ID: 969327658

View in Genome Browser
Species Human (GRCh38)
Location 4:6453140-6453162
Sequence TCATCTCCATCCACCCTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 138}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969327655_969327658 3 Left 969327655 4:6453114-6453136 CCTGAGCATCGGATACACCTAAC No data
Right 969327658 4:6453140-6453162 TCATCTCCATCCACCCTTGAAGG 0: 1
1: 0
2: 1
3: 17
4: 138
969327654_969327658 8 Left 969327654 4:6453109-6453131 CCGTTCCTGAGCATCGGATACAC 0: 1
1: 0
2: 0
3: 1
4: 75
Right 969327658 4:6453140-6453162 TCATCTCCATCCACCCTTGAAGG 0: 1
1: 0
2: 1
3: 17
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969327658 Original CRISPR TCATCTCCATCCACCCTTGA AGG Intronic