ID: 969328476

View in Genome Browser
Species Human (GRCh38)
Location 4:6458422-6458444
Sequence CTCACATGACAGAAGGGCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1107
Summary {0: 1, 1: 7, 2: 30, 3: 207, 4: 862}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969328468_969328476 27 Left 969328468 4:6458372-6458394 CCACTGAGGTCCAACTTCCTGAC 0: 1
1: 0
2: 2
3: 20
4: 174
Right 969328476 4:6458422-6458444 CTCACATGACAGAAGGGCAAGGG 0: 1
1: 7
2: 30
3: 207
4: 862
969328469_969328476 17 Left 969328469 4:6458382-6458404 CCAACTTCCTGACTCTCAAACAG 0: 1
1: 0
2: 0
3: 19
4: 319
Right 969328476 4:6458422-6458444 CTCACATGACAGAAGGGCAAGGG 0: 1
1: 7
2: 30
3: 207
4: 862
969328470_969328476 10 Left 969328470 4:6458389-6458411 CCTGACTCTCAAACAGTGCCTTC 0: 1
1: 0
2: 1
3: 16
4: 195
Right 969328476 4:6458422-6458444 CTCACATGACAGAAGGGCAAGGG 0: 1
1: 7
2: 30
3: 207
4: 862
969328471_969328476 -8 Left 969328471 4:6458407-6458429 CCTTCTCGCTGCGTCCTCACATG 0: 3
1: 49
2: 900
3: 2115
4: 3360
Right 969328476 4:6458422-6458444 CTCACATGACAGAAGGGCAAGGG 0: 1
1: 7
2: 30
3: 207
4: 862

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969328476 Original CRISPR CTCACATGACAGAAGGGCAA GGG Intronic
900010647 1:104012-104034 CACTCATGGCAGAAGGGGAAGGG - Intergenic
900026751 1:280578-280600 CACTCATGACAGAAGGGGAAGGG - Intergenic
900036546 1:414481-414503 CACTCATGGCAGAAGGGGAAGGG - Intergenic
900058175 1:650235-650257 CACTCATGGCAGAAGGGGAAGGG - Intergenic
900874176 1:5329803-5329825 CTCACATGGTGGAAGGGGAAGGG + Intergenic
901100815 1:6717189-6717211 CTCATATGGCAGAAGGGCTGAGG + Intergenic
902976238 1:20090570-20090592 TTCACATGGCAGAAGGGCCCGGG - Exonic
903174764 1:21574261-21574283 TTCACATAACAGAAGTGCACAGG - Intronic
903820855 1:26101452-26101474 CTCACAAGGCAGAAGTGGAAGGG - Intergenic
904228815 1:29049096-29049118 CACACATAACAGAAGAGGAAGGG - Intronic
904751689 1:32744566-32744588 CTCACTTTACAGATGGGAAATGG + Intronic
904862000 1:33545526-33545548 TTCACATGGCACAAGGGAAAGGG + Intronic
905861455 1:41354760-41354782 CTCACATGACAGAAGGGGCAGGG + Intergenic
906273713 1:44500937-44500959 CTGACAGGACAGAAGAGCCAAGG - Intronic
906672982 1:47671516-47671538 CTCACATGGCAGAACGCAAAAGG + Intergenic
906887172 1:49661530-49661552 CTTACATGGCAGAAGGCAAAGGG - Intronic
907680676 1:56560547-56560569 CTCATATGATGGAAGGGCAGAGG + Intronic
907791774 1:57673180-57673202 CTCACATGACAGAAGGGGCATGG + Intronic
907877259 1:58503653-58503675 CTCACATGGTAGAAGGGGCAAGG - Intronic
907928346 1:58975577-58975599 CTCACATGATGGAAGGGATAAGG + Intergenic
908112466 1:60910847-60910869 CTTACATGGCAGAAGGCGAAGGG - Intronic
908158936 1:61386954-61386976 CTCACATGGCAGAAGGGGTGGGG + Intronic
908499472 1:64728903-64728925 CTCACATGGCAGAAGGTGGAAGG - Intergenic
908554636 1:65245559-65245581 CTCACATGGTGGAAGGGGAAAGG + Intergenic
908905857 1:69007939-69007961 CTCACATGGTGGAAGGGGAAAGG + Intergenic
909067429 1:70952240-70952262 CTCACATAACAGATGAGAAATGG + Intronic
909107694 1:71433115-71433137 CTCACATGGCAGAAGGCAGAAGG - Intronic
909239392 1:73192847-73192869 CTCACATGGAAGAAGGGTTAAGG + Intergenic
909364896 1:74808124-74808146 CACTCATGGCAGAAGGGGAAAGG + Intergenic
909395195 1:75163900-75163922 TTCACATGGCTGAAGGCCAAAGG - Intergenic
909658312 1:78055175-78055197 CTCATGTAACAGAAGGGGAAAGG + Intronic
909878834 1:80847472-80847494 CTCACATGGCAGAAGGCAGAAGG + Intergenic
910052575 1:82992913-82992935 CAGTCATGACAGAAAGGCAAAGG - Intergenic
910191084 1:84596520-84596542 CTCACATGGCAGAAGGCTGAAGG + Intergenic
910291000 1:85600332-85600354 CAATCATGGCAGAAGGGCAAAGG - Intergenic
910544645 1:88400117-88400139 CTCACATGGTAGAAGGGGCAAGG + Intergenic
911056049 1:93709465-93709487 CCCACTTCACTGAAGGGCAAGGG - Intronic
911111651 1:94194593-94194615 CTCACATGATAGAAGGGGAAGGG + Intronic
911156135 1:94638604-94638626 CTCACATGATGGAAGGGGTAAGG - Intergenic
911687902 1:100798083-100798105 ATCACATGGCAAATGGGCAAAGG - Intergenic
912164895 1:107031275-107031297 CTCGCATGGCAGAAGGGGCAAGG - Intergenic
912367328 1:109145179-109145201 CTCACATGGCAGAAGGTAGAAGG - Intronic
912397612 1:109359208-109359230 CGTACATGACAGAAGGGGCAAGG + Intronic
912509459 1:110178721-110178743 CTCACATGGCAGAAGTTCAAGGG + Intronic
912553420 1:110499091-110499113 CTGCCATGACAGAAGGCCACAGG - Intergenic
913050288 1:115111657-115111679 CTCACATGGTAGAAGGGGAAGGG - Intergenic
913066002 1:115255577-115255599 CTCACATGGCAGAAGGGGTGAGG - Intergenic
913144083 1:115972275-115972297 CTCACATGGCAGAAGGTGGAAGG + Intergenic
913173105 1:116249956-116249978 CTCACATGGCGGAAGGGCTGAGG - Intergenic
914354652 1:146873783-146873805 ATCACATGATGAAAGGGCAATGG + Intergenic
914395309 1:147261334-147261356 CTCACATGACAGAAGGTGGACGG + Intronic
915877800 1:159630847-159630869 CAATCATGGCAGAAGGGCAAAGG + Intergenic
915988950 1:160493802-160493824 CAATCATGACGGAAGGGCAAGGG + Intronic
916086136 1:161270909-161270931 CTCACATGGTAGAAGGGGAGAGG - Intronic
916165222 1:161960838-161960860 TTCACATTACAGAATGGGAAGGG - Exonic
916264487 1:162876968-162876990 CTCACATGACAGAAGGGAGGAGG - Intergenic
916882595 1:169034361-169034383 CTCACATGGGAGAAGGGGAAAGG + Intergenic
916997904 1:170321311-170321333 CCCACATGGCCGAAGGGAAATGG - Intergenic
917005032 1:170405620-170405642 CTCACATGACAGAAGGGGTAAGG - Intergenic
917050620 1:170918236-170918258 CTCACATGGCAGAAGGTAGAAGG - Intergenic
917246990 1:173014162-173014184 CTCACATGGCAGAAGGCAGAAGG - Intergenic
917851750 1:179070458-179070480 GTCACATGGCAGAAGGCAAAAGG + Intronic
918740619 1:188126706-188126728 CTCACATGGCAGAAGGTAGAGGG + Intergenic
918931998 1:190865702-190865724 GTTACATGGCAGAAGGGGAAAGG + Intergenic
918961138 1:191279689-191279711 CTCACATGGCAGAAGGTGGAAGG + Intergenic
919588490 1:199469469-199469491 CTCACATGACAGAGGGCAAATGG + Intergenic
921126475 1:212182435-212182457 CTTACATGGCAGAGGGCCAAGGG + Intergenic
921686464 1:218094749-218094771 CTCACATGGTAGAAGGGGCAAGG - Intergenic
921718983 1:218449785-218449807 CTCACATGGTAGCAGGGCCAAGG + Intergenic
921980595 1:221253588-221253610 CACTCATGGCAGAAGGGAAAAGG + Intergenic
921990321 1:221359211-221359233 CTCACATAATAGAAGGTTAAAGG - Intergenic
922259087 1:223920019-223920041 CACTCATGGCAGAAGGGGAAGGG - Intergenic
922514184 1:226194695-226194717 CTCACATGGTAGAAGGGACAAGG + Intergenic
922727537 1:227929840-227929862 CTCACATGGCAGAAGAGGCAAGG - Intronic
923323563 1:232860117-232860139 AACACAAGAGAGAAGGGCAAGGG + Intergenic
923492016 1:234492488-234492510 CTCACACAACAGAAGGGGCAAGG + Intergenic
923676857 1:236087876-236087898 CTCACATGGCAGAAGGTGGAAGG + Intergenic
923839848 1:237657995-237658017 CTCCCATGACAAATGGTCAATGG + Exonic
924072655 1:240297919-240297941 CTCACATGGTAGAAGGGACAAGG + Intronic
924187591 1:241511220-241511242 CTCACATGGTAGAAGGGACAAGG - Intronic
924272681 1:242350079-242350101 CCCACATGATAGAAGGGGCAAGG - Intronic
924340277 1:243022769-243022791 CACTCATGGCAGAAGGGGAAGGG - Intergenic
924433341 1:244016508-244016530 CTCACATGGCAGAAAGAAAAGGG - Intergenic
924494870 1:244577602-244577624 CTCACATGGCAGAAGGGGCAAGG + Intronic
924672512 1:246143850-246143872 ATCACCTCACAGAAGGGCACAGG + Intronic
1063276834 10:4578447-4578469 CTCACATGGCAGAAGGGGTGAGG + Intergenic
1063919498 10:10918142-10918164 CTCAAATGACAGAAAGATAAAGG + Intergenic
1064279288 10:13936556-13936578 CTCACATGGCAGAAGGGGTGAGG - Intronic
1064573977 10:16725617-16725639 CTCCCATGACAGAAGGCAGAAGG - Intronic
1065460344 10:25956077-25956099 CTCACATGGCAGAAGGCAGAAGG + Intronic
1065650189 10:27880658-27880680 CTCACATGGCAGAATGGGGAAGG - Intronic
1065690123 10:28324212-28324234 CTCACGTGGCAGAGGGGCCAGGG - Intronic
1065731397 10:28712813-28712835 CTCACAGGGCAGAAGAGGAAAGG - Intergenic
1065972432 10:30816194-30816216 CACTCATGGCAGAAGGGGAAGGG + Intergenic
1066054576 10:31668500-31668522 CTCACATGGAAGAAGGGACAGGG + Intergenic
1066444342 10:35468193-35468215 CTCACATGGCAAAAGGGGCAAGG + Intronic
1066458275 10:35590741-35590763 CTCACATGGCAGAAGAGGCAGGG + Intergenic
1066630026 10:37450145-37450167 CTCACATGGCAGAAGGCTGAAGG + Intergenic
1066650449 10:37650331-37650353 CACTCATGGCAGAAGGGGAAGGG + Intergenic
1066680105 10:37929944-37929966 CTCACATGATAGAAGGGGCAAGG + Intergenic
1066694044 10:38062121-38062143 CTCACATGTCAGAAAGGGGAGGG - Intronic
1066712030 10:38246548-38246570 CCCACATGATAGAAGGGGCAAGG + Intergenic
1066736222 10:38482837-38482859 CACTCATGGCAGAAGGGGAAGGG + Intergenic
1066998775 10:42587030-42587052 CTCACATGTCAGAAAGGAGAGGG + Intronic
1067033455 10:42896467-42896489 CACTCATGGCAGAAGGGCAAGGG + Intergenic
1067537537 10:47124897-47124919 CTCACATGACAGAAAAGAAGAGG - Intergenic
1068293367 10:55033958-55033980 CTCACATGATAGAAGGTGAAGGG - Intronic
1068296866 10:55081633-55081655 CTCACATAGCGAAAGGGCAAGGG - Intronic
1068803377 10:61167029-61167051 CTTACATGGAAGAAGTGCAAAGG + Intergenic
1068804082 10:61174972-61174994 CTCAGATGACAGAAGGCAGAAGG + Intergenic
1068902673 10:62287494-62287516 CTCACATGGCAGAAGGGGCAAGG + Intergenic
1069279369 10:66635479-66635501 CTCACATGGCAGAAAGAGAAGGG + Intronic
1069323691 10:67204864-67204886 GCCACATGACAGATGGGCAGGGG + Intronic
1069783284 10:70970257-70970279 CACTCATGACAGAAGGCGAAGGG - Intergenic
1070311891 10:75279853-75279875 CTCACATGGCAGAAGGCACAAGG + Intergenic
1070487108 10:76941907-76941929 CTCACATGACAGAAGGGACGAGG + Intronic
1071177238 10:82940723-82940745 CTCACATGGTAGAAGGGGCAGGG + Intronic
1071185407 10:83038138-83038160 CTCAAATGAGAAAAGGGGAAAGG - Intergenic
1072313611 10:94180809-94180831 CTCACATGGCAGAAGGTGAAAGG - Intronic
1072407835 10:95171039-95171061 CTCACATTCCAGCAGGGCAGAGG + Intergenic
1072597890 10:96892525-96892547 CTCACATGACAAAAGGATGAGGG + Intronic
1073040476 10:100600994-100601016 CTCACATGGCAGAAGGGACAGGG + Intergenic
1073430019 10:103479852-103479874 CTCACACGGAAGAAGGGCAGGGG - Intergenic
1073470649 10:103720186-103720208 CTCACATGATGGAAGGGGCAAGG + Intronic
1073604052 10:104875914-104875936 CTCACATGGCAAAAGGAAAATGG + Intronic
1073794708 10:106975033-106975055 CTTACAACACAGAAGGCCAAAGG + Intronic
1074244982 10:111680710-111680732 CTCACATGGCAGAAGGGACGGGG - Intergenic
1074252264 10:111762839-111762861 CTCACATGACAGAAGACAGAAGG - Intergenic
1074489561 10:113927027-113927049 CTCACATGGCAGAAGGGGCTAGG - Intergenic
1074644783 10:115435395-115435417 ATCCCATGGCAGAAGGCCAAAGG - Intronic
1074836470 10:117300782-117300804 CTCACATGGCAGAAGGGATAAGG - Intronic
1075003534 10:118814846-118814868 CTCACATGGCAGAAGGGGTGAGG + Intergenic
1075079475 10:119373512-119373534 CAATCATGACAGAAGAGCAAGGG - Intronic
1075350960 10:121724988-121725010 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1075396756 10:122133229-122133251 GTGACATGGCAGAAGGGCAGGGG - Intronic
1075607808 10:123827378-123827400 CACACATGACAGTATGGTAAAGG - Intronic
1075872390 10:125780244-125780266 CTCATATGGCAGACGGGCAAAGG - Intergenic
1076502225 10:130946308-130946330 CTCACTAGAATGAAGGGCAAAGG - Intergenic
1076869961 10:133188395-133188417 CACACCTGATAGAAGGGCTAGGG - Intronic
1077396859 11:2328529-2328551 CTCACATGGCAGAAAGGGAAAGG + Intergenic
1077728400 11:4701341-4701363 ATCACATGGCAAAAGGGCAAGGG - Intergenic
1078087120 11:8240632-8240654 CTCACGTGGCAGAAGGGGCAAGG + Intronic
1078424115 11:11235440-11235462 TTCACATGACAGAAGGGGAAGGG - Intergenic
1078991387 11:16649908-16649930 CTCACATAACCGAAAGGTAAAGG + Intronic
1079097509 11:17520443-17520465 CTCACATCAGAGAAGGGCTCTGG - Intronic
1079649377 11:22907993-22908015 ATCCCATGGCAGAAGGACAAGGG - Intergenic
1079651385 11:22934317-22934339 CTCACATGGCAGAAGGCAGAAGG - Intergenic
1079707484 11:23638623-23638645 CAATCATGGCAGAAGGGCAAAGG + Intergenic
1080205334 11:29722986-29723008 TCCACATGACATAAGAGCAAAGG - Intergenic
1080282219 11:30570253-30570275 CTCATATGAAAGAAGAACAAGGG + Intronic
1080368468 11:31607460-31607482 CTCACATGGCAGAATGTGAAAGG + Intronic
1080397288 11:31901949-31901971 CTCACATGGCAGAAGGGGCAAGG + Intronic
1080695031 11:34596054-34596076 CTCACATGGCAGAAGGGACAAGG - Intergenic
1080762843 11:35269140-35269162 CTCACATGGTAGAAGGGCCAAGG - Intronic
1080990669 11:37530436-37530458 CAGTCATGGCAGAAGGGCAAAGG + Intergenic
1081285270 11:41261173-41261195 CTCACCTGGCAGAAGGGTAAGGG - Intronic
1082217825 11:49596162-49596184 CTCACATGGCAGAAGATCCAAGG + Intergenic
1082254581 11:50019460-50019482 CTCACAGCACAGAAGGACAGTGG + Intergenic
1082826977 11:57587145-57587167 CCTTCATGGCAGAAGGGCAAAGG - Intergenic
1082827154 11:57588278-57588300 CAGTCATGGCAGAAGGGCAAAGG - Intergenic
1082998171 11:59268984-59269006 CTCACATGGCAGAAGAGGCAAGG + Intergenic
1083140884 11:60720554-60720576 CTCACATGGCAGAGGGGCCAAGG + Intergenic
1084081102 11:66825521-66825543 CTCACATGGCAGAAGGGGCAAGG - Intronic
1084536777 11:69762053-69762075 CCCAAATGACAAAGGGGCAAGGG - Intergenic
1084697333 11:70763490-70763512 CTCAGAGCACAGAAGGGCATGGG - Intronic
1085068369 11:73518951-73518973 CACTCATGGCAGAAGGGGAAGGG - Intronic
1085235903 11:75015223-75015245 CTCACATGACTGAAGGGCAAAGG - Intronic
1085846454 11:80071388-80071410 TTCACATGGCAGAAGGGGCAAGG - Intergenic
1085925804 11:81019138-81019160 ATTACATGGCAGAAGGGCAGAGG - Intergenic
1086053197 11:82618310-82618332 TTTCCATGACAGAGGGGCAATGG - Intergenic
1086214013 11:84355452-84355474 TTCACTTGGCAGAAGGGGAAAGG - Intronic
1086631745 11:89027987-89028009 CTCACATGGCAGAAGATCCAAGG - Intronic
1086737795 11:90328588-90328610 CTCACTTGACAGAAGAGTGAGGG - Intergenic
1086900449 11:92361509-92361531 CTCATATGGCAGAAGAGCAGGGG - Intronic
1087238200 11:95744689-95744711 CTCACATGGCAGAAGGTAGAAGG - Intergenic
1087264545 11:96045949-96045971 CTAACAAAACAGAAGGCCAAGGG - Intronic
1087329398 11:96760965-96760987 ATCCCAAGGCAGAAGGGCAAAGG - Intergenic
1087512458 11:99115002-99115024 CTCACATGGAAGAAGGGGGAAGG - Intronic
1087673662 11:101134248-101134270 CTCACATGGTAGAAGGGGCAGGG - Intergenic
1087687717 11:101284245-101284267 CTCACATGGCAGAAAGGACAAGG - Intergenic
1088297603 11:108317504-108317526 CTTACCTGACGGAAGTGCAATGG - Exonic
1088338552 11:108736703-108736725 CTCACATGGCAGAAGGCAGAGGG - Intronic
1088416450 11:109594600-109594622 CTCACATGACAGAAGGCAGAAGG + Intergenic
1088483270 11:110316486-110316508 CTCACATGACAGAAGATGGAAGG + Intergenic
1088531214 11:110811805-110811827 CAATCATGACAGAAGAGCAAGGG + Intergenic
1088587097 11:111368920-111368942 CTCCGATGACAGATGGGCCATGG - Intronic
1089238748 11:117055847-117055869 CTCACATGGCAGAAGGCAGAAGG - Intronic
1089420536 11:118330094-118330116 CTCACATGGTAGAAGGGGCAAGG + Intergenic
1089639541 11:119838715-119838737 CTCACATGCTGGAAGGGCCAAGG + Intergenic
1089827027 11:121287324-121287346 CTCACATGGCAGCAGGGCAAGGG + Intergenic
1090374476 11:126279287-126279309 CTCACATGGCAGAAGGGGTAAGG + Intergenic
1090729323 11:129556015-129556037 CTCCCATGGCAGAAGGTGAAAGG - Intergenic
1090846049 11:130530874-130530896 GTCGTATGGCAGAAGGGCAAGGG + Intergenic
1091195740 11:133729355-133729377 CTCACATGGCAGAAGGGACAAGG + Intergenic
1091610886 12:2007766-2007788 CTAAGAAGACAGATGGGCAAAGG - Intronic
1091628192 12:2138691-2138713 CACTCATGGCAGAAGGGGAAGGG - Intronic
1091682518 12:2537193-2537215 CTCCCATGACAGATAGGAAAAGG + Intronic
1092675818 12:10917898-10917920 TTGACATGGCAGAAGGTCAAAGG - Intronic
1092954901 12:13540906-13540928 GTCACATGGCAGAGGGGAAATGG - Exonic
1093214125 12:16343259-16343281 CTCACATGACGGAGGGGGCAGGG - Intergenic
1093269491 12:17041769-17041791 CTCACATGGCAGAAGGTAGAAGG - Intergenic
1093315367 12:17643610-17643632 CTCATATGACTGTAGGGTAAGGG - Intergenic
1093510638 12:19923063-19923085 CACTCATGGCAGAAGGCCAAGGG - Intergenic
1093769596 12:23003297-23003319 CTCACCTGGTAGAAGGGAAAAGG + Intergenic
1095039465 12:37425390-37425412 CTCACATGGCAGAAGGTGAAAGG + Intergenic
1096174187 12:49501319-49501341 GGCAGATGGCAGAAGGGCAAGGG + Intronic
1096498029 12:52050029-52050051 CTTACATGGGAGAAGGGGAATGG + Intronic
1097404592 12:59174943-59174965 CTCACATGACAGAAGAGGTGAGG + Intergenic
1097533602 12:60837397-60837419 CTCACATGGTGGAAGGGCAAAGG - Intergenic
1097574136 12:61370154-61370176 CTCACATGGCAGAAGGTGGATGG - Intergenic
1097940177 12:65295595-65295617 CTCAGATAACAGAAGGGCTCAGG - Intronic
1098081232 12:66787626-66787648 CTTACATGACAGAAGGAACAAGG - Intronic
1098235521 12:68414540-68414562 CTCACATGGTGGAAGGGGAAAGG - Intergenic
1098535778 12:71592176-71592198 CTCACATGGTAGAAGGGCTGAGG - Intergenic
1098972293 12:76869193-76869215 CTTACATGGCAGAAGAGCAGAGG + Intronic
1099024258 12:77445723-77445745 CTCACATGACAACAGTGCATGGG - Intergenic
1099568254 12:84279815-84279837 CACTCATGACAGAAGGTGAAGGG + Intergenic
1099621663 12:85009121-85009143 CTCCCATGGCAGAAGGTGAAAGG + Intergenic
1099792243 12:87350438-87350460 CTCACATGGCAAAAGTACAAAGG + Intergenic
1100752192 12:97710590-97710612 CTCACATGGCAGAAGGTGAAAGG + Intergenic
1100806303 12:98287498-98287520 CCCACATGGCAGAAGGGGCAAGG - Intergenic
1101469265 12:104981375-104981397 CTCACATGGTAGAAGGGACAAGG - Intergenic
1101540491 12:105660550-105660572 CTCACATGGCAGAAGAGCAAGGG + Intergenic
1101594235 12:106149611-106149633 ATCGTGTGACAGAAGGGCAATGG + Intergenic
1102414321 12:112747304-112747326 CTCACATGGTGGAAGGGCAAGGG - Intronic
1102879494 12:116473512-116473534 CTCACATGGAAGAAGGTGAAAGG - Intergenic
1104110177 12:125697373-125697395 CAATCATGGCAGAAGGGCAAAGG - Intergenic
1104127065 12:125857963-125857985 CAAACATGACAGAAGGCAAAAGG - Intergenic
1104736940 12:131140808-131140830 CTCGCCTGACAGAAGAGCAAAGG - Exonic
1104937983 12:132376719-132376741 CCCACATGACACCAGAGCAAAGG + Intergenic
1106130442 13:26935022-26935044 CTCAGAAGACAGAAAGACAAGGG + Intergenic
1106262528 13:28079873-28079895 CACTCATGACAGAAGGGGAAAGG + Intronic
1106610001 13:31269783-31269805 CTCACATGGCAGAAAGGGCAAGG - Intronic
1106648646 13:31665129-31665151 CTTACACGACAGAAGGCAAAGGG + Intergenic
1107390022 13:39954045-39954067 CTGCAATGACAGAAAGGCAAGGG - Intergenic
1107414044 13:40184628-40184650 CTCACATGGCAGAAGGGATGAGG + Intergenic
1107557666 13:41531898-41531920 CTCACATGGCAGAAGAGAAAAGG + Intergenic
1108033792 13:46265525-46265547 CTCACATGACAGAAGGGGTGAGG + Intronic
1108091832 13:46857428-46857450 CTCACAGGATGGAAGGGCCAAGG + Intronic
1108111555 13:47079381-47079403 CTCACATAATGGAAGGGGAAAGG - Intergenic
1108118525 13:47158074-47158096 TTCACATGATGGAAGGGAAAAGG - Intergenic
1108797809 13:54053283-54053305 TTCACTTGACAGAAGGGCTGTGG + Intergenic
1108910315 13:55541984-55542006 CTCACATGACAGAAGGTGCCAGG + Intergenic
1109119289 13:58433742-58433764 CTCACATGGCAGAAGGAGGAAGG + Intergenic
1109330008 13:60917917-60917939 CTCACATGGCAGAAGGCAGAGGG + Intergenic
1109330231 13:60919919-60919941 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1109413503 13:62005652-62005674 CTCACATGGCAGAAGGCAAAAGG - Intergenic
1109532034 13:63662569-63662591 TTCACATGGCAGAAGGGGAAAGG + Intergenic
1109551217 13:63902884-63902906 CAAACATGACAGAAGGTGAAGGG + Intergenic
1109901950 13:68785055-68785077 CACTCATGGCAGAAGGGAAAAGG - Intergenic
1109922617 13:69088652-69088674 CTCACATGGCAGAAAGGCAAAGG - Intergenic
1109973137 13:69796508-69796530 CACTCATGACAGAAGGCAAAGGG - Intronic
1109988391 13:70019998-70020020 CTCACGTGACAGAAGGCAGAAGG - Intronic
1110130472 13:72002676-72002698 CACTCATGACAGAAGGCGAAGGG + Intergenic
1110330950 13:74271728-74271750 CTCACATGACAAAAGTGTGAAGG + Intergenic
1110662320 13:78071748-78071770 CTGACATGACAGAAAGGACATGG - Intergenic
1110950650 13:81485818-81485840 TTCACATGATAGAAGGGTCAAGG - Intergenic
1111641484 13:90976279-90976301 CTCACATGGCAGAAGGCAGAAGG - Intergenic
1111663656 13:91241726-91241748 TTCACAGGACAGATGGGAAATGG + Intergenic
1111671818 13:91340694-91340716 CTCAAATGACACACGGACAATGG + Intergenic
1112473628 13:99711372-99711394 CTCATATGACAGAAGGGGTGAGG + Intronic
1113035844 13:106047763-106047785 CTCACATGATGGAAGGGGCAAGG - Intergenic
1113334665 13:109366455-109366477 CTCACATGACAAAAGGCTGAGGG - Intergenic
1113389089 13:109878506-109878528 CGCACATGGTAGAAGGGCAAGGG - Intergenic
1114084300 14:19228198-19228220 CTCACATGACAGAAGGGATGAGG - Intergenic
1115300199 14:31876888-31876910 CCCACATGGCAGAAGGCGAAGGG + Intergenic
1115358918 14:32479754-32479776 CTCATGTGACAGAAAGGCAAGGG - Intronic
1115824091 14:37245743-37245765 TTCAAATTACAGAAAGGCAATGG + Intronic
1116145977 14:41069550-41069572 CTCACAGGACAGAAGGTAGAAGG - Intergenic
1116334024 14:43634261-43634283 CTCACATAGCAGAAGGTGAAAGG + Intergenic
1116429436 14:44828903-44828925 CTCACATGACAGAAAGGGCAAGG - Intergenic
1116503191 14:45646005-45646027 CTCACATGGTAGAAGAGCAAGGG - Intergenic
1117287814 14:54304263-54304285 CTCATATGGCAGAAGGGGCAAGG - Intergenic
1117733078 14:58743474-58743496 CTCACATGGCAGAAGGCTCAAGG - Intergenic
1118050891 14:62026429-62026451 CTCACATGGCAGAAGGTGGAAGG + Intronic
1119140445 14:72262787-72262809 CTCACATAGCAGATGGCCAAGGG + Intronic
1119167308 14:72505376-72505398 TTCACATGACAGAAGGGAAAGGG + Intronic
1119564127 14:75614291-75614313 CTCACATGACAAATGTGCAGTGG + Intronic
1119609134 14:76047009-76047031 CTCACATGGCAGAAGGCAGAAGG + Intronic
1120073003 14:80124157-80124179 CAGACATGGCAGAAGGCCAAAGG - Intergenic
1120413158 14:84184067-84184089 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1120592078 14:86388301-86388323 TTCACATGACAGAAGGCGGAAGG + Intergenic
1120849002 14:89151847-89151869 CAATCATGGCAGAAGGGCAAAGG + Intronic
1120862118 14:89264401-89264423 CTAACATGACAGAACAGCATGGG + Intronic
1121156233 14:91687446-91687468 CTCACGTGGCAGAGGGGCAAGGG - Intronic
1121383057 14:93491108-93491130 CTCAAGTGACAAAAGGGCAAGGG + Intronic
1121659412 14:95623949-95623971 CTCACATGGCAGAAAGGGCAAGG + Intergenic
1121853173 14:97242381-97242403 TTCACATGGTGGAAGGGCAAAGG + Intergenic
1121915400 14:97833158-97833180 CTCACATCACAGGAGGAAAAGGG - Intergenic
1121941792 14:98077735-98077757 CTCACATGGCACAAGGGGCAAGG + Intergenic
1121968057 14:98328853-98328875 CTCACATGGTAGAAGGGCCCAGG + Intergenic
1122520838 14:102342514-102342536 CTCCCAGGAGAGAAGGGAAACGG - Intronic
1122612381 14:102994412-102994434 CTCTCCTGACAGAAGAGCACTGG + Intronic
1123122638 14:105925088-105925110 CTCACTTGGGAGAAGGGGAAAGG + Intronic
1202895914 14_GL000194v1_random:10060-10082 CTCACATGACAGAAGGGATGAGG - Intergenic
1123405284 15:20016514-20016536 CTCACTTGGGAGAAGGGGAAAGG + Intergenic
1123514614 15:21023162-21023184 CTCACTTGGGAGAAGGGGAAAGG + Intergenic
1124047396 15:26162867-26162889 CTCACATGGCCGAAGGGGCAAGG + Intergenic
1124353744 15:28979315-28979337 CTCACATGACAGGAGTGGACCGG - Intronic
1124583263 15:30981420-30981442 CTCACATGACACAAGGGCAAAGG + Intronic
1124839542 15:33229021-33229043 CTCACATGGCAGAAGGAGCAAGG + Intergenic
1125776858 15:42223605-42223627 GTCACATGACAGAAGGTGGAAGG - Intronic
1126124146 15:45280074-45280096 CTCACATGGCAGAAGGGACAAGG - Intergenic
1126318717 15:47398729-47398751 CTCACCTGACACCAGGACAAAGG - Intronic
1126451992 15:48818453-48818475 CTCACATGACGGAAATGCTAAGG + Intergenic
1127284104 15:57517662-57517684 ATCACATGGCAGAAGGGCAGAGG + Intronic
1127290973 15:57570770-57570792 CACTCATGACAGAAGGTGAAGGG - Intergenic
1127552416 15:60053961-60053983 CTGCCATGAGTGAAGGGCAAGGG + Intronic
1127815211 15:62602680-62602702 CTTACATGGCAGAAAGGGAAAGG + Intronic
1128591788 15:68904493-68904515 CTCACATGGCAGAAGGCAGAAGG + Intronic
1128748721 15:70133299-70133321 CTCACATGGAGGGAGGGCAAAGG + Intergenic
1128822807 15:70675863-70675885 CTCACCTGGCAGAAGGCGAAAGG - Intronic
1129429229 15:75486393-75486415 CTCACATGGCAGAAGGGGAAGGG - Intronic
1129442518 15:75592107-75592129 CTCCCAGGAGCGAAGGGCAAAGG - Intergenic
1129552224 15:76465288-76465310 CTCACCTGACAGAAGGGGCAAGG + Intronic
1129912432 15:79239727-79239749 CTCACATGCATGAAGGCCAAAGG - Intergenic
1130253440 15:82315139-82315161 CGCACAGGGAAGAAGGGCAAAGG - Intergenic
1130391250 15:83457326-83457348 GTCACATGACAGAAGTTAAAAGG - Intronic
1130429610 15:83833356-83833378 CTCACATGGCAGAAGGGATGAGG + Intronic
1130706885 15:86241597-86241619 CTCACATAGCAGAAGGTGAAAGG + Intronic
1131024445 15:89128385-89128407 CCCACAGGACAAAAGGACAAAGG - Intronic
1131077922 15:89509890-89509912 CTTTCATGACAGAAGGGGAGAGG - Intergenic
1131560743 15:93437243-93437265 CTCACATGGCAGAAGGCAGAAGG - Intergenic
1131975287 15:97939752-97939774 CTCACATGGCAGAAGGTGGAAGG - Intergenic
1132020547 15:98358148-98358170 CTCACATGACAGAAGAAGCAAGG - Intergenic
1133026950 16:2992682-2992704 CACACAAGACAGAAAGGCAGAGG + Intergenic
1133179006 16:4038427-4038449 CTCACATGACAGAAGAGCAAAGG - Intronic
1133700754 16:8306255-8306277 CTTAGATGACAGAAGCTCAAAGG - Intergenic
1134166068 16:11930609-11930631 TTCAGATGCCAGAAGGGCAGAGG - Intronic
1134285672 16:12860155-12860177 CTCACATGGCAGAAGGTGGAAGG - Intergenic
1134310226 16:13069841-13069863 CTCACAGGGCAGAAGGGCCAAGG - Intronic
1134494650 16:14723118-14723140 TTCAGATGCCAGAAGGGCAGAGG + Intronic
1134500033 16:14762238-14762260 TTCAGATGCCAGAAGGGCAGAGG + Intronic
1134526576 16:14948856-14948878 TTCAGATGCCAGAAGGGCAGAGG + Intronic
1134545828 16:15107489-15107511 TTCAGATGCCAGAAGGGCAGAGG - Intronic
1134580547 16:15366812-15366834 TTCAGATGCCAGAAGGGCAGAGG - Intronic
1134714154 16:16347329-16347351 TTCAGATGCCAGAAGGGCAGAGG + Intergenic
1134722027 16:16390693-16390715 TTCAGATGCCAGAAGGGCAGAGG + Intronic
1134945398 16:18321176-18321198 TTCAGATGCCAGAAGGGCAGAGG - Intronic
1134952663 16:18361329-18361351 TTCAGATGCCAGAAGGGCAGAGG - Intergenic
1135178632 16:20253633-20253655 CTCACATGACAGAAGAGGCAAGG + Intergenic
1135311458 16:21408034-21408056 TTCAGATGCCAGAAGGGCAGAGG - Intronic
1135364410 16:21840485-21840507 TTCAGATGCCAGAAGGGCAGAGG - Intronic
1135447433 16:22530863-22530885 TTCAGATGCCAGAAGGGCAGAGG + Intronic
1135502238 16:23006529-23006551 CACTCGTGGCAGAAGGGCAAAGG + Intergenic
1136150617 16:28345932-28345954 TTCAGATGCCAGAAGGGCAGAGG - Intronic
1136166854 16:28459770-28459792 TTCAGATGCCAGAAGGGCAGAGG - Intronic
1136196121 16:28655262-28655284 TTCAGATGCCAGAAGGGCAGAGG + Intronic
1136212461 16:28769385-28769407 TTCAGATGCCAGAAGGGCAGAGG + Intronic
1136257182 16:29049297-29049319 TTCAGATGCCAGAAGGGCAGAGG + Intronic
1136283436 16:29227907-29227929 CTCACATGGCGGAAGGGGTAAGG + Intergenic
1136308164 16:29387030-29387052 TTCAGATGCCAGAAGGGCAGAGG - Intronic
1136321580 16:29488568-29488590 TTCAGATGCCAGAAGGGCAGAGG - Intronic
1136436260 16:30228538-30228560 TTCAGATGCCAGAAGGGCAGAGG - Intronic
1137565587 16:49530762-49530784 CTCAGCTGACAGAAGAGGAAGGG + Intronic
1137791158 16:51175955-51175977 CACTCATGGCAGAAGGGGAAGGG - Intergenic
1138087219 16:54143996-54144018 CTCAGATGACAAAAGGTGAAGGG - Intergenic
1138209427 16:55151007-55151029 CTCACATGGCAGAAATGAAAAGG + Intergenic
1138397162 16:56713867-56713889 CTCACATGGCAGAAGGCAGAAGG + Intronic
1139022814 16:62772864-62772886 CTCACATGGCAGAAGGTAGAAGG + Intergenic
1139032026 16:62895682-62895704 CACTCATGGCAGAAGGGGAAAGG - Intergenic
1139130773 16:64141592-64141614 CTTACATGACGGAGGAGCAAGGG - Intergenic
1139293267 16:65876925-65876947 GACAGATGACAGAAGGGCAAGGG + Intergenic
1139445439 16:66995453-66995475 TTCCCATGACAGATGGGCCAGGG + Intronic
1139532420 16:67548905-67548927 CCCACATGACAGCAGGGTAGGGG - Intergenic
1139979368 16:70841751-70841773 ATCACATGATGAAAGGGCAATGG - Intronic
1140366873 16:74388632-74388654 TTCAGATGCCAGAAGGGCAGAGG + Intronic
1140706871 16:77638965-77638987 CTCACATGGCAGAAGGGGCCAGG - Intergenic
1141042422 16:80683774-80683796 CTCACATGATAGAAGGGGCAAGG - Intronic
1142087861 16:88193857-88193879 CTCACATGGCGGAAGGGGCAAGG + Intergenic
1142453699 16:90202897-90202919 CACTCATGGCAGAAGGGGAAGGG + Intergenic
1144125927 17:12202829-12202851 CTCACATGGCAGAAGAGGCAAGG - Intergenic
1144226951 17:13158459-13158481 CTCACATGACAGAAGGCAAAAGG + Intergenic
1144358587 17:14469725-14469747 CTCACATAAAGGACGGGCAAAGG + Intergenic
1144417756 17:15068183-15068205 CTCACATAGCAGAAGGTGAACGG + Intergenic
1144671562 17:17135611-17135633 CTCACATGTTAGAAGGGGCAAGG + Intronic
1144798616 17:17910290-17910312 CTCACATCCCAGAGGGGGAAGGG - Intronic
1145102541 17:20088904-20088926 CTCACATGGCAGAAGGGGCAAGG - Intronic
1145378408 17:22373047-22373069 CTCACATGGCAGAAGGCGGAAGG - Intergenic
1145833142 17:27933675-27933697 GGCAGAAGACAGAAGGGCAAGGG + Intergenic
1146415027 17:32623832-32623854 CTCACATGGCAAAAGGGCGAGGG + Intronic
1147157883 17:38553553-38553575 ATCATGTGAGAGAAGGGCAATGG - Intronic
1147479153 17:40742441-40742463 CTCACAAGGTGGAAGGGCAAGGG + Intergenic
1147560204 17:41504112-41504134 CTCACTTTACAGAAGAGCAATGG - Intronic
1148468814 17:47880829-47880851 ATCACCTGAAAGAAGGGGAAGGG - Intergenic
1148571055 17:48669464-48669486 CTCACATGGCAGATGGGTGAGGG - Intergenic
1148971933 17:51491254-51491276 CTCACATGGAAGAAGGGGCAAGG - Intergenic
1149200615 17:54181912-54181934 CTCACATGATGGAAGGGGCAAGG - Intergenic
1149249422 17:54750811-54750833 CTCACATGATGGAAGGTTAAGGG - Intergenic
1149339918 17:55674689-55674711 GTCTGATGACAGAAGTGCAAAGG - Intergenic
1149634965 17:58159408-58159430 CTCATATGGCAGAAGACCAAAGG - Intergenic
1149974761 17:61254423-61254445 CTGACTTGACACTAGGGCAAAGG - Intronic
1150661878 17:67088185-67088207 CTCAAATGACAGAATGGGATTGG + Intronic
1150714790 17:67562665-67562687 CTCACAAGGCAGAAGGGCGAAGG + Intronic
1150719033 17:67598562-67598584 CTCACATGGTAGAAGGGACAAGG - Intronic
1150907971 17:69358909-69358931 CTCACATGACAGAGGGGGGAAGG - Intergenic
1150998551 17:70347522-70347544 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1151145453 17:72036337-72036359 CTCACATGGCATAAGGGAAAAGG + Intergenic
1151532793 17:74717860-74717882 CTCACATGGTAGAAGGGGCAAGG - Intronic
1151824805 17:76518274-76518296 CTCACCTGGTGGAAGGGCAAGGG - Intergenic
1152029546 17:77833474-77833496 CTCACATGGCAGAAGGTGGAAGG + Intergenic
1152145486 17:78566035-78566057 CTTACATGGCAGAAGGGGCAAGG - Intronic
1152521924 17:80861642-80861664 CTCACATGACACAAAGCCCAGGG + Intronic
1153097288 18:1421507-1421529 CTCACATGGCAGAAGAGAGAAGG + Intergenic
1153132861 18:1877382-1877404 CTCACATGACAGAAGGGGGAAGG - Intergenic
1153173333 18:2341419-2341441 CTCGCATGAGATAAAGGCAAAGG + Intergenic
1153711052 18:7799212-7799234 CTCACATGGCAGAAGGAGGAAGG + Intronic
1154117329 18:11622654-11622676 TTCAGATGCCAGAAGGGCAGAGG - Intergenic
1154338085 18:13481920-13481942 CTCACAGGGCAGGAGGGCAGAGG + Intronic
1154353745 18:13609164-13609186 CACACATAGCAGAAGGGCATGGG - Intronic
1154938653 18:21088769-21088791 CTCACATGGTAGAAGGCAAAAGG - Intronic
1155367771 18:25065979-25066001 ATCACTTGTGAGAAGGGCAAGGG + Intronic
1155605990 18:27606477-27606499 TTCACATAGCAGAGGGGCAAGGG + Intergenic
1155625512 18:27829909-27829931 CAATCATGGCAGAAGGGCAAAGG + Intergenic
1156243208 18:35272860-35272882 CTCACATGACAACAGCACAAGGG + Intronic
1156886246 18:42139676-42139698 CTCACATGGCAGAAGCAGAAGGG + Intergenic
1157032817 18:43933284-43933306 CAATAATGACAGAAGGGCAAAGG + Intergenic
1157078499 18:44495332-44495354 CTCACATCACAGGAGGTCAAAGG + Intergenic
1157231482 18:45920554-45920576 CACACATGGCAGAAGGCCAACGG + Intronic
1157301748 18:46484431-46484453 CTCACATGGCAGAAGGCGGAGGG - Intronic
1157663576 18:49466774-49466796 CTCACATGGAGGAAGGGCAGAGG - Intergenic
1157988724 18:52469967-52469989 CTCACATGGCAGAAGTGCCTAGG + Intronic
1158094511 18:53755531-53755553 CTCACATGGCAGAAGGTGGAAGG + Intergenic
1158727562 18:59987377-59987399 CTCACATGGCAGAAGGGCAAGGG - Intergenic
1159156764 18:64593179-64593201 CTCACATAGCCGAAGAGCAAGGG + Intergenic
1159358212 18:67364435-67364457 CTCACATGGGAGAAGGGACAAGG + Intergenic
1159442175 18:68495343-68495365 CTCACATGACAGAAGGTGTGAGG + Intergenic
1159713991 18:71798466-71798488 CTCACATGGTGGAAGAGCAAAGG - Intergenic
1159829314 18:73254693-73254715 CACTCATGACAGAAGGTGAATGG + Intronic
1163403698 19:17109790-17109812 ATCCCATGAGAGAAAGGCAAGGG - Intronic
1164693474 19:30227271-30227293 CTCACAATACAGAAGTGAAAAGG - Intergenic
1164718609 19:30414648-30414670 TTCACATGAAGGAAAGGCAAAGG - Intronic
1164761405 19:30731161-30731183 CTCACATCAGAGATGGGCATAGG - Intergenic
1165529392 19:36385247-36385269 ATCTCATGGCGGAAGGGCAAAGG - Intronic
1165600083 19:37047342-37047364 CTCACATGGCAGAAGGAGGAAGG - Intronic
1165642007 19:37397695-37397717 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1165642252 19:37399681-37399703 CTCACATGGCAGAAGGCAAAAGG + Intergenic
1165959303 19:39520964-39520986 GTCACATGCCAGGAGGTCAAGGG + Intergenic
1165987351 19:39781671-39781693 CACTCATGACAGAAGGCGAAGGG - Intronic
1166584114 19:43930119-43930141 CTCACGTGGCAGAAGGGTAGGGG + Intronic
1167583836 19:50361840-50361862 CTCACAGGTCAGAAAGTCAAAGG - Intronic
1168281737 19:55309571-55309593 TTCACATGGCAGAAGGGGCAAGG + Intronic
1168637241 19:58005889-58005911 CTCACCTGACAGAAGGTAAAGGG - Exonic
1168646475 19:58062203-58062225 CTGACATGCCATAAGGGCAAGGG + Intronic
925070109 2:960164-960186 CTTTCCAGACAGAAGGGCAAAGG - Intronic
925400153 2:3566864-3566886 CACTCATGGCAGAAGGGGAAGGG - Intergenic
925496089 2:4450900-4450922 CTCACATGGCAGAAGGCTGAAGG - Intergenic
925504412 2:4544718-4544740 CTCACATGGCAGAAGAGGCAAGG + Intergenic
925665565 2:6251755-6251777 CTCACATCACAGATGGGGACAGG + Intergenic
925832768 2:7912354-7912376 CTCACATGGCCGAAGGACAGAGG + Intergenic
925880641 2:8349611-8349633 CTCACATGGCAGAAGGCAGAGGG + Intergenic
926736652 2:16078577-16078599 CTCACAAGCCAGAAGGCCATGGG + Intergenic
927084686 2:19662774-19662796 CTCACATGATGGAAGGGGCAAGG + Intergenic
927262589 2:21107698-21107720 CTGACATGAGTGAAGGACAAAGG - Intergenic
927489815 2:23513687-23513709 CTCAGAGGACAGGAGGGCAGAGG + Intronic
927601910 2:24450451-24450473 CTCACATGGCAGAAGGGGTGGGG - Intergenic
927746424 2:25625935-25625957 CTCACATGACAAAGGGGCAAAGG - Intronic
928002002 2:27531541-27531563 CACTCATGGCAGAAGGGGAAAGG - Intergenic
928044700 2:27917512-27917534 CTTGCATGGCAGAAGGGAAAAGG + Intronic
928801204 2:35094971-35094993 TTCACATGGCAGAAGGGGCAAGG + Intergenic
929129035 2:38547962-38547984 CTCACATGGCAGAAGGAGCAGGG - Intergenic
929584524 2:43105420-43105442 CTCACATGGCAGAAGGGGTTAGG - Intergenic
929831125 2:45347351-45347373 CTCACATGGCAGAAGGAGCAAGG + Intergenic
929875342 2:45792150-45792172 ACAACATGGCAGAAGGGCAAAGG + Intronic
929965561 2:46532656-46532678 CTCACATGGTAGAAGGGAAAAGG - Intronic
930296466 2:49560848-49560870 CACACATGACTGTAGGACAAGGG - Intergenic
930572232 2:53101841-53101863 CTCATATGGCAGAAGGCAAAAGG + Intergenic
930605945 2:53493172-53493194 CTCACATGGGAGAAGGGGCAAGG - Intergenic
931685794 2:64791541-64791563 ATCCCATGGCAGAAGGGCAAAGG + Intergenic
932186155 2:69698146-69698168 CTCACATGACTGAAGGAGCAAGG + Intronic
932889322 2:75578514-75578536 CTCACATGACAGAAGGACCAAGG - Intergenic
932972295 2:76558901-76558923 CTCACATGGCAGAAGGGCTGAGG - Intergenic
933151187 2:78917227-78917249 CTCCCTTAATAGAAGGGCAAAGG + Intergenic
933198075 2:79415289-79415311 CAAACATGGCAGAAGGCCAAAGG - Intronic
933407469 2:81879656-81879678 CAAGCATGGCAGAAGGGCAAAGG + Intergenic
933495320 2:83043349-83043371 CACTCATGACAGAAGGCAAAAGG - Intergenic
933539483 2:83620176-83620198 CAGACATGACAGAAGGCAAAAGG + Intergenic
933948327 2:87307589-87307611 CACTCATGGCAGAAGGGCAAAGG + Intergenic
934569315 2:95358700-95358722 ATCACATGGCTGAAGGGCACAGG + Intronic
934891439 2:98073891-98073913 CTCAGATGGCAGAAGGAGAAAGG + Intergenic
934942164 2:98510557-98510579 CTCACATGACAAAAGGTGAAGGG + Intronic
935272578 2:101447952-101447974 CTCACATGGCAGAAGGCAGAAGG + Intronic
935400544 2:102655864-102655886 CTCACATGGCAGAAGGCAGAGGG + Intronic
935635334 2:105245489-105245511 CTCGCATGGCAGAAAGGGAAGGG + Intergenic
935718091 2:105956108-105956130 CTCACATGGCAGAAGTGGACGGG - Intergenic
936143865 2:109965856-109965878 CTCACTTGACAGAAGGGGCAAGG - Intergenic
936180547 2:110263818-110263840 CTCACTTGACAGAAGGGGCAAGG - Intergenic
936200822 2:110405613-110405635 CTCACTTGACAGAAGGGGCAAGG + Intronic
936262976 2:110978252-110978274 CTCACATGGCAGAAGGCAGAAGG + Intronic
936331872 2:111554006-111554028 CACTCATGGCAGAAGGGCAAAGG - Intergenic
936543130 2:113368281-113368303 CTCACATGGCAGAAGGGGTGAGG + Intergenic
936596900 2:113856778-113856800 CTCACATGGCAGAAGGCAGAAGG - Intergenic
936693283 2:114918118-114918140 ATCTCATTAAAGAAGGGCAAAGG + Intronic
937013604 2:118583555-118583577 CTCACATGGCAGAAGGGGTGAGG + Intergenic
937433880 2:121864147-121864169 CTCACATGGTGGAAGGGGAAAGG - Intergenic
938079085 2:128359743-128359765 CACACATGACAGAAGGGGAAAGG - Intergenic
938492290 2:131767891-131767913 CTCACATGACAGAAGGGATGAGG + Intergenic
938495279 2:131794459-131794481 CTCACATGACAGAAGGGATGAGG - Intergenic
938730385 2:134142597-134142619 TTCACATGACCAAAGGGCACTGG + Intronic
938892820 2:135722704-135722726 CTCAAATGACACAAGGTCATAGG - Intronic
938961487 2:136345511-136345533 CTCACATGGCAGAAGGAGCAAGG + Intergenic
939162162 2:138603629-138603651 CTCACAGGGTTGAAGGGCAAGGG + Intergenic
939444626 2:142292454-142292476 CACGCATGGCAGAAGGGAAAGGG - Intergenic
939499370 2:142963499-142963521 CTCACATGGCAGAAGGGCTAAGG + Intronic
940372781 2:152921408-152921430 CTCACATGGTAGAAGGGGCAAGG + Intergenic
940418435 2:153449792-153449814 CTCACATGACAGAAGGTGGAAGG + Intergenic
940478723 2:154200629-154200651 CTCACATGGCAGAAGGTAGAAGG + Intronic
941348839 2:164406127-164406149 CTCACATGGCAGAAGGAGCAAGG - Intergenic
941688999 2:168478748-168478770 CACCCAAGACAGAAGGGCCAGGG - Intronic
941708072 2:168680734-168680756 CTCACATGACAGAATGCTGAAGG - Intronic
941856279 2:170234367-170234389 CTCACATGGCAGAAGGCAGAAGG + Intronic
941946192 2:171100483-171100505 CTCATGTTACAGAAGGTCAAAGG - Intronic
942020621 2:171864575-171864597 CTCACATTAGTGAATGGCAATGG - Intronic
942592321 2:177559169-177559191 ATAACATGGCAGAAGGTCAAAGG - Intergenic
942983031 2:182105477-182105499 CACAGAAGAGAGAAGGGCAAAGG + Intronic
943395691 2:187329722-187329744 CAAACATGGCAGAAGGGCAAAGG - Intergenic
943625695 2:190197045-190197067 CTCACATGTCAGTAGGGGCAAGG + Intronic
944036844 2:195304574-195304596 CAATCATGGCAGAAGGGCAAGGG - Intergenic
944223576 2:197326641-197326663 CTCACATGGCAGAAGGCTGAAGG - Intergenic
944467609 2:200018793-200018815 CTCACATGGCAGAAGGGGTAAGG + Intergenic
944977996 2:205079453-205079475 CTTACATGACAGAAGGCAGAAGG + Intronic
945319503 2:208405839-208405861 CTCACATGGCAGAAGGGATGAGG - Intronic
945426965 2:209717755-209717777 ATTAAATGACAAAAGGGCAATGG + Intronic
945509789 2:210686979-210687001 CAATCATGGCAGAAGGGCAAAGG + Intergenic
945650412 2:212551637-212551659 CTCCCATGATAGAAGGGGCAAGG + Intergenic
945930724 2:215852551-215852573 CTCACATGGCAGAAGGGTCAAGG + Intergenic
946426621 2:219601824-219601846 ATCACATGACTGCAGAGCAATGG - Intronic
946443147 2:219713969-219713991 CTCATATGGCAGAAGGGGTAGGG - Intergenic
946468929 2:219938537-219938559 CTCACCTGGCAGAAGGTGAAAGG - Intergenic
946879055 2:224159467-224159489 CAATCATGGCAGAAGGGCAAAGG + Intergenic
947069821 2:226276189-226276211 CTCACATGGCAGAAGGAGCACGG + Intergenic
947436432 2:230076766-230076788 CTCACATGATAGAAGGGGCAGGG + Intergenic
947739300 2:232477811-232477833 CTCACTGAACACAAGGGCAACGG + Intergenic
947915680 2:233830467-233830489 CTAACATGAAAGAAATGCAATGG + Intronic
948765997 2:240219354-240219376 CTCACATGGCAGAAGGGGTAAGG + Intergenic
949085145 2:242147560-242147582 CACTCATGGCAGAAGGGGAAGGG + Intergenic
1169331401 20:4719309-4719331 CCCACATGGCAGAAGGGACAAGG + Intergenic
1169605810 20:7317598-7317620 CTCACATCAGAGAAGTTCAAAGG - Intergenic
1169635794 20:7690038-7690060 CTCACATGGTAGAAGGAAAAAGG - Intergenic
1169994023 20:11536463-11536485 CTCACATGGAGGAAGGGCAGAGG - Intergenic
1170195530 20:13685280-13685302 CTCACATGGCAGAAGGCTGAAGG + Intergenic
1170425397 20:16230202-16230224 GTCAGATGACAGAAGGGTAAAGG - Intergenic
1170957049 20:20991167-20991189 CTCACATGGCAGAAGGGGAGAGG + Intergenic
1171524869 20:25800943-25800965 CTCACATGGCAGAAGGTGGAAGG + Intronic
1171534057 20:25870610-25870632 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1171551958 20:26054940-26054962 CTCACATGGCAGAAGGTGGAAGG - Intergenic
1171571231 20:26253484-26253506 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1171855383 20:30338166-30338188 CTCACATGGCAGAAGGCGGAAGG + Intergenic
1172315632 20:33951996-33952018 CAATCATGGCAGAAGGGCAAAGG - Intergenic
1172835650 20:37871441-37871463 CTCACATTGCAGAAGGGGGAAGG + Intronic
1173234174 20:41228572-41228594 CTCACATGGCAGAAGGGACCAGG + Intronic
1173674280 20:44820412-44820434 CCCACATGTCAGAAGGGGGATGG + Intergenic
1173881281 20:46414357-46414379 TTCACGTGGCAGAAGGGGAAAGG + Intronic
1173954389 20:47019280-47019302 CCCAGATGACAGAAGGGCAGCGG + Intronic
1174144550 20:48442283-48442305 CTCAAACGACAGAAGGGGCAAGG + Intergenic
1174503347 20:51001427-51001449 CTCACTTGAGAGAGGGACAAAGG - Intergenic
1174517766 20:51106296-51106318 CTCACATGGCAGAAGGGGAAAGG - Intergenic
1174779807 20:53378581-53378603 TTCACATGACAGGAGTTCAATGG + Intronic
1175000285 20:55620455-55620477 CTCACATCACTGTAGGGAAATGG + Intergenic
1175084287 20:56445731-56445753 CTCTCAAGACAGCAGGGCACGGG - Intronic
1175171352 20:57083791-57083813 CTCAGATGACAGGAGGCCAAGGG - Intergenic
1175995245 20:62809371-62809393 CACAGATGGCAGCAGGGCAAGGG + Intronic
1176709572 21:10137692-10137714 CTCACATGACAGAAGGGATGAGG + Intergenic
1176937276 21:14881987-14882009 CTCACATGGTGGAAGGGCCAAGG + Intergenic
1177006242 21:15675865-15675887 CTCACATGGCAGAAGGGGTGAGG - Intergenic
1177018222 21:15817636-15817658 CTAACATGGCAGAAGGTGAAGGG + Intronic
1177072702 21:16530660-16530682 CTAACCTGACAGAATGGCTAAGG - Intergenic
1177197042 21:17914275-17914297 CTCACATGGCAGAAGAGTAATGG + Intronic
1177478521 21:21655131-21655153 ATCACATGAAAAGAGGGCAAAGG + Intergenic
1177802358 21:25840379-25840401 CTCACATGGTAGAAGGGCAAGGG + Intergenic
1178126875 21:29525853-29525875 CAATCATGGCAGAAGGGCAAAGG + Intronic
1178131214 21:29574456-29574478 CTCACAGGACAGAGGGGCACTGG - Intronic
1178169373 21:30021555-30021577 CTCACATGGCAGAAGAGGCAAGG - Intergenic
1178600765 21:33992569-33992591 TTCACATGGCAGAAGGCAAAAGG + Intergenic
1178983916 21:37287118-37287140 CTCACATGGCAGAAGAGCAGAGG - Intergenic
1179390004 21:40979765-40979787 CTCACCTGGCAGAAGTGGAAGGG - Intergenic
1180293671 22:10865005-10865027 CTCACATGACAGAAGGGATGAGG + Intergenic
1180496476 22:15894420-15894442 CTCACATGACAGAAGGGATGAGG + Intergenic
1180573408 22:16750504-16750526 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1181411992 22:22730619-22730641 CTCACATGACAGAAGGGATGAGG - Intergenic
1181419034 22:22784948-22784970 CTCACATGACAGAAGAGATGAGG - Intronic
1182474039 22:30566216-30566238 CTCAAAAGGCAGAAGGTCAATGG - Intronic
1182782100 22:32876198-32876220 CTTACATGGCAGAAGGGGCAAGG + Intronic
1182817638 22:33180007-33180029 CTCACATGGCAGAAGGCAGAAGG - Intronic
1182920540 22:34075215-34075237 CTCACATGGCAGAAGGGGGAAGG + Intergenic
1182931147 22:34175489-34175511 CTCACATGGTGGAAGGGCCAAGG + Intergenic
1183261035 22:36796163-36796185 CTCACATGGTGAAAGGGCAAAGG + Intergenic
1183698141 22:39434770-39434792 CTCCCATCACAGAGGGGCCAGGG + Intronic
1184014849 22:41778170-41778192 CTCACATGACAGAAGGGGTGAGG + Intronic
1184078691 22:42201917-42201939 CTCAAAAGACAGAAGGCAAAAGG - Intronic
1184559784 22:45255549-45255571 CTCACATGGCAGAAGGTAGAAGG + Intergenic
1184740538 22:46426473-46426495 CTCACATGACAGAAGGGGTGAGG + Intronic
1184939723 22:47754340-47754362 TTCAGATGAAAGAAGGTCAATGG + Intergenic
949316007 3:2756360-2756382 CTCACATGGCAGAAGGAGCAAGG - Intronic
949340197 3:3021411-3021433 CTCAGATGACATAAGGGGACTGG - Intronic
949624485 3:5851374-5851396 CACTCATGACAGAAGGTGAAGGG - Intergenic
949636258 3:5984648-5984670 ATCACATGGCAGAAGGTGAAAGG + Intergenic
949726918 3:7059772-7059794 CTCACATGGCAGAAGGGGTTAGG - Intronic
950307493 3:11927780-11927802 CACTCATGGCAGAAGGGGAAGGG + Intergenic
950800700 3:15550045-15550067 ATCACATGCCTGAAGGGCCAAGG + Intergenic
951061692 3:18215828-18215850 CTCACATGACAGAAAGAGAAAGG - Intronic
951520349 3:23605413-23605435 CTCACATGGCAGAAGACAAAAGG - Intergenic
951522543 3:23622700-23622722 CTCCCATCACAGAAGGGGCAAGG + Intergenic
951843381 3:27059206-27059228 CTCACATAACTGAATGGGAAAGG - Intergenic
952234044 3:31460812-31460834 CTCACGTGGCAGAAAGGCAAAGG + Intergenic
952300108 3:32097397-32097419 CTCACATGATGGAAGAGCAGAGG - Intergenic
952510389 3:34047749-34047771 CTCACATGGCAGAAGAGCCAAGG - Intergenic
952585545 3:34887761-34887783 CTCACATGGCAGAAGACAAAAGG - Intergenic
952733462 3:36664625-36664647 CAAACATGACGGAAGGGGAAGGG - Intergenic
953408561 3:42673506-42673528 CTCACATGGCAGAAGGCCAAAGG + Intergenic
953532732 3:43752796-43752818 CTCAGAAGGCAGAAAGGCAAGGG + Intergenic
954525949 3:51271423-51271445 CTCACATAGCAGAAGGGGCAAGG + Intronic
954789295 3:53119338-53119360 CTCACATGCCAGCAGAGCACAGG - Intronic
954815078 3:53273846-53273868 CACTCATGGCAGAAGGGGAAGGG + Intergenic
955241648 3:57183241-57183263 CTCACATGGCAGAAGGGGAAAGG + Intergenic
956758358 3:72412960-72412982 CTCACATGGCAGAAGGTGGAAGG - Intronic
956919187 3:73908267-73908289 CTCACATGGCAGAAGGCAGAAGG - Intergenic
956957343 3:74356124-74356146 CTCACATGGTAGAAGGGGCAAGG - Intronic
957444777 3:80301869-80301891 CTTACATGACAGCAGGCAAAAGG + Intergenic
957660542 3:83145955-83145977 ATGACATGAGAGAAGGGGAAGGG - Intergenic
958036098 3:88172186-88172208 CTCATATGACAAAAGAGAAAGGG + Intergenic
958124282 3:89335287-89335309 CTCAGATGATAGAAGGGACAAGG + Intronic
958488517 3:94743168-94743190 CACACAGGACACAAGTGCAAAGG + Intergenic
958521686 3:95197858-95197880 CTCAGACCGCAGAAGGGCAAGGG + Intergenic
958610769 3:96423332-96423354 ATCACGTAACAGAAGGGCCAAGG - Intergenic
958686803 3:97408677-97408699 CTCACATGGCAGAAGGGTATGGG + Intronic
959303554 3:104631704-104631726 CTGTCATGTCAGAAGGCCAAAGG + Intergenic
959508973 3:107188659-107188681 CTCACATGGTAGAAGGGGAGAGG + Intergenic
959518421 3:107297853-107297875 CTCACATGATGGAAGGGGCAAGG - Intergenic
959726963 3:109554523-109554545 CTCACAAGATGGAAAGGCAAGGG + Intergenic
960124748 3:113986243-113986265 CTAACCTGACAATAGGGCAATGG + Intronic
960358430 3:116680631-116680653 CTCACATGGCAGAAGGCAAGAGG - Intronic
960559577 3:119068790-119068812 CTCACATGATAAAAGGACAATGG + Intronic
960697746 3:120412415-120412437 CTCACATGGCAGAAGGCAGAAGG - Intronic
961826574 3:129602288-129602310 AGCACATGACACAAGGGCCAGGG - Intronic
962894165 3:139698945-139698967 CACTCATGTCAGAAGGGGAAGGG - Intergenic
963423085 3:145087225-145087247 CTCACATGACAGAAAGTGGAAGG + Intergenic
963845465 3:150151429-150151451 CTCACATGACAGAAAGAGAGAGG - Intergenic
963908424 3:150793767-150793789 CTCACATGGTAGAAGGGCAGAGG - Intergenic
963958885 3:151285824-151285846 CTTACATGGCGGAAGGTCAAAGG - Intronic
964092651 3:152894481-152894503 CTCGTATGACAGAAGGGGCAAGG - Intergenic
964165134 3:153695079-153695101 CTCACATGGCAGAAGGGAGAAGG - Intergenic
964174933 3:153816393-153816415 ACAACATGACAGAAGGTCAATGG - Intergenic
964309631 3:155378899-155378921 CTCACATGGCAGAAGGGGCGTGG + Intronic
964323802 3:155525352-155525374 CTCACGTGACAGAAGGGGCAAGG - Intronic
964441853 3:156719391-156719413 TTCACATGGCAGAAGGGAAGAGG - Intergenic
965404396 3:168251005-168251027 TTCACATTTCAGAAAGGCAAAGG - Intergenic
965465044 3:169018747-169018769 ATAACGTGGCAGAAGGGCAAGGG - Intergenic
965797566 3:172457250-172457272 CTCACATGGCAGAAGGGGTGAGG + Intergenic
965948536 3:174274467-174274489 CTGAACTGACAGAATGGCAAAGG - Intronic
966001047 3:174949007-174949029 CTCACATGGCAGAAGAGAAAGGG + Intronic
966087400 3:176085154-176085176 CTCACATGGCTGAAGGGAAGAGG + Intergenic
966288753 3:178329588-178329610 CTCACATGGCAGAAGGGCAGAGG + Intergenic
966972678 3:185059987-185060009 CGATCATGGCAGAAGGGCAAAGG - Intergenic
967123458 3:186404524-186404546 CTCACATGGTGAAAGGGCAAGGG - Intergenic
967253040 3:187562755-187562777 CACCCATGACAGAAGGCAAAGGG + Intergenic
967385624 3:188908053-188908075 CTCACATGGCAGAAAGCAAAGGG + Intergenic
967774916 3:193376337-193376359 CTCACATGGTAGAAGGGACAAGG + Intronic
968697200 4:2037162-2037184 CAATCATGGCAGAAGGGCAAAGG - Intronic
969081370 4:4621180-4621202 CTCACATGGCAGAAGGGGCAAGG + Intergenic
969328476 4:6458422-6458444 CTCACATGACAGAAGGGCAAGGG + Intronic
969355867 4:6625265-6625287 CTCACATGGCAGAAGGGGCAAGG + Intergenic
970162723 4:13205365-13205387 CTCACATGGCAGAAGGGGCAGGG + Intergenic
970207533 4:13669837-13669859 CTCATGTGACAGAAGGGACAAGG + Intergenic
970230671 4:13907585-13907607 CTCACAGGACAAAAGAGCAGAGG - Intergenic
970237712 4:13975403-13975425 CTCACATGGCGAAAGGGGAAGGG + Intergenic
970276176 4:14403615-14403637 CCATCATGGCAGAAGGGCAAAGG + Intergenic
970367353 4:15373245-15373267 CACACATGACAGAAGGGTAGAGG + Intronic
970732068 4:19117463-19117485 CTCACATAGCAGAAGGGACAAGG + Intergenic
970964562 4:21913397-21913419 CTCACATGGCAGAAGGCAGAAGG - Intronic
971020996 4:22535242-22535264 CTCACTTGGCAGAAGGCAAAGGG - Intergenic
971272749 4:25166045-25166067 CTCACATGGCAGAAGGTGGAAGG - Intronic
971412696 4:26391989-26392011 CTCACATGGCAGGAGGGACAAGG + Intronic
971515330 4:27479140-27479162 CTCACATGAGGGAAGGGGCAAGG - Intergenic
971520579 4:27545871-27545893 CTCACATGGCAGAAGGCAGAAGG + Intergenic
971599583 4:28575321-28575343 CTCACATGGCAGAAGGGGAGAGG + Intergenic
971671217 4:29560600-29560622 GTTACATGGCAGAAGGCCAAGGG + Intergenic
971907445 4:32745538-32745560 CTCACATGACAAAGGGACAAAGG + Intergenic
971945671 4:33273530-33273552 CTCACATGGCAGAAGGTGGAAGG - Intergenic
971996524 4:33972554-33972576 CTCACATGACAGAAGGCAGAAGG - Intergenic
972097806 4:35370141-35370163 CTCACATGACATAAGGGGTAAGG + Intergenic
972142310 4:35976096-35976118 CTCACATGGCAGAAGGGGCAAGG + Intronic
972161573 4:36234300-36234322 CTCACATGGCAGAAGGGCAAGGG + Intronic
972263605 4:37437316-37437338 CTCACAGGGCAGGAGGGCAAGGG + Intronic
972280007 4:37592721-37592743 CTCACTTTACAGATGGGTAAAGG - Intronic
972803755 4:42506303-42506325 CTCACATGGTAGAAGGGGCAAGG - Intronic
972887225 4:43507615-43507637 CTCACATGGCAGATGAGGAAAGG - Intergenic
972907342 4:43767496-43767518 CTCACATGGCAGGAAGGCAGAGG + Intergenic
973009910 4:45060280-45060302 CAATCATGACAGAAGGGGAAGGG + Intergenic
973025298 4:45261355-45261377 ATCACATGGCAAAAGGGAAAGGG + Intergenic
973169093 4:47116853-47116875 CAATCATGGCAGAAGGGCAAGGG + Intronic
973189203 4:47367928-47367950 CTCACATGAAACAAAGGAAAAGG + Intronic
973627283 4:52785425-52785447 CTCACATGGCAGAAGGGGCCAGG - Intergenic
973646672 4:52957045-52957067 CACACAAGAGAGGAGGGCAAGGG + Intronic
974092241 4:57323201-57323223 CTCACATGATGGAAGAGCAAAGG + Intergenic
974198593 4:58610125-58610147 CTCACATGGCTGAAGGTAAAAGG - Intergenic
974469080 4:62295919-62295941 CTCACATGGTAGAAGGTGAAGGG + Intergenic
974506264 4:62776825-62776847 CAATCATGGCAGAAGGGCAAAGG - Intergenic
974660409 4:64880988-64881010 CTCATATAGCAGGAGGGCAAAGG - Intergenic
974677409 4:65111419-65111441 CTCACATGGCAGATGGGATAAGG - Intergenic
974900668 4:67993217-67993239 ATCACATGACAGACAGCCAATGG + Intergenic
975028724 4:69585763-69585785 CTCACATGGTAGAAGTGGAATGG + Intergenic
975421862 4:74174101-74174123 CTCACATGGCAGAAGGCACAAGG + Intronic
975516293 4:75251974-75251996 CTCACATGGCAAAATGTCAAAGG - Intergenic
975740897 4:77427837-77427859 CTCACATGGCAGAAGGTAGAGGG + Intronic
976334697 4:83871822-83871844 CTCACATGGTAGAAGGGGCAAGG + Intergenic
976425732 4:84901077-84901099 CTCACATGGCAGAAGGCGAAAGG + Intronic
976493870 4:85703584-85703606 CTCACATGGCAGAAGAGGCAAGG - Intronic
977281588 4:95046696-95046718 TACACCTGACAGAAGGGCAGAGG - Intronic
977358141 4:95972101-95972123 CTCACATGACTGAATGGATAAGG + Intergenic
977421311 4:96803318-96803340 CTCACATGGCAGAAGGGACAAGG - Intergenic
977437866 4:97022878-97022900 CTCACATGGTAGAAGTGAAAAGG - Intergenic
977443073 4:97095060-97095082 CAATCATGGCAGAAGGGCAAAGG + Intergenic
977490702 4:97706420-97706442 CTCACATGGCAGAAGGGCAAAGG - Intronic
977540068 4:98306364-98306386 CTCACATGACAGAAGGTGGAAGG + Intronic
977748463 4:100579857-100579879 CTCACATGGCAGAAGGGGCAAGG - Intronic
977748600 4:100581002-100581024 CTCACATGGCAGAAGGAGCAAGG - Intronic
977880498 4:102198949-102198971 CTCACATGGCAGAAGGGATAAGG + Intergenic
977954360 4:103010303-103010325 CTCACATGGCAGAAGGTATAAGG + Intronic
978050347 4:104191107-104191129 CTCACATGGTAGAAGGGACAAGG + Intergenic
978063192 4:104364216-104364238 CAATCATGGCAGAAGGGCAAAGG - Intergenic
978099138 4:104815269-104815291 CTCACATGACAGAAGGTGGAAGG - Intergenic
978365770 4:107979729-107979751 CTCACGTGATAGAAGGGACAAGG - Intergenic
978506041 4:109457471-109457493 ATCACGTGGCAGAAGGGCAAAGG + Intronic
978713093 4:111809322-111809344 CTCCCAGGAGACAAGGGCAAAGG - Intergenic
978964443 4:114724597-114724619 CTCACATGGCAGAAGGGAGGAGG - Intergenic
979174392 4:117644497-117644519 CTCACATGGCAGAAGGGGCAAGG + Intergenic
979262576 4:118665805-118665827 CACTCATGGCAGAAGGGGAAGGG + Intergenic
979306781 4:119155044-119155066 CACTCATGGCAGAAGGGAAAGGG + Intronic
979418214 4:120469836-120469858 CTCACATGGCAGAAGGCAGAAGG - Intergenic
979669488 4:123347131-123347153 CACTCATGGCAGAAGGGAAAGGG - Intergenic
980174844 4:129332202-129332224 CTCACATGGCAGAAGGGGTGAGG - Intergenic
980269172 4:130562296-130562318 CACTCATGGCAGAAGGGGAACGG - Intergenic
980763910 4:137273346-137273368 CTCACATAGCAGAAGGTGAAAGG + Intergenic
980972149 4:139576794-139576816 CTCACATGGCAGAAGGGGTATGG + Intronic
981031740 4:140132216-140132238 CTTACAGGAGAGAAGGGCAAGGG - Intronic
981274988 4:142888736-142888758 CTCACATGGCAGAAGGGGCAAGG - Intergenic
981356238 4:143792530-143792552 CTCACATGGCAGAAGGAGGAAGG - Intergenic
981377556 4:144033412-144033434 CTCACATGGCAGAAGGAGGAAGG - Intergenic
981473292 4:145161569-145161591 CTCACACAGAAGAAGGGCAAAGG + Intronic
981535072 4:145791254-145791276 CTCACATGGCAGAAGAGGCAAGG + Intronic
981698358 4:147581523-147581545 CTCACATGGCAGAAGGTGGAAGG - Intergenic
982020619 4:151200018-151200040 CTCTTATGGCAGAAAGGCAAGGG - Intronic
982113458 4:152077090-152077112 CTCACATGGCAGAAGGGACCAGG - Intergenic
982479286 4:155889602-155889624 CTCACTTCACAGATGGGAAACGG - Intronic
982951191 4:161698140-161698162 CTCACATGGCAGAAGGCAGAAGG - Intronic
983011371 4:162551250-162551272 TTCAGGTGACAGAAGGGAAATGG - Intergenic
983267095 4:165518845-165518867 ATCACTTGAGGGAAGGGCAAAGG - Intergenic
983480150 4:168263654-168263676 CTCACATGGCAGAAGGGACAGGG - Intronic
983500635 4:168495390-168495412 CTCACATGGCAGAAGGTGGAAGG - Intronic
983656294 4:170088842-170088864 CTCACGTGGCAGAAGGGCCAAGG - Intronic
983849687 4:172565084-172565106 CTCACATGGAAGAAGGGGCAAGG + Intronic
983972741 4:173894487-173894509 CTCACATGGCAGAAGGCAGAAGG - Intergenic
984031782 4:174613069-174613091 CTATCATGACAGAAGGTGAAAGG + Intergenic
984176903 4:176430308-176430330 CTCACCTGGCAGAAGGGAAAAGG - Intergenic
984435962 4:179710427-179710449 CTCACATGGCAGAAGGGGCAAGG + Intergenic
984615462 4:181891983-181892005 CTCACATGGCAGAACGTCAAAGG - Intergenic
984863383 4:184259180-184259202 CTCACATGGCAGAAGGGGCAAGG - Intergenic
984900647 4:184583223-184583245 CTCACATGGCAGAAGGCAGAAGG - Intergenic
984983194 4:185302621-185302643 CTCACATGGCAGAAGGTGCAAGG - Intronic
985254738 4:188058480-188058502 CTCACATGGCAGAAGGCAGAAGG + Intergenic
986174296 5:5338892-5338914 CTCACATGGCCGAAGGGGCAAGG - Intergenic
986985778 5:13499674-13499696 CTAACATGGCCAAAGGGCAAGGG - Intergenic
987064342 5:14273621-14273643 CTCATATGGCTGAAGGGCAAGGG - Intronic
987392785 5:17391660-17391682 CTTACCTGACAGAAGGGCAGGGG + Intergenic
987544177 5:19290886-19290908 TTCACATGACAGAAAGGACAAGG + Intergenic
987571062 5:19659709-19659731 CTCACATGGCAGAAGGCAGAAGG - Intronic
987700352 5:21390173-21390195 CTCACATGGCAGAAGGGGCAAGG - Intergenic
987884320 5:23793980-23794002 CACTCATGACAGAAGGTTAAGGG + Intergenic
988442979 5:31253136-31253158 CTCACATGCCAGAAGGGGTCAGG + Intronic
988514849 5:31895375-31895397 CTCACATGACAGAGGAGATAAGG - Intronic
988545764 5:32156096-32156118 CTCACATGGCAGAAGGGCATAGG - Intronic
988752056 5:34197892-34197914 CTCACATGGCAGAAGGGTCAAGG + Intergenic
988794071 5:34636100-34636122 CTTACATGGCAGAAGAGCAGAGG + Intergenic
988858139 5:35249065-35249087 CTCACATGGCAGAAGGAGCAAGG + Intergenic
989055452 5:37361961-37361983 CTCACATGGCAGAGGGGTAGGGG - Intronic
989340557 5:40369438-40369460 CTCACATGAAAGAAGGTGGAAGG + Intergenic
989703439 5:44298317-44298339 CTCAGATGACAGAAGGGAGGAGG - Intergenic
990500884 5:56396275-56396297 CTCACATGTCAGAAGGGGCCAGG + Intergenic
990532043 5:56683814-56683836 TTCACATGGCAGAAGGGGCAAGG - Intergenic
991190621 5:63868764-63868786 CTCACATAACAGAAGGGTAAAGG - Intergenic
991194478 5:63916668-63916690 CTCACATGGCAGAAGGTGAAAGG - Intergenic
991221526 5:64224900-64224922 CTCACATGGCAGAAGGTGGAAGG - Intronic
991357517 5:65784534-65784556 CTCACATGGCAGAAGGGGGAAGG + Intronic
991558252 5:67920842-67920864 CTCACATGGTGGAAGGGTAAAGG - Intergenic
991582814 5:68174466-68174488 CTCACATGGTGGAAGGGCAAGGG + Intergenic
991739821 5:69658708-69658730 CTCACATGGCAGAAGGGGCAAGG + Intergenic
991757678 5:69894469-69894491 CTCACATGGCAGAAGGGGCAAGG - Intergenic
991791396 5:70238449-70238471 CTCACATGGCAGAAGGGGCAAGG + Intergenic
991819284 5:70534833-70534855 CTCACATGGCAGAAGGGGCAAGG + Intergenic
991837081 5:70770351-70770373 CTCACATGGCAGAAGGGGCAAGG - Intergenic
991883845 5:71238791-71238813 CTCACATGGCAGAAGGGGCAAGG + Intergenic
992157934 5:73973074-73973096 CTCACATGGCAGAAGGGGCAAGG + Intergenic
992476278 5:77104502-77104524 CTCACATGGCAGAAGGCAGAAGG - Intergenic
992485924 5:77195200-77195222 CTCACATGGCAGAAGGCAGAAGG + Intergenic
992641842 5:78774465-78774487 CTCCCATGGCACCAGGGCAAAGG + Intergenic
993023364 5:82618485-82618507 CTCACATGGCAGAAGGTTGAAGG + Intergenic
993701418 5:91123429-91123451 CTCACATGGCAGAAGAGCAAAGG + Intronic
993748291 5:91630239-91630261 CTCACATGGCAGAGGGTGAAAGG - Intergenic
993752621 5:91689828-91689850 CTTACATGGCAGAAGGTCAAAGG + Intergenic
994015748 5:94962988-94963010 CTCACATGGCAAAAGGTGAAAGG + Intronic
994260713 5:97655421-97655443 CTCACGTGGCAGAAGGGACAAGG - Intergenic
994690295 5:103010457-103010479 CTGAGAAGACAGAAGGGCCATGG - Intronic
994699310 5:103113408-103113430 TTCACATGAGGGAAGGGGAAAGG + Intronic
994913401 5:105943000-105943022 ATCACATGACTGAAGGTTAAAGG - Intergenic
995135393 5:108674675-108674697 CCCACATGGCAGAGAGGCAAGGG + Intergenic
995143419 5:108759656-108759678 CTCACATGGCAGAAAGCCGAAGG + Intronic
995205099 5:109470537-109470559 CACTCATGGCAGAAGGGAAAGGG - Intergenic
995484025 5:112620786-112620808 CACTCATGACAGAAGGGGAGAGG + Intergenic
995593058 5:113719787-113719809 CTCACATGGCAGAAGGTAAAAGG - Intergenic
995755486 5:115499197-115499219 CTCACATGGCAGAAGGGGTGAGG + Intergenic
996146175 5:119979833-119979855 GACACATGAGAGCAGGGCAAAGG + Intergenic
996182191 5:120432577-120432599 CTCACATGGCAGAAGGTGGAAGG - Intergenic
996192947 5:120567737-120567759 CACTTATGGCAGAAGGGCAAAGG - Intronic
996590404 5:125140460-125140482 CTCACATGACTGAAGGGCAAGGG + Intergenic
996643693 5:125790215-125790237 CTCACATGGCTGAAGGAGAAGGG - Intergenic
996999393 5:129741213-129741235 CTGACATGGCAGAAGGGGTAAGG + Intergenic
997023131 5:130025697-130025719 CTCCCATAGCAGAAGGGCCAGGG + Intronic
997046833 5:130329265-130329287 CAATCATGGCAGAAGGGCAAAGG - Intergenic
997110117 5:131065640-131065662 CAATCATGACAGAAGGGGAAGGG - Intergenic
997559956 5:134837636-134837658 CTCACATGGCAGAAGGGGCAAGG - Intronic
997579952 5:135010914-135010936 CTCATGTGACAGATGGGAAAGGG - Intronic
997909389 5:137854963-137854985 CTCACATGGTAGAAGGGGCAAGG - Intergenic
998163560 5:139827458-139827480 CACATATGACAGAAGCACAAAGG + Intronic
998766269 5:145491292-145491314 CTCACATGGTGGAAGGGCCAAGG + Intronic
999499613 5:152133582-152133604 CACACATGACAGAAGGAAAAAGG + Intergenic
1000013603 5:157257439-157257461 CTCATATGGCAGAAGGGTAAAGG - Intergenic
1000423410 5:161062620-161062642 CTCACATGGCGGAAGGGGCAAGG - Intergenic
1000424974 5:161079913-161079935 CAATCATGACAGAAGGGGAATGG - Intergenic
1000856350 5:166403276-166403298 CTCTCATGGCAGAAGGCAAAGGG + Intergenic
1001547204 5:172577882-172577904 CTCACTTTACAGATGGGAAACGG + Intergenic
1001668669 5:173455311-173455333 CTCACATGACTGATGGTCACTGG - Intergenic
1001814268 5:174654921-174654943 CTCACATGGCAGAAGGCGGAAGG - Intergenic
1001947233 5:175789838-175789860 CTCACATGGCAGAAGGTGGAAGG - Intergenic
1002592136 5:180298174-180298196 CTCACATGGCAGAAGGGACAAGG - Intergenic
1002737275 5:181404383-181404405 CACTCATGGCAGAAGGGGAAGGG + Intergenic
1003118588 6:3300476-3300498 CTCACATGAGGGAAGGGGCAAGG - Intronic
1003183465 6:3811133-3811155 CTCACATGGGAGAAGGTGAAAGG - Intergenic
1003380775 6:5622637-5622659 CTCACATGGCGGAGGGACAAAGG - Intronic
1003682709 6:8271773-8271795 CACTCATGGCAGAAGGGGAAGGG + Intergenic
1003878913 6:10462777-10462799 CTTACATGGCAGAAGAGCCAAGG + Intergenic
1004246816 6:13985899-13985921 CACTCATGACAGAAGGCAAAGGG - Intergenic
1005214518 6:23509605-23509627 CTCACATGGAGGAAGGGAAAGGG - Intergenic
1005217131 6:23543543-23543565 CAATCATGGCAGAAGGGCAAAGG - Intergenic
1005249864 6:23932363-23932385 CTGATATCACAGAAGTGCAAAGG + Intergenic
1005376783 6:25190784-25190806 CTCACATGGCAGAAGAGCATAGG - Intergenic
1005550217 6:26904606-26904628 CTCACATGGCAGAAGGGGCAAGG + Intergenic
1006761252 6:36463650-36463672 CTCACATGATGGAAGGAGAAGGG - Intronic
1006826250 6:36938464-36938486 CTCACATTGCAGAAGGGGAGTGG + Intergenic
1007076444 6:39070034-39070056 CTCACATCACAGAAGGCAAAAGG + Intronic
1007159997 6:39782595-39782617 TTCACATGGCAGAAGGTGAAGGG + Intergenic
1007238582 6:40408971-40408993 CTCACATGGCAGCAGTGGAAGGG + Intronic
1007295913 6:40820388-40820410 CTCACATGGCAGAAGGGGCAAGG - Intergenic
1007718345 6:43870193-43870215 CTCCCAGGCCTGAAGGGCAAAGG + Intergenic
1007928354 6:45668314-45668336 CTCACATGGCAGAAGGTGAAAGG + Intergenic
1008065417 6:47042527-47042549 CTGAAATCACAGAAGGGAAATGG + Intergenic
1008135509 6:47771603-47771625 CACACATGGCAGAAGGCAAAGGG - Intergenic
1008158507 6:48047728-48047750 CTCACATGATAGAAGGGGCAAGG - Intronic
1008523923 6:52388577-52388599 CTCACATGGCAGAAGAGGCAAGG - Intronic
1008614808 6:53216465-53216487 CTCACATGGCAGAAGGGGCAGGG - Intergenic
1008668236 6:53738759-53738781 CTCACATGGTGGAAGGGGAAAGG + Intergenic
1009026190 6:58003080-58003102 CTCACAAGGCAGAAGGGCAATGG - Intergenic
1009201739 6:60754553-60754575 CTCACAAGGCAGAAGGGCAAGGG - Intergenic
1009389226 6:63125779-63125801 CAATCATGACAGAAGGGGAAGGG - Intergenic
1009435795 6:63616981-63617003 GACAGGTGACAGAAGGGCAAAGG + Intergenic
1009845168 6:69125490-69125512 TTCACATGGCAGAAGGGGCAAGG - Intronic
1009897659 6:69773255-69773277 ATCCCATGGCAGAAGGGCAATGG - Intronic
1010247451 6:73674777-73674799 TTCACATGATAGAAGGGGCAAGG - Intergenic
1010623545 6:78106925-78106947 CTCATGTGGCAGAAGGCCAAAGG - Intergenic
1010628309 6:78166588-78166610 CTCACATGAAAGAAGGGATAAGG + Intergenic
1010731026 6:79391512-79391534 CTCACATGATGGAAGGGGCAAGG + Intergenic
1011072736 6:83403441-83403463 CTCACATGAGGGAAAGGGAAAGG + Intronic
1011220824 6:85052880-85052902 CACTCATGACAGAGGGGGAAGGG + Intergenic
1011574916 6:88786940-88786962 CCCACATGGCAGAAGGGGCAAGG - Intronic
1012191064 6:96280380-96280402 CAATCATGGCAGAAGGGCAAAGG - Intergenic
1012599618 6:101079063-101079085 CTCACATGGCAGAAGGCAGAAGG - Intergenic
1013227239 6:108128874-108128896 CTCTCATGGCAGAAGGTGAAAGG - Intronic
1013383117 6:109597139-109597161 CTCACATGACTTCAGGTCAAAGG + Intronic
1013688307 6:112610754-112610776 CTCACATGGCAGAAGGTGGAAGG + Intergenic
1013786712 6:113789448-113789470 CTCACATGGTAGAAGGGGCAAGG + Intergenic
1014068382 6:117152805-117152827 CAATCATGGCAGAAGGGCAAAGG + Intergenic
1014075082 6:117226304-117226326 CCCACATGGCAGAAGAGCAGAGG + Intergenic
1014508401 6:122289013-122289035 CTCACATGTCAGAATTGTAAAGG + Intergenic
1014525480 6:122496218-122496240 CTGAAGTGACAGAAGTGCAAAGG + Intronic
1014574605 6:123054748-123054770 CTGAAATGAAAGAAGAGCAAAGG + Intronic
1014808942 6:125863799-125863821 CTCACATGGTAGAAGGGTGAGGG + Intronic
1014918373 6:127182005-127182027 CACTCATGACAGAAGGAAAAGGG + Intronic
1015169889 6:130240761-130240783 CTCACATGGTGGAAGGGCAAGGG - Intronic
1015187093 6:130430219-130430241 CTCACATGGTAGAAGGGGGAAGG + Intronic
1015971755 6:138749359-138749381 CTCATATGACAGAAGGAACAAGG - Intergenic
1015977028 6:138800969-138800991 CTCACATGGCAGAAGGTGGAAGG + Intronic
1016026686 6:139294572-139294594 CTCACATGGCAGAGGGGTAAGGG - Intergenic
1016029403 6:139322312-139322334 CTCACATGGCAGAAGGTAGAAGG + Intergenic
1016587536 6:145706991-145707013 CTCACATGGCAGAGGGGAAAAGG - Intronic
1016753454 6:147657732-147657754 CTCACATGGTAGAAGGGGCATGG + Intronic
1016876572 6:148871187-148871209 CTCACATGACAGAAAGAGAGGGG - Intronic
1016904640 6:149136765-149136787 CTCACATGGCAGAAGGGGAAGGG + Intergenic
1017155044 6:151315341-151315363 CTCATGTGGCAGAAGGGCAGAGG + Intronic
1017405247 6:154112400-154112422 ATCACAAGACATAAAGGCAAAGG - Intronic
1017874545 6:158514030-158514052 TTCCCAGGACAGAAGGGAAATGG - Intergenic
1017985777 6:159442060-159442082 GTCACATGTCAAAAGGGCATCGG + Intergenic
1018107130 6:160499765-160499787 TTCACAAGAGAGTAGGGCAAAGG - Intergenic
1018127018 6:160691637-160691659 CTCACATGGCAGAAGGCAGAGGG - Intergenic
1018149540 6:160925443-160925465 CTCACATGGCAGAAGGCAGAGGG + Intergenic
1018520573 6:164645655-164645677 CTCACATGGTGGAAGGGCCAAGG - Intergenic
1018615466 6:165682569-165682591 CTCACATGGCAGAGAGGCAAAGG - Intronic
1018750557 6:166800521-166800543 CTCACATGACAGGAGGTGGAAGG - Intronic
1019242370 6:170679939-170679961 CACTCATGGCAGAAGGGGAAGGG + Intergenic
1019602218 7:1890402-1890424 ATCACATGGCAGGAGGCCAAAGG - Intronic
1019962037 7:4468588-4468610 CAATCATGACAGAAGGGTAAGGG + Intergenic
1020570267 7:9851418-9851440 TTCAAATGACAGAAGGGGTAGGG - Intergenic
1021087577 7:16440780-16440802 CTATCATGGCAGAAGGCCAAAGG - Intergenic
1021260514 7:18451162-18451184 GTCACATGATGAAAGGGCAAAGG - Intronic
1021367734 7:19801660-19801682 CTCACATGGCAGAAGGGGCAAGG - Intergenic
1021976935 7:26020216-26020238 CTCACATGGCAGAAGGTAGAAGG - Intergenic
1022610113 7:31862583-31862605 CTCACATGGCAGAAGAGGGAAGG + Intronic
1022748040 7:33192808-33192830 CTCACATGGCAGAAGAACAGAGG + Intronic
1022897848 7:34770898-34770920 CTCACGTGGCAGAAGGCCAAAGG + Intronic
1023641052 7:42258706-42258728 CTCACATGACAGAATGGGTGAGG + Intergenic
1023988875 7:45115990-45116012 CTCACATGGCAGAAGGAGAAAGG - Intergenic
1024964647 7:55013193-55013215 CTCACATGGCAGAAGGACCAAGG - Intergenic
1025285530 7:57657543-57657565 CTCACATGGCAGAAGGTGGAAGG + Intergenic
1027154864 7:75759708-75759730 CTCACATGGCAGAAGGCAGAAGG - Intergenic
1027950495 7:84808955-84808977 CTCACATGGCAGAAGGGACCAGG + Intergenic
1028210220 7:88064661-88064683 CAGACAGGATAGAAGGGCAAAGG + Intronic
1028789819 7:94841421-94841443 ATCACATGACAGAAGGCAAGAGG + Intergenic
1029029698 7:97454587-97454609 CTCATATCACAGAAGGGGCAAGG - Intergenic
1029209899 7:98898630-98898652 CTCAAAATACAGATGGGCAATGG - Intronic
1029502370 7:100939881-100939903 TTCACATGGTAGAAGGGCAAGGG - Intergenic
1030203449 7:106929063-106929085 CTCACATGGCAGAAGGGACAAGG + Intergenic
1030206300 7:106955368-106955390 CTCATATGACAGAAGGGGCAAGG - Intergenic
1030874802 7:114800551-114800573 CTCACATGGCAGAAGGAGCAAGG + Intergenic
1031185942 7:118480519-118480541 CTCACATGACAGAAGAAAGAAGG + Intergenic
1031363451 7:120874942-120874964 CAATCATGGCAGAAGGGCAAAGG + Intergenic
1031555885 7:123175554-123175576 CTCACATGATGGAAGGGGCAAGG - Intronic
1031650399 7:124282099-124282121 CTCACATGGCAGAAGTGCAGAGG - Intergenic
1031788450 7:126065975-126065997 CTCCCATGACAGATGGGGATGGG + Intergenic
1032197267 7:129796583-129796605 CTCCCAGGACAGAAGGGACAGGG - Intergenic
1032716414 7:134512727-134512749 TTCACATGACAGCTGAGCAAGGG - Intergenic
1033980217 7:147155214-147155236 CTCACATGGCAGAAGGCTCAAGG - Intronic
1034278741 7:149837292-149837314 CTCACATGGCAGAAGGCAGAGGG + Intergenic
1034688472 7:152994943-152994965 CTCACATGATGGAAGGGATATGG - Intergenic
1034922211 7:155092756-155092778 CTCACATGGCAGAAGGCAAAGGG - Intergenic
1035505747 8:128215-128237 CACTCATGGCAGAAGGGGAAGGG - Intergenic
1035864537 8:3068639-3068661 CAAACATGGCAGAAGGCCAAGGG + Intronic
1035897735 8:3422904-3422926 CTCACATGGCAGAAGGAAAAGGG + Intronic
1035957854 8:4102223-4102245 AAAACATTACAGAAGGGCAAGGG - Intronic
1036026967 8:4919838-4919860 TTCACATGAAAGAAGGTGAAAGG - Intronic
1036161797 8:6395879-6395901 CTCACATGGCAGAAGGGACAAGG + Intergenic
1036180665 8:6581879-6581901 CTCACATGGCAGAAGGGGTGAGG + Intronic
1036591233 8:10170360-10170382 CTCACATCACAGAAGGCGCAAGG - Intronic
1036659014 8:10695769-10695791 CTCACATGAAGGAAGAGAAAAGG + Intronic
1037490371 8:19391813-19391835 CTAACAAGACAAAAGGGCTATGG + Intronic
1037687716 8:21157896-21157918 CCCACATGGCAGCAGGGTAAGGG - Intergenic
1037728204 8:21501474-21501496 CTCACATGGCAGAAGGCAGAGGG - Intergenic
1038174375 8:25166746-25166768 CTCACATGGCAGAAAGGCCCAGG - Intergenic
1038475682 8:27865327-27865349 CTCACATGACAGAAGAGGGGAGG + Intergenic
1038494913 8:27994560-27994582 CTCACATGGCAGAAAGGCAGAGG - Intergenic
1038819645 8:30940711-30940733 ATCACATGACAGAAGGTCAAAGG + Intergenic
1038926872 8:32150502-32150524 CTCACATGGCAGAAGCAGAAGGG - Intronic
1038984426 8:32793110-32793132 CTCAAATGGCAGAAGGGCCAAGG + Intergenic
1039307177 8:36275261-36275283 CTCACATGGTAGACGGGCAAGGG + Intergenic
1039377060 8:37045160-37045182 CACTCATGGCAGAAGGGGAAGGG + Intergenic
1039567625 8:38562812-38562834 CTCATATAACAGAAAGGGAAGGG - Intergenic
1039582072 8:38675108-38675130 CTAACATGGCTGAAGGCCAAAGG - Intergenic
1040539773 8:48342142-48342164 CTCACTTGGTAGAAGGGGAAAGG - Intergenic
1040673242 8:49717616-49717638 CTCACATGGCAGATGGGGCAAGG - Intergenic
1041136236 8:54762170-54762192 TGCACATCACAGAAGGGAAAAGG + Intergenic
1041422893 8:57689353-57689375 CTCACATGGCAGAAGGAGCAAGG + Intergenic
1041716935 8:60941022-60941044 CTCACATGGAAGAAGGGCCATGG + Intergenic
1041773296 8:61496232-61496254 GTCATATGACAGAAGGTAAATGG + Intronic
1041871155 8:62635643-62635665 TTCACATGACAGGAGGGGCAAGG - Intronic
1042474687 8:69233818-69233840 CTCACATGACAGAGGGCAGAAGG + Intergenic
1042739765 8:72030206-72030228 CCCATATGGCAGAAAGGCAAAGG + Intronic
1042953154 8:74221628-74221650 CTCCAATGACAGGAGGGCATAGG + Intergenic
1043143631 8:76623162-76623184 TTCACATGACAGAAGGCAAAAGG - Intergenic
1043928317 8:86062647-86062669 CGATCATGACAGAAGGCCAAGGG - Intronic
1044348161 8:91130886-91130908 CTCACATGGTAGAAGGGGCAAGG + Intronic
1044537486 8:93374207-93374229 CTCACATGGCAGAAGGGCTGAGG + Intergenic
1045090190 8:98733993-98734015 CAATCATGACGGAAGGGCAAAGG + Intronic
1045320362 8:101077569-101077591 CTCACATGACTGAGGGGCAGTGG - Intergenic
1045859772 8:106803102-106803124 CTCACATGGTAGAAGGGGCAAGG + Intergenic
1045998776 8:108395218-108395240 CTTACATGGCAGAAGGTGAAGGG + Intronic
1046074182 8:109297530-109297552 CTCACATGACAGAAGGCGGAGGG - Intronic
1046359912 8:113137649-113137671 TTCACATGACAGAAGGCAGAAGG + Intronic
1046519508 8:115306348-115306370 CTTACATGGCAGAAGAGCAGAGG - Intergenic
1046913262 8:119652182-119652204 CTCACATTATGGAAGGGTAAGGG + Intronic
1046953378 8:120039185-120039207 CTCACATGGTAGAAGGGGCAAGG - Intronic
1047014641 8:120710653-120710675 CTCACATGGCAGAAGGCAGAAGG - Intronic
1047145352 8:122192667-122192689 CTCACATGATAGAAGGGTGAGGG + Intergenic
1047452839 8:124981761-124981783 ATAACATGGCAGAAGGTCAAGGG + Intergenic
1048066870 8:130979156-130979178 ATCCCATGTGAGAAGGGCAAAGG + Intronic
1048794682 8:138138780-138138802 CTCACGTGCCATATGGGCAATGG + Intronic
1048922360 8:139242846-139242868 CACTCATGACAGAAGGTCAATGG + Intergenic
1049291220 8:141803345-141803367 CTCACATGATGGAAGGGGTAAGG + Intergenic
1049390874 8:142370071-142370093 CTCACGTGGCAGAAGGGTGAAGG - Intronic
1049653045 8:143784384-143784406 CAATCATGACAGAAGGCCAAGGG - Intergenic
1050093659 9:2041430-2041452 CTCACATGGCAGAAGAGACAAGG + Intronic
1050103939 9:2146194-2146216 CTCACATGGTAGAAGGGACATGG + Intronic
1050759681 9:9052159-9052181 CCCACATGGCAGAAGGGGCAAGG + Intronic
1050990954 9:12151310-12151332 TTCACATGGAAGAAGGGAAAAGG + Intergenic
1051157904 9:14171258-14171280 TTCACATGGAAGAAGGGGAAAGG - Intronic
1051371121 9:16360074-16360096 CTCACATGGCAGAAGTGGTAAGG + Intergenic
1051605692 9:18916047-18916069 CTCACATGACAGAAGGTAGAAGG - Intergenic
1051662681 9:19440494-19440516 CTCACATGGTAGAAGGGCCAAGG - Intronic
1052125419 9:24768740-24768762 CACTCATGACAGAAGGAGAAAGG + Intergenic
1052234310 9:26191619-26191641 CTCATATGACAAAAGGGCCAGGG + Intergenic
1052603429 9:30670090-30670112 CTCACATGACAGAAGAAATAAGG - Intergenic
1053375312 9:37601043-37601065 CTCACATGACAGAAGGTGGGAGG + Intronic
1053504014 9:38625159-38625181 CTCACATAACAGAAGGGGTGAGG - Intergenic
1053646544 9:40123224-40123246 CTCACATGACAGAAGAGATGAGG + Intergenic
1053759170 9:41340327-41340349 CTCACATGACAGAAGAGATGAGG - Intergenic
1053793212 9:41701451-41701473 CTCACATGGCAGAAGGCGGAAGG + Intergenic
1054151965 9:61613388-61613410 CTCACATGGCAGAAGGCGGAAGG - Intergenic
1054181621 9:61913463-61913485 CTCACATGGCAGAAGGCGGAAGG + Intergenic
1054327556 9:63721126-63721148 CTCACATGACAGAAGAGATGAGG + Intergenic
1054471737 9:65544518-65544540 CTCACATGGCAGAAGGCGGAAGG - Intergenic
1054538026 9:66252749-66252771 CTCACATGACAGAAGAGATGAGG - Intergenic
1054869431 9:70035801-70035823 CTCACATGGCAGAAGAGGCAAGG - Intergenic
1056120518 9:83483268-83483290 CAGTCATGGCAGAAGGGCAAAGG - Intronic
1056423476 9:86453174-86453196 CTCACATGGTAGAAGGGGCAAGG + Intergenic
1056594749 9:87997780-87997802 CTCACATGGCAGAAGGCAGAAGG - Intergenic
1056987127 9:91373664-91373686 CTCACATGATAGAAGGGGCAGGG + Intergenic
1057035108 9:91806324-91806346 CTCACATGGCAGAAGGAGAAAGG + Intronic
1057330761 9:94112809-94112831 CTCACATGACAGAAAGTGGAAGG - Intergenic
1058293897 9:103280498-103280520 CTCACATGGCAGAAGGTGGAAGG - Intergenic
1058560336 9:106221766-106221788 CTCACTTGGCAGAAGGGGAGTGG - Intergenic
1058721914 9:107772229-107772251 CAATCATGGCAGAAGGGCAAAGG + Intergenic
1059110606 9:111555612-111555634 CAGTCATGGCAGAAGGGCAAAGG + Intronic
1059110782 9:111556796-111556818 CAATCATGGCAGAAGGGCAAAGG - Intronic
1059133912 9:111784814-111784836 CTCACATGGCAGAAAGGTCAAGG + Intronic
1059489470 9:114655246-114655268 CTCACATAGCAGAAGGGGCAAGG - Intergenic
1059535221 9:115074368-115074390 CTCACAGGACAGAAGGGGCAAGG - Intronic
1060011600 9:120048329-120048351 CTCACATGGCAGAAGGTGGAAGG - Intergenic
1062057314 9:134475317-134475339 CTCTCAAGACAGCAGGGCAGCGG - Intergenic
1202794331 9_KI270719v1_random:106659-106681 CTCACATGACAGAAGGGATGAGG + Intergenic
1203602561 Un_KI270748v1:29163-29185 CACTCATGGCAGAAGGGGAAGGG + Intergenic
1185828584 X:3276623-3276645 CTCACATGGTAGAAGGGGCAAGG - Intronic
1185913975 X:4014373-4014395 CACACATGGCAGAAGGGGAGGGG - Intergenic
1186170551 X:6872016-6872038 CTCACATGGTGGAAGGGGAAAGG + Intergenic
1186395587 X:9205703-9205725 CTCACAGGGTGGAAGGGCAAGGG + Intergenic
1186482921 X:9909945-9909967 CTCACATGATGGAAGGGGAGAGG + Intronic
1186987566 X:15033266-15033288 CTCACATGGCAGAAGCGTAAGGG - Intergenic
1187316710 X:18202515-18202537 CTCACATGGCAGAAGGTAGAAGG - Intronic
1187426228 X:19179860-19179882 CTCACATGGCATAAGGGGCAGGG - Intergenic
1187569716 X:20488591-20488613 CTCACACGATGGAAGGGCCAAGG - Intergenic
1187692987 X:21890212-21890234 CTCACATGAAAAATGGGCAAAGG - Intergenic
1187802787 X:23082667-23082689 CTCACATGGCAAAAGGGGTAAGG + Intergenic
1187974577 X:24692430-24692452 CTCACATGGAAGAAGGGGCAAGG + Intergenic
1188293515 X:28417571-28417593 CTCACATGGCAGAAGGGGCGAGG + Intergenic
1188459122 X:30402678-30402700 TTGACTTGACAGAATGGCAATGG + Intergenic
1188746445 X:33850640-33850662 CTCACATGTCAGAAGGGGCAAGG + Intergenic
1188827686 X:34856367-34856389 CTCACATGGCAGAAGGTGAAAGG + Intergenic
1188856098 X:35197863-35197885 CAATCATGGCAGAAGGGCAAAGG - Intergenic
1188911192 X:35849543-35849565 CTCACATGGCAAAAGGTAAAAGG - Intergenic
1188956342 X:36438694-36438716 CTCACATGCCAGAAGGGAATGGG + Intergenic
1189025566 X:37390143-37390165 CTCACATGGCAAAAGGGGATGGG + Intronic
1189385945 X:40536993-40537015 CTCACATGGCAGAAAGGGCAAGG - Intergenic
1189569757 X:42283933-42283955 CTCACATGGCAGAAGGAGCAAGG - Intergenic
1189668678 X:43384630-43384652 CTCACATGGCACAAGGGGCAAGG - Intergenic
1189916163 X:45857749-45857771 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1190164025 X:48056706-48056728 CTCACATGGCAGAAGGCAGAAGG - Intronic
1192072376 X:67954613-67954635 CTCATATGACAGATAGGGAAGGG + Intergenic
1192816557 X:74599603-74599625 CTCACATGGCAAAAGGACAAAGG - Intronic
1193265777 X:79467598-79467620 CTCACACCACAGAAAGACAAAGG + Intergenic
1193668455 X:84353424-84353446 CTCTCATGGCAGAAGGGGCAAGG - Intronic
1193698097 X:84734327-84734349 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1193761779 X:85476022-85476044 ATAACATGGCAGAAGGTCAAAGG + Intergenic
1193903420 X:87212770-87212792 CTCACATGGCAGAAGGCAGAAGG + Intergenic
1193960523 X:87919695-87919717 CACTCATGGCAGAAGGGCAATGG + Intergenic
1194463844 X:94207050-94207072 CTAACATGGCAGAAGGCAAAAGG - Intergenic
1194592872 X:95821528-95821550 CTCACATGACAAAAGGAAGAAGG + Intergenic
1194764392 X:97832540-97832562 TTCACATGGCAGAAGGACTAAGG + Intergenic
1194812619 X:98404568-98404590 CTCACATGGCAGAAGGGACAAGG + Intergenic
1195163959 X:102198905-102198927 CTCACATGGAGGAAGGGGAAAGG - Intergenic
1195194902 X:102488190-102488212 CTCACATGGAGGAAGGGGAAAGG + Intergenic
1195430320 X:104781978-104782000 CTCACATGGCAGAAGGGGCAAGG - Intronic
1195627379 X:107018387-107018409 CTCACATGGTAGAAGGACAAAGG + Intergenic
1195808234 X:108799673-108799695 CTCACATGGCAGAAGGCAGAAGG - Intergenic
1196058221 X:111378932-111378954 CTCACATGGCAGAAGGCAGAAGG - Intronic
1196109147 X:111927354-111927376 GTCACATGACAATAAGGCAAGGG + Intronic
1196321373 X:114344385-114344407 CTCACATGGCAGAAGGTTGAAGG - Intergenic
1196327155 X:114420028-114420050 CTCACATGGTAGAAGGGCAAAGG - Intergenic
1196538182 X:116872470-116872492 CTCACATGACAGAAGGTGGATGG + Intergenic
1196808396 X:119608808-119608830 CGCACATGGCAGAAGGCAAAGGG - Intergenic
1197482128 X:127000290-127000312 CGCACATGGCAGAAGGTAAAAGG + Intergenic
1197883063 X:131189634-131189656 CTAACATGGCAGAAGGGCAAAGG - Intergenic
1199187706 X:144936738-144936760 TTCACATATCAGAAGGGCCAAGG - Intergenic
1199234983 X:145481233-145481255 CCCACATGGCAGAAGGGGCAGGG + Intergenic
1199279838 X:145988414-145988436 TTCACATGGCAGAAGGGACAAGG - Intergenic
1199535872 X:148902578-148902600 CTCCCATGTCAGAAGAACAAAGG - Intronic
1199736062 X:150687759-150687781 CTCACATGGCAGAAGGTAAAAGG - Intergenic
1199765756 X:150940713-150940735 GTCACATTACAGAAGGGGTAAGG - Intergenic
1199949423 X:152695640-152695662 CTCACATGGAAGAAGGGGCAAGG - Intergenic
1199951597 X:152711301-152711323 CTCACATGCAAGAAGGGATAAGG - Intergenic
1199958086 X:152757147-152757169 CTCACATGCAAGAAGGGATAAGG + Intergenic
1199960253 X:152772809-152772831 CTCACATGGAAGAAGGGGCAAGG + Intergenic
1200374418 X:155765002-155765024 CTCACATGATGGAAGTGCCAAGG + Intergenic
1201148987 Y:11084767-11084789 CTCACATGACAGAAGGGATGAGG - Intergenic
1201446686 Y:14064600-14064622 CTCACATGGTAGAAGGGGAAAGG - Intergenic
1201637365 Y:16139084-16139106 CTCACATGATGGAAGGGACAAGG + Intergenic
1201676098 Y:16586103-16586125 CTCACATGGCAGAAGGGGCGAGG - Intergenic
1202231412 Y:22662949-22662971 CACTCATGACAGAAGGTAAAAGG - Intergenic
1202311746 Y:23533216-23533238 CACTCATGACAGAAGGTAAAAGG + Intergenic
1202384647 Y:24314261-24314283 CACTCATGGCAGAAGGGGAAGGG + Intergenic
1202486137 Y:25355861-25355883 CACTCATGGCAGAAGGGGAAGGG - Intergenic
1202559056 Y:26137378-26137400 CACTCATGACAGAAGGTAAAAGG - Intergenic