTATTTTCATCGTGGGAATGG + Exonic
993850567 5:93002492-93002514 TATCATTTTCACTTTGGGAAGGG - Intergenic
994415174 5:99460561-99460583 TATGTTTCTCACTGTCGGAGTGG + Intergenic
997339432 5:133131149-133131171 TAAGAATCTCATTGTGGGACAGG + Intergenic
1000109673 5:158095917-158095939 AATTATTCACACTGTGGGAAAGG - Intergenic
1000902242 5:166925296-166925318 CATGATTCTCACTGTTGGAGGGG - Intergenic
1001882973 5:175261017-175261039 TAGGATTTTCAGTGTGGGAGTGG - Intergenic
1003347897 6:5287608-5287630 TAAGATTCTTTCTGTGGGACGGG - Intronic
1012667313 6:101989348-101989370 TAAGATTCTTACTGTACGAAAGG + Intronic
1014220736 6:118796288-118796310 TACAATCCTCACTGGGGGATTGG + Intergenic
1015120561 6:129696926-129696948 TACACTTCTCAATGAGGGAATGG - Intronic
1023366879 7:39473605-39473627 TACAATGCTCACTGTGTGCATGG - Intronic
1023485656 7:40683543-40683565 GAAGATTCCCACAGTGGGAAAGG - Intronic
1024111402 7:46150506-46150528 CAGGTTTCTCACTGTGGGAGAGG - Intergenic
1024533789 7:50413446-50413468 TACGCATGTCACTGTAGGAAGGG + Intergenic
1025722049 7:64025900-64025922 TACAATTCTTACTTTGGGCAGGG - Intergenic
1025782730 7:64616110-64616132 TACAATGCTCCCTGTGGGCAGGG - Intergenic
1028560109 7:92165931-92165953 TACCATTCTCACTGTGAACATGG + Intronic
1032646623 7:133831951-133831973 CAGGTTTCTCACTGAGGGAAAGG - Intronic
1033813248 7:145042787-145042809 TACGATTCACAATGTGGTAGAGG - Intergenic
1034886678 7:154803742-154803764 TGCCATTCTCTCTGTGGGAAGGG - Intronic
1038551879 8:28477397-28477419 TAACATTCTAACTGTGTGAAAGG - Intronic
1039366510 8:36933607-36933629 TAAGATCCTCACAGTGGGAATGG + Intronic
1039656170 8:39410461-39410483 TCTGATTCTGACTGTGGGGATGG + Intergenic
1040381915 8:46881383-46881405 CACAATTCTTACTGAGGGAAGGG + Intergenic
1040733361 8:50476495-50476517 TAAGTTTCTCACTGTTGGAGTGG + Intronic
1051082283 9:13307522-13307544 TATGATTCTCATTGTGTGCAAGG - Intergenic
1053870197 9:42483282-42483304 TACCTCTCTCACTGTGGGGAGGG + Intergenic
1054086092 9:60745867-60745889 TACCTCTCTCACTGTGGGGAGGG - Intergenic
1055848676 9:80598289-80598311 TATGCTTCTCTCTGTTGGAAAGG + Intergenic
1058803547 9:108567853-108567875 TCTGATTCTCACTGCAGGAAGGG + Intergenic
1059575915 9:115488299-115488321 GACGATTCACATTCTGGGAAAGG + Intergenic
1203423416 Un_GL000195v1:15957-15979 TACAATGCTCCCTGTGGGCAGGG - Intergenic
1190897906 X:54639484-54639506 TTCGATTCTCACTCTTGGAGCGG + Intergenic
1193134881 X:77959628-77959650 TGTGATTCTCACTGAGAGAAGGG - Intronic
1195597772 X:106712717-106712739 TATGATACTAACTGTGGCAAAGG - Intronic
1197879360 X:131149080-131149102 CAGGTTTCTCACTGTGGGAGTGG - Intergenic
1197958026 X:131973986-131974008 TATGACTCCCACTCTGGGAAAGG - Intergenic
1198385998 X:136130240-136130262 TGGGATTCTCACTGTGGGAAAGG + Intergenic
1198881836 X:141290201-141290223 TACAATTCTCAATCTGAGAATGG + Intergenic
1200902300 Y:8444943-8444965 AACAATTCTGATTGTGGGAATGG + Intergenic
1202080685 Y:21081056-21081078 CACAATTCCCACTGTGGAAAGGG - Intergenic