ID: 969330340

View in Genome Browser
Species Human (GRCh38)
Location 4:6470988-6471010
Sequence GCGGAGCCGGAGCCCCGCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 269}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969330340_969330351 17 Left 969330340 4:6470988-6471010 CCTCCGCGGGGCTCCGGCTCCGC 0: 1
1: 0
2: 4
3: 31
4: 269
Right 969330351 4:6471028-6471050 AGAGCCAGGCTTCGAGGAGGCGG 0: 1
1: 0
2: 0
3: 26
4: 291
969330340_969330353 30 Left 969330340 4:6470988-6471010 CCTCCGCGGGGCTCCGGCTCCGC 0: 1
1: 0
2: 4
3: 31
4: 269
Right 969330353 4:6471041-6471063 GAGGAGGCGGACCCAGCCGCAGG No data
969330340_969330346 3 Left 969330340 4:6470988-6471010 CCTCCGCGGGGCTCCGGCTCCGC 0: 1
1: 0
2: 4
3: 31
4: 269
Right 969330346 4:6471014-6471036 GCCTCATTTCCGGCAGAGCCAGG 0: 1
1: 0
2: 0
3: 13
4: 131
969330340_969330344 -7 Left 969330340 4:6470988-6471010 CCTCCGCGGGGCTCCGGCTCCGC 0: 1
1: 0
2: 4
3: 31
4: 269
Right 969330344 4:6471004-6471026 GCTCCGCTCGGCCTCATTTCCGG 0: 1
1: 0
2: 0
3: 8
4: 69
969330340_969330350 14 Left 969330340 4:6470988-6471010 CCTCCGCGGGGCTCCGGCTCCGC 0: 1
1: 0
2: 4
3: 31
4: 269
Right 969330350 4:6471025-6471047 GGCAGAGCCAGGCTTCGAGGAGG 0: 1
1: 1
2: 3
3: 31
4: 289
969330340_969330348 11 Left 969330340 4:6470988-6471010 CCTCCGCGGGGCTCCGGCTCCGC 0: 1
1: 0
2: 4
3: 31
4: 269
Right 969330348 4:6471022-6471044 TCCGGCAGAGCCAGGCTTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969330340 Original CRISPR GCGGAGCCGGAGCCCCGCGG AGG (reversed) Intronic
900786782 1:4654702-4654724 GCGGCGGCGGCGCCGCGCGGAGG - Intergenic
902044270 1:13513546-13513568 GCAGAGCCCGAGCGCCGCGGCGG + Exonic
902404255 1:16174377-16174399 GGGGAGACGGAGCCCCGAGCAGG - Intergenic
903385258 1:22921949-22921971 GCTGAGCAGGAGGCCCGCGACGG + Intergenic
904050164 1:27634152-27634174 GCCCACCCGGAGCCCCGCGGCGG + Intronic
904500237 1:30908865-30908887 GAGGGCGCGGAGCCCCGCGGGGG - Intergenic
904542095 1:31239938-31239960 GCGGCGGCGGAGCCACGTGGTGG - Intergenic
905617111 1:39408932-39408954 GCGGGGGCGGGGCCCGGCGGGGG - Intronic
906640481 1:47438097-47438119 GCGGAGCCGGAGAGTGGCGGCGG + Exonic
907069206 1:51519006-51519028 CCGGAGCCGGAGCCCCCCTGCGG - Intronic
907689246 1:56645608-56645630 GCGGAGCTGGGGCCCCGGGAGGG + Intronic
911440486 1:97920707-97920729 GCGGAGCCACAGGCCCGCGTGGG - Intronic
912429085 1:109619807-109619829 GCGGAGGCGGGGCCAGGCGGGGG + Intronic
913191720 1:116418655-116418677 GCGGAGGCGGCGCTTCGCGGCGG + Intergenic
913960398 1:143334511-143334533 CCGGAGCCCGAGCACAGCGGTGG - Intergenic
914054754 1:144160084-144160106 CCGGAGCCCGAGCACAGCGGTGG - Intergenic
914124392 1:144806277-144806299 CCGGAGCCCGAGCACAGCGGTGG + Intergenic
914803102 1:150974578-150974600 CCGGCGCCCGAGCCCCGCGCGGG - Intronic
914824434 1:151131480-151131502 GCGGAGCTTGAGCGCGGCGGCGG + Intergenic
915517288 1:156420915-156420937 GCGGAGCCCGAGCCTGGCGCGGG + Intronic
915574786 1:156768151-156768173 GCGGTGCCGGTCCCCCGCTGGGG + Exonic
919888860 1:201955466-201955488 GCGGAGCCTGACCCCAGAGGCGG - Intergenic
1065025076 10:21534051-21534073 GGGGAGCCGGCGGCGCGCGGAGG - Intergenic
1066046907 10:31602918-31602940 GCTGAGCCGGAGGACCCCGGGGG + Intergenic
1066220676 10:33334809-33334831 GCGGAGCTGGCGCCCAGGGGAGG + Exonic
1069619120 10:69825685-69825707 GCCAAGCCGGAGTCCTGCGGTGG + Intronic
1069944856 10:71978819-71978841 GCTGAGCAGGGGCCCCTCGGAGG - Intronic
1070302103 10:75210987-75211009 GCCAAGCCGGAGGCCCGCGCCGG + Intronic
1070304953 10:75234472-75234494 CCGGGGCCGGAGCCCCGGAGGGG + Intronic
1071603167 10:86968817-86968839 GAGGAGCCGGAGCTGCGCTGCGG + Intronic
1076838995 10:133036137-133036159 GGGGAGCCGGACCCCCGGGAGGG - Intergenic
1077095742 11:798319-798341 GGGGAGCCGAAGCCCGGAGGAGG - Exonic
1077100537 11:820381-820403 CCGGAGGAGGAGCCCCGCTGAGG + Intronic
1077171519 11:1168419-1168441 GCGGCACCTCAGCCCCGCGGAGG - Intronic
1078061437 11:8047744-8047766 ACGGAGCCTGAGCCCCAGGGAGG + Intronic
1078474757 11:11621244-11621266 GCGGCCCCAGAGCCCCGCCGTGG + Intronic
1078891376 11:15561207-15561229 GCCGCGCAGGAGCCCGGCGGGGG - Intergenic
1079076714 11:17389115-17389137 GCGGAGCGGGAGCCGCGGCGCGG - Intronic
1080683413 11:34496282-34496304 GGGGAGCCAGAGCCCTGCGGAGG + Intronic
1080802106 11:35618665-35618687 CAGCAGCCAGAGCCCCGCGGTGG - Exonic
1083273014 11:61581346-61581368 GCGGAGCCGGATCCCCTGGCCGG - Intergenic
1083583487 11:63839685-63839707 GCGGAGCCGGAGCCAGGAGCCGG - Intronic
1083678978 11:64342686-64342708 GCGGAGACGGAGCCGCGGGGCGG + Intronic
1083824138 11:65188706-65188728 GCGGCGGGGGAGCACCGCGGGGG + Exonic
1084680068 11:70661910-70661932 GCAGAGCCGGAGCCAGCCGGAGG + Intronic
1085270285 11:75266126-75266148 GTGGAGCCGGAGCCACGTGGAGG + Exonic
1091564634 12:1639470-1639492 GCTGAGCTGGGGCCCAGCGGCGG + Intronic
1092255418 12:6924505-6924527 GCAGAGCGGGAGGCCCGCAGGGG - Exonic
1095752995 12:45730401-45730423 GCGGGGTCTGAGCGCCGCGGCGG + Intronic
1096220988 12:49828115-49828137 TCGCAGCCGGACCCCCGAGGAGG + Intronic
1096250066 12:50025294-50025316 GCTGTCCCGGACCCCCGCGGCGG + Intronic
1097239400 12:57564730-57564752 GAGGAGCAGGAGCCCTGAGGAGG + Intronic
1097267749 12:57755604-57755626 GCCGAGCCGCAACCCCGGGGGGG + Exonic
1099365103 12:81758778-81758800 GTGCAGCTGGAGCCCCGGGGCGG + Intronic
1101640137 12:106581643-106581665 GCAGAGCCGGCGGGCCGCGGCGG - Intronic
1104882769 12:132084128-132084150 GCGGAGCCAGAGGCGCGCGCCGG + Intergenic
1105250729 13:18697217-18697239 GCGGAGGCGGAGGGCCACGGTGG + Intergenic
1106246578 13:27954686-27954708 AAGGAGCCCGGGCCCCGCGGCGG + Intergenic
1111333595 13:86792519-86792541 GCCAAGCCCGAGCCCCGCTGAGG + Intergenic
1113016996 13:105838714-105838736 GGGGAGCCGGAGCCCAGCAAGGG - Intergenic
1113437791 13:110307010-110307032 GCTGAGCCGGGGCCCCATGGTGG + Exonic
1113660720 13:112104974-112104996 GGGGAGCCGGAGCGCAGCGGAGG + Intergenic
1114612487 14:24051972-24051994 GGGGAGCCGGCGCTCCGAGGCGG + Intergenic
1117803044 14:59464681-59464703 GCCGCGCCAGGGCCCCGCGGCGG + Exonic
1119219328 14:72893469-72893491 CCGGAGTTGGAGCACCGCGGGGG - Intronic
1122517614 14:102319775-102319797 GCGGAGCCGGAGGCTGGGGGCGG + Exonic
1122602429 14:102928388-102928410 GCTGAGGCGGCGCCACGCGGGGG - Intronic
1123550455 15:21373870-21373892 GCGCAGCAGGAGCGCCACGGTGG + Intergenic
1124441363 15:29688393-29688415 GAGGAGCTGAAGCCACGCGGGGG + Intergenic
1127071175 15:55289681-55289703 GAGGAGCGGGAGGCGCGCGGCGG - Intronic
1128322468 15:66703175-66703197 GCGCAGCCGGCGCCTCGCTGAGG + Exonic
1129483241 15:75843929-75843951 GGGGAGCCGGAGCCTCTCCGGGG - Intronic
1129933599 15:79431864-79431886 GCGCCGCCGGAGCCCCGGGAAGG - Intergenic
1130301155 15:82680566-82680588 GCAGAGCCGCAGCGCCGCGGTGG - Exonic
1132111469 15:99105104-99105126 GCGAGGCCGGAGCGTCGCGGCGG + Exonic
1132604342 16:787526-787548 GGGCGGCCGGAGCCCCACGGTGG - Intronic
1132734463 16:1378726-1378748 GCGGGGCCGGAGTCTCTCGGGGG - Intronic
1132810496 16:1794545-1794567 GTGGAGACGGAGCCCAGGGGTGG - Intronic
1132943591 16:2520415-2520437 GCGGCTCCGGAGCCCCGCGGCGG - Exonic
1133121461 16:3611323-3611345 GCGGATCCGGATCCCCACGGTGG - Intronic
1133271962 16:4614651-4614673 GCGGCGCCGGAGCCGGGCGAGGG - Intronic
1133784582 16:8964083-8964105 CCTGCGCCGCAGCCCCGCGGCGG + Intronic
1137454788 16:48609993-48610015 GCGGCGCCGGGGGCCGGCGGCGG + Exonic
1137550987 16:49437516-49437538 TCCGAGCCGGAGCCCCAGGGTGG - Intergenic
1139534613 16:67563360-67563382 GCGGAGACGGAGACCAGCGGCGG - Intronic
1139890663 16:70251568-70251590 GCGGCGCCGGCGGCCCGCGAAGG + Exonic
1140078635 16:71723954-71723976 GCGGAGCCGGCGGGCCGCGGGGG - Intronic
1142130821 16:88430783-88430805 CTGAAGCCGGGGCCCCGCGGCGG - Exonic
1142163238 16:88570307-88570329 GCGGGGGCGGAACCGCGCGGAGG + Intergenic
1142293130 16:89201749-89201771 GCGGAGCCTGAGTCCAGTGGAGG + Intergenic
1142513156 17:410521-410543 GCGGCGCCGCGGGCCCGCGGGGG + Exonic
1142847660 17:2690049-2690071 GGGGAGCCGGAGCTCTGTGGCGG - Exonic
1143311524 17:5995079-5995101 GAGGAGCCGGAGCCCAGCGTGGG + Intronic
1144695793 17:17303310-17303332 GCGGAGGCGGAGCCCCGGGGCGG - Intergenic
1146882804 17:36453075-36453097 GCGGGGCTGGAGCCCCTCGTGGG - Intergenic
1147184283 17:38705287-38705309 GCGTAGCCCGAGCCCGGCGGGGG - Intergenic
1147313185 17:39606821-39606843 GCGGAGCCGGGGCCCAGCGCCGG - Intronic
1147635779 17:41962978-41963000 GCGGAGACAGAGCCCCTCTGAGG - Intronic
1147819673 17:43234265-43234287 GGGGAGCCGGGGCTCCGCTGGGG + Intergenic
1147820982 17:43241662-43241684 GGGGAGCCGGGGCTCCGCTGGGG + Intergenic
1147821789 17:43246152-43246174 GGGGAGCCGGGGCTCCGCTGGGG + Intergenic
1147822881 17:43252307-43252329 GGGGAGCCGGGGCTCCGCTGGGG + Intergenic
1147825399 17:43267111-43267133 GGGGAGCCGGGGCTCCGCTGGGG + Intergenic
1147826522 17:43273578-43273600 GGGGAGCCGGGGCTCCGCTGGGG + Intergenic
1147827411 17:43278456-43278478 GGGGAGCCGGGGCTCCGCTGGGG + Intergenic
1147828519 17:43284617-43284639 GGGGAGCCGGGGCTCCGCTGGGG + Intergenic
1147829628 17:43290769-43290791 GGGGAGCCGGGGCTCCGCTGGGG + Intergenic
1147831405 17:43300519-43300541 GGGGAGCCGGGGCTCCGCTGGGG + Intergenic
1147934651 17:44004791-44004813 GCTGAGCCGGCGCCCCGGGCTGG - Exonic
1147986048 17:44308459-44308481 GCAGAGCCCGGGCCCCACGGAGG - Intronic
1148081059 17:44967921-44967943 CCGGCGCCGGGGCCCCGCGCGGG + Exonic
1148742759 17:49902067-49902089 GCCGCGCCGGAGCCCCTCGCCGG - Intergenic
1149314024 17:55421954-55421976 GGGGCGCAGGAGCCCCGGGGCGG - Exonic
1150128181 17:62652410-62652432 GCGGAGGCAGAGCCTCGCCGTGG - Intronic
1150643447 17:66964570-66964592 GCGGACCCGGAGCGCGGCGGCGG + Intergenic
1151314048 17:73311200-73311222 GCGGGGCGGGAGCCTGGCGGGGG + Intronic
1151578638 17:74965080-74965102 GCAGAGCCGGAGGCCTGTGGCGG - Intronic
1151580137 17:74972812-74972834 CAGGAGGCGGAGCCACGCGGGGG - Intronic
1153051289 18:905466-905488 GGGGAACCGGAGTCCGGCGGCGG - Exonic
1154070762 18:11149525-11149547 GCGCAGCCGGGGCTCCCCGGCGG + Intergenic
1154161161 18:11981613-11981635 TGGGAGCCGGAGTCCCGCCGAGG + Exonic
1154438118 18:14361709-14361731 GCGGAGGCGGAGGGCCACGGTGG - Intergenic
1155392714 18:25352271-25352293 GCGGATCCGGAGCCAGGCGGCGG + Intergenic
1158505745 18:58044640-58044662 ATGGAGCCGGCGCCCCGCGCGGG - Exonic
1160499096 18:79393806-79393828 GCAGAGCCGGGGGCCCGCGGTGG + Intergenic
1160777457 19:862567-862589 GCGGAGCGGGATCCCTGCTGTGG + Intronic
1160874299 19:1290111-1290133 GGGGTGACGGAGCCCTGCGGTGG + Intronic
1160880866 19:1319383-1319405 GCTGAGCCGAGGCCCCGCGTGGG - Intergenic
1160991795 19:1863210-1863232 GCGGACCCGGAGCCGCCCCGGGG - Exonic
1161129482 19:2579595-2579617 GCGGAGCTGCTGCCCAGCGGCGG - Intronic
1161179088 19:2867448-2867470 CCGGAGCCGGAGCCCTGGGAGGG + Intronic
1161366112 19:3880759-3880781 GCGCAGCCGCAGCCCCGCGCTGG + Exonic
1161550504 19:4909853-4909875 GCGTCCCCGGAGCCCGGCGGGGG + Intronic
1162070499 19:8149522-8149544 GCGGCGCCGGGGACCCGGGGCGG + Exonic
1162091049 19:8280435-8280457 GCGGAGCAGGAGCCCAGGGCAGG + Intronic
1162093283 19:8295273-8295295 GCGGAGCAGGAGCCCAGGGCAGG + Intronic
1162410514 19:10502701-10502723 GCGGAGCCGGAGCGCGGCCATGG - Intronic
1162770392 19:12945925-12945947 GCGGGGCCCGAGCGACGCGGCGG - Exonic
1162770415 19:12946027-12946049 GCCGGGCCGGAGCCCGGGGGCGG + Intronic
1162921556 19:13906252-13906274 GCGGCGCCCGAGGCCCGAGGCGG + Exonic
1162944156 19:14032144-14032166 GTCGAACCGGAGCCCCGGGGCGG + Intronic
1163158073 19:15449738-15449760 GCGGAGCCGTAGCGGGGCGGGGG - Intronic
1163626914 19:18395543-18395565 GCGGAGTTGGGGCTCCGCGGTGG - Intronic
1165080088 19:33302014-33302036 GCGCAGCCGTAGCCGGGCGGGGG + Exonic
1165867019 19:38945527-38945549 GTGGAGCCAGAGCCTCGGGGAGG + Intronic
1166039136 19:40191629-40191651 GCGGAGCCGGGGGCCGCCGGTGG + Intergenic
1168154025 19:54463382-54463404 GCGGCGCCGGCGCCCCAGGGTGG + Exonic
1168286993 19:55340102-55340124 GCGGAGCCCGAGGCCCGGCGAGG - Intronic
1202694235 1_KI270712v1_random:112762-112784 CCGGAGCCCGAGCACAGCGGTGG - Intergenic
927472373 2:23385756-23385778 CCGGGGCCGGAGCCGCGCGCCGG + Exonic
930069446 2:47354091-47354113 GAGAAGCCGGAGCCCCACTGTGG + Intronic
931348694 2:61470418-61470440 GCCGAGCCGGAGCTCCGCGGCGG + Intronic
931429211 2:62196073-62196095 GCGGGGCCGGGCGCCCGCGGCGG + Intergenic
932605469 2:73162926-73162948 GGGGATCCAGAGCCCTGCGGAGG + Intergenic
933666900 2:84971378-84971400 GCAGCGCCGGGACCCCGCGGGGG + Exonic
933728146 2:85437898-85437920 GAGGCGCAGGAACCCCGCGGGGG + Intergenic
934567050 2:95346850-95346872 GCTGGGCCGGGGCCCCGTGGAGG - Intronic
934761194 2:96858010-96858032 GCTGAGCCTGAGACCCGGGGCGG - Exonic
941934688 2:170973678-170973700 GCGGGGCCGGGGCGTCGCGGTGG + Intergenic
942220101 2:173760458-173760480 GTGGGGCCGGAGCCCCGAGGGGG - Intergenic
942454644 2:176129704-176129726 GGGGACGAGGAGCCCCGCGGAGG - Intronic
948645388 2:239400911-239400933 GCGGGGACGGTGCTCCGCGGCGG + Exonic
948983865 2:241508442-241508464 GCCGGGATGGAGCCCCGCGGAGG - Exonic
949070377 2:242020873-242020895 GTGCAGCTGGAGACCCGCGGGGG + Intergenic
949070914 2:242023557-242023579 GTGGAGCCGGAGATCCGGGGAGG + Intergenic
1168802687 20:653335-653357 GCGGAGCCGGAGTCGGGCTGGGG - Exonic
1173631733 20:44521581-44521603 GAGGAACCGGAGCCCCTCGCTGG + Intronic
1174060910 20:47832546-47832568 GTGGAGCTGGAGACCCGGGGCGG - Intergenic
1174070988 20:47898824-47898846 GTGGAGCTGGAGACCCGGGGCGG + Intergenic
1174100280 20:48121906-48121928 GTGGAGCCTGAGACCCGGGGAGG - Intergenic
1174148940 20:48472569-48472591 GTGGAGCTGGAGACCCGGGGAGG - Intergenic
1174148959 20:48472675-48472697 GTGGAGCTGGAGACCCGGGGAGG - Intergenic
1174148975 20:48472781-48472803 GTGGAGCTGGAGACCCGGGGAGG - Intergenic
1174149381 20:48475429-48475451 GTGGAGCTGGAGACCCGGGGAGG - Intergenic
1174153070 20:48499834-48499856 GTGGAGCTGGAGACCCGGGGCGG - Intergenic
1174153627 20:48503035-48503057 GTGGAGCCGGAGATCCACGGAGG - Intergenic
1175517249 20:59577467-59577489 GCGGAGCCGGGGCCGCGGGGAGG - Intergenic
1175585968 20:60140259-60140281 GCAGAGCCGGAGCCCTGCCCAGG - Intergenic
1175964240 20:62652455-62652477 GAGGAGCAAGAGCCCCGGGGCGG - Intronic
1176550026 21:8217036-8217058 CCGCCGCCGGGGCCCCGCGGCGG - Intergenic
1176568953 21:8400071-8400093 CCGCCGCCGGGGCCCCGCGGCGG - Intergenic
1176576867 21:8444306-8444328 CCGCCGCCGGGGCCCCGCGGCGG - Intergenic
1177834104 21:26170769-26170791 ACGGAGCCCGAGCGCGGCGGCGG + Intronic
1178327896 21:31660061-31660083 GCGCAGGCCCAGCCCCGCGGCGG - Intronic
1178476798 21:32944300-32944322 GCAGAGCCAGAGCCCCCAGGAGG + Intergenic
1178914552 21:36699276-36699298 ATGGAGCGGGAGCCCAGCGGAGG - Exonic
1179994327 21:44967077-44967099 GCGGAGGCGGAGGGCCACGGTGG + Exonic
1180615031 22:17121131-17121153 GCGGCCCCAGAGCCCCTCGGAGG - Exonic
1181471776 22:23145204-23145226 GCGGAGCCTGAGCCCTGGGTGGG - Intergenic
1181592561 22:23894317-23894339 GCGGAGCCGCAGCCTCGCGGGGG + Exonic
1182149833 22:28020153-28020175 CCGGAGCCGCAGCCCCCAGGAGG - Intronic
1183409704 22:37647552-37647574 GCAGAGCCAGAGCCCAGCTGAGG + Intronic
1184222724 22:43111034-43111056 GCGGAGACTGAGGCCCGCAGGGG - Intronic
1184465882 22:44668730-44668752 CCGGAGCCGGAGCCCGGGGCCGG - Intronic
1185313847 22:50170500-50170522 GAGTAGCCGGAGGCGCGCGGCGG - Intergenic
1203254916 22_KI270733v1_random:133362-133384 CCGCCGCCGGGGCCCCGCGGCGG - Intergenic
1203262972 22_KI270733v1_random:178441-178463 CCGCCGCCGGGGCCCCGCGGCGG - Intergenic
949522367 3:4868655-4868677 GCGAAGCCGGCGCCCCGGGCTGG - Intronic
951208339 3:19947326-19947348 GCGGAGACGGAGCCCGACAGGGG + Exonic
951217755 3:20040583-20040605 GCGCAGGGGGAGCCCTGCGGGGG - Exonic
951611157 3:24494466-24494488 GGGGCGCAGAAGCCCCGCGGAGG + Intronic
954632749 3:52056161-52056183 GAGGAGCTGGAGGCGCGCGGCGG - Exonic
955298688 3:57756865-57756887 GCGGAGCCGGGTCCCCGCCCTGG + Exonic
955656653 3:61251347-61251369 GCGGGGCCGGAGCGCCGCCTGGG + Exonic
961013013 3:123448472-123448494 GCGGCGCCGGCGCCCCGGGGAGG - Exonic
961383437 3:126510481-126510503 CGGGAGCCGGAGCCCAGCGCTGG - Intronic
961446264 3:126983148-126983170 GCGGAGCCCGGGCGCGGCGGCGG + Intergenic
961754915 3:129121829-129121851 GCGGAGCCGGGGGCGGGCGGGGG - Intronic
968049924 3:195647433-195647455 GTGCAGCTGGAGACCCGCGGGGG - Intergenic
968049994 3:195647751-195647773 GTGCAGCTGGAGACCCGCGGGGG + Intergenic
968084872 3:195869770-195869792 GCAGAGCCGGAGCCGTGGGGTGG + Intronic
968097291 3:195940839-195940861 GTGCAGCTGGAGACCCGCGGGGG - Intergenic
968304137 3:197638232-197638254 GTGCAGCTGGAGACCCGCGGGGG - Intergenic
968556681 4:1249282-1249304 GCGGGGCTGCAGCCCGGCGGAGG + Intronic
968965179 4:3766040-3766062 GCGGCGCCGGCGCCCCGCCCGGG + Intergenic
968965233 4:3766198-3766220 GCGGTCCCGGAGCCCAGCCGGGG - Intergenic
969330340 4:6470988-6471010 GCGGAGCCGGAGCCCCGCGGAGG - Intronic
969394084 4:6909618-6909640 GCCGCTCCGGAGGCCCGCGGCGG + Intronic
969714294 4:8860983-8861005 GCGGGGCCGGAACCGCGGGGAGG + Intronic
969721318 4:8894289-8894311 GCAGACCCGGAGCCTCCCGGAGG + Intergenic
972162589 4:36244530-36244552 GGGGAGCAGGCGCCCCGCGCGGG + Intergenic
975118624 4:70705363-70705385 CGGGAGGCGGAGCTCCGCGGGGG - Intronic
976068336 4:81215035-81215057 GCGGCGCCGGAGCCCAGCGCAGG + Exonic
980930011 4:139176525-139176547 CCGGAGCCGGACCCCCGCCCTGG + Intronic
985741112 5:1618031-1618053 GTGGAGCTGGAGACCCGGGGGGG - Intergenic
985741488 5:1619781-1619803 GTGCAGCTGGAGACCCGCGGGGG - Intergenic
987050415 5:14143586-14143608 GCGGACGCAGAGCCCCGGGGCGG - Intergenic
988065351 5:26224723-26224745 GTGGAGCTGGAGACCTGCGGAGG - Intergenic
988722463 5:33892218-33892240 GCGGGGCCGGAGGAGCGCGGGGG - Intergenic
988949344 5:36241685-36241707 GCCCAGCCGGGGCCGCGCGGCGG + Exonic
989379265 5:40797891-40797913 GCCGCGCCGCAGCCCCGCGGCGG + Intronic
998374602 5:141682302-141682324 GAGTGGCCGGGGCCCCGCGGAGG - Intergenic
1004615086 6:17281551-17281573 CCGGAGCCCGAGCCGCGGGGCGG + Exonic
1005826049 6:29632527-29632549 GCGGGGGCGGAGCCCCGCGCGGG + Intronic
1005864365 6:29926996-29927018 TTGGAGCCGGAGACTCGCGGGGG - Intergenic
1006950819 6:37819915-37819937 GCGGCGGCGGAGCTCGGCGGCGG - Exonic
1007423689 6:41734395-41734417 GTGAAGCCGGAACCCCGCGCGGG + Intronic
1007631378 6:43275282-43275304 GCGGGGCCGAAGTCCGGCGGGGG - Intronic
1013230582 6:108158046-108158068 GCAGTCCCGAAGCCCCGCGGGGG + Intronic
1014724980 6:124962665-124962687 GCGGAGGCGGCGCGCAGCGGGGG - Exonic
1016386713 6:143536956-143536978 GCGGGGCCGGAGCACCGGGTGGG - Intronic
1016461588 6:144285068-144285090 GGGGAGCCGGAGCGCTGCAGAGG + Intergenic
1016982321 6:149864395-149864417 GCGGGGGCGGGGCCGCGCGGGGG - Intergenic
1016994995 6:149955073-149955095 GTGGGGCCGGAGCCCCAGGGAGG - Intergenic
1017003613 6:150014362-150014384 GTGGGGCCGGAGCCCCAGGGAGG + Intergenic
1017009738 6:150055213-150055235 GTGGAGCCGGAGACCCGGGGAGG - Intergenic
1017146595 6:151240629-151240651 GCTGAGCCCGAGCCCAGCGGCGG + Exonic
1018984368 6:168625099-168625121 GCGAAGCAGGAGCCCCTGGGAGG - Intronic
1019272778 7:159839-159861 TCGGTGTCTGAGCCCCGCGGGGG - Intergenic
1019334625 7:477139-477161 GCGGCGCCAGCGGCCCGCGGGGG + Intergenic
1019361286 7:605362-605384 GCAGAACAGGAGCCCAGCGGGGG + Intronic
1020099987 7:5389169-5389191 GCGGAGGCGGCTCCCCGCCGCGG + Exonic
1020261010 7:6530905-6530927 GCGGAGCCCGAGGCCCAGGGAGG - Intronic
1023810346 7:43906613-43906635 GCCGAGCCGCGGCCGCGCGGAGG - Exonic
1024471706 7:49773584-49773606 GCGGAACGGGAGCCGGGCGGAGG + Intergenic
1029207586 7:98878703-98878725 GCGGAGCCGCCGCGCCGCAGAGG - Intronic
1029537205 7:101163723-101163745 GCGGAGCAGGAGAGACGCGGCGG - Exonic
1031919297 7:127589183-127589205 AGGGAGCGGGAGCGCCGCGGCGG + Intronic
1032582822 7:133118843-133118865 GAGGAGCCTGAGCCCAGGGGAGG + Intergenic
1035354741 7:158270320-158270342 GCAGAGCGGGAGCCAGGCGGGGG + Intronic
1035716993 8:1763140-1763162 ACGGAGCCGGAGCCTCCCCGGGG - Intronic
1036739515 8:11347897-11347919 GCGGCTCCGGAGCCCGGCGCGGG + Intergenic
1036803200 8:11808351-11808373 GCGGAGCGGGAGGCCGGGGGCGG + Intronic
1038644038 8:29348870-29348892 GCGGAGGCGCAGCGCGGCGGGGG + Intronic
1042483170 8:69325589-69325611 GTGCAGCTGGAGACCCGCGGAGG + Intergenic
1043284891 8:78516319-78516341 ATGCAGCCGGAGCTCCGCGGCGG + Exonic
1044320094 8:90791778-90791800 CCGGATCCAGAGCCCGGCGGCGG + Exonic
1045305411 8:100952688-100952710 GCGGGGCGGGGGCCCCGGGGCGG + Intronic
1047259225 8:123241160-123241182 CCGGGGCCGGGGCCCCGCGGAGG + Intronic
1048970965 8:139644813-139644835 GCAGTGCCGGGGCCCAGCGGAGG - Intronic
1049109752 8:140635514-140635536 TCGGCCCCGGAGCCCCTCGGCGG - Exonic
1049411454 8:142475656-142475678 GCGGAGCCGGAGCCCTGGAGAGG + Intronic
1049621476 8:143600133-143600155 GCGGAGGCCCAGCCCCACGGGGG - Exonic
1049641058 8:143716253-143716275 GCGGAGCCGGGGCCTGCCGGGGG + Exonic
1049643923 8:143727749-143727771 GCGGAGCCGGAGCGCAGGGGCGG - Exonic
1049766641 8:144358215-144358237 GCGGCGCTGGGGCCCCGGGGCGG + Exonic
1049777565 8:144413652-144413674 GCGGAGCCGCAGGCCTGGGGTGG + Intronic
1049828663 8:144685979-144686001 CGGGAGCCGGAGTCCCGCGGAGG + Intergenic
1049867880 8:144950651-144950673 GCGGGGGCGGAGCCGCGCGGGGG - Intronic
1053055191 9:34989761-34989783 GCGGAGCCGGAGCCGGGGGAGGG + Exonic
1054835582 9:69672320-69672342 GCGGAGCCGGAGCTGGGCGAGGG - Intergenic
1056560522 9:87725897-87725919 GCAGAGCTGGTGCCCCGGGGCGG - Exonic
1057195025 9:93111995-93112017 GCGGAGATGGAGCCCTGGGGAGG - Intronic
1057322959 9:94031000-94031022 CCGGAGACGCTGCCCCGCGGAGG - Intronic
1058908567 9:109499958-109499980 GCGGGGCCGGAGCCCCCGGAAGG + Intergenic
1060724771 9:125999495-125999517 GAGGAGCCTGGGCCCCGTGGGGG - Intergenic
1060980042 9:127786412-127786434 GAGGAGCCTGAGGCCCGTGGTGG + Intronic
1062318380 9:135978900-135978922 GCGGAGACGGAACCCCGGGCCGG + Intergenic
1062332788 9:136051833-136051855 ACGGAGCGGGAGCCCTGGGGCGG + Intronic
1062367186 9:136216497-136216519 GCGGAGCCCGGGCCCCGAGCAGG + Intronic
1062367728 9:136219311-136219333 GCGCAGCCGGAGCCCAGGCGGGG - Intronic
1062574532 9:137200158-137200180 GCCGCGCCCGGGCCCCGCGGTGG - Exonic
1062596607 9:137302496-137302518 ACGGAGCTGGACCCCCCCGGCGG - Intergenic
1203471318 Un_GL000220v1:116508-116530 CCGCCGCCGGGGCCCCGCGGCGG - Intergenic
1203479139 Un_GL000220v1:160480-160502 CCGCCGCCGGGGCCCCGCGGCGG - Intergenic
1185641545 X:1591748-1591770 ACGCAGGCGGAGCCCCGCGCAGG + Exonic
1185747471 X:2584225-2584247 GCGCGCCCGGAGCCCCGCGCCGG + Intergenic
1189321928 X:40092119-40092141 GCGGACCCGGAGAGGCGCGGCGG - Intronic
1190266882 X:48831955-48831977 CCGGGGTCGGAGCGCCGCGGCGG + Exonic
1190474599 X:50814019-50814041 GCGGCGCCTGAGCCCAGCCGAGG - Exonic
1190881571 X:54495714-54495736 GCGGGGCCGGGGGCCCGCTGGGG + Exonic
1200057930 X:153471108-153471130 GAGAAGACGGAGCCCCGCGCTGG - Intronic
1200067823 X:153512973-153512995 GCCGAGCTGGAGCTCCTCGGTGG + Intergenic
1200078706 X:153565038-153565060 GCCGAGCGGGAGCTCCGCAGGGG + Exonic
1200238120 X:154478921-154478943 GTGGAGTCGGAGCGGCGCGGCGG - Exonic