ID: 969330714

View in Genome Browser
Species Human (GRCh38)
Location 4:6472311-6472333
Sequence CCTGCTAGGCTGCGGCGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 112}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969330714_969330739 23 Left 969330714 4:6472311-6472333 CCATGCCGCCGCAGCCTAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 112
Right 969330739 4:6472357-6472379 AGGGAGGGCATCGCGGCAGGGGG 0: 1
1: 0
2: 2
3: 18
4: 270
969330714_969330723 -8 Left 969330714 4:6472311-6472333 CCATGCCGCCGCAGCCTAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 112
Right 969330723 4:6472326-6472348 CTAGCAGGGGCGCGGGCCGCCGG 0: 1
1: 0
2: 0
3: 11
4: 140
969330714_969330738 22 Left 969330714 4:6472311-6472333 CCATGCCGCCGCAGCCTAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 112
Right 969330738 4:6472356-6472378 AAGGGAGGGCATCGCGGCAGGGG 0: 1
1: 0
2: 3
3: 14
4: 191
969330714_969330727 4 Left 969330714 4:6472311-6472333 CCATGCCGCCGCAGCCTAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 112
Right 969330727 4:6472338-6472360 CGGGCCGCCGGGGCCCCGAAGGG 0: 1
1: 0
2: 0
3: 14
4: 103
969330714_969330736 20 Left 969330714 4:6472311-6472333 CCATGCCGCCGCAGCCTAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 112
Right 969330736 4:6472354-6472376 CGAAGGGAGGGCATCGCGGCAGG 0: 1
1: 0
2: 0
3: 4
4: 79
969330714_969330737 21 Left 969330714 4:6472311-6472333 CCATGCCGCCGCAGCCTAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 112
Right 969330737 4:6472355-6472377 GAAGGGAGGGCATCGCGGCAGGG 0: 1
1: 0
2: 1
3: 14
4: 166
969330714_969330741 28 Left 969330714 4:6472311-6472333 CCATGCCGCCGCAGCCTAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 112
Right 969330741 4:6472362-6472384 GGGCATCGCGGCAGGGGGACGGG 0: 1
1: 0
2: 1
3: 19
4: 229
969330714_969330724 -7 Left 969330714 4:6472311-6472333 CCATGCCGCCGCAGCCTAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 112
Right 969330724 4:6472327-6472349 TAGCAGGGGCGCGGGCCGCCGGG 0: 1
1: 0
2: 1
3: 7
4: 119
969330714_969330725 -6 Left 969330714 4:6472311-6472333 CCATGCCGCCGCAGCCTAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 112
Right 969330725 4:6472328-6472350 AGCAGGGGCGCGGGCCGCCGGGG 0: 1
1: 0
2: 3
3: 32
4: 328
969330714_969330740 27 Left 969330714 4:6472311-6472333 CCATGCCGCCGCAGCCTAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 112
Right 969330740 4:6472361-6472383 AGGGCATCGCGGCAGGGGGACGG 0: 1
1: 0
2: 1
3: 22
4: 323
969330714_969330730 8 Left 969330714 4:6472311-6472333 CCATGCCGCCGCAGCCTAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 112
Right 969330730 4:6472342-6472364 CCGCCGGGGCCCCGAAGGGAGGG 0: 1
1: 1
2: 2
3: 13
4: 141
969330714_969330726 3 Left 969330714 4:6472311-6472333 CCATGCCGCCGCAGCCTAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 112
Right 969330726 4:6472337-6472359 GCGGGCCGCCGGGGCCCCGAAGG 0: 1
1: 0
2: 0
3: 18
4: 217
969330714_969330728 7 Left 969330714 4:6472311-6472333 CCATGCCGCCGCAGCCTAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 112
Right 969330728 4:6472341-6472363 GCCGCCGGGGCCCCGAAGGGAGG 0: 1
1: 0
2: 1
3: 14
4: 161
969330714_969330732 16 Left 969330714 4:6472311-6472333 CCATGCCGCCGCAGCCTAGCAGG 0: 1
1: 0
2: 0
3: 9
4: 112
Right 969330732 4:6472350-6472372 GCCCCGAAGGGAGGGCATCGCGG 0: 1
1: 0
2: 1
3: 7
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969330714 Original CRISPR CCTGCTAGGCTGCGGCGGCA TGG (reversed) Intronic
900206871 1:1435382-1435404 CCTGCTCGGCTCCCGCGGCTGGG + Intronic
900462371 1:2807812-2807834 GCAGCGAGGCTGCGGCGTCAGGG - Intergenic
901754831 1:11435147-11435169 CCTGCCAGGCTGCAGCGGGCAGG - Intergenic
902332847 1:15739076-15739098 CCTGTGAGGCTGCGGCGCCATGG - Intronic
902690539 1:18107961-18107983 GCTGCCTGGCCGCGGCGGCATGG + Exonic
905867031 1:41382128-41382150 CCTGCACGGCGGCGGCGGCGCGG + Exonic
906257680 1:44362943-44362965 CCTGCTAGTCTGGGAAGGCAGGG - Intergenic
917294518 1:173504948-173504970 CCTGGTAGGCTGCAGCCACATGG - Intronic
919879904 1:201894639-201894661 CCTGCTAGGCTGGGAGGGAATGG + Intergenic
920651422 1:207840205-207840227 CCTGCATGGCTGTGTCGGCATGG + Intergenic
922631237 1:227113940-227113962 CCTGGGAGGCTGAGGCTGCAGGG + Intronic
923009050 1:230073829-230073851 CCTGGAAGGCTGCGGCAGAAGGG - Intronic
923141388 1:231163376-231163398 GCTCCTCGGCTGCGGCGGCTCGG + Exonic
1064227931 10:13503957-13503979 CCTCCTAGGCAGCAGCTGCAGGG - Intronic
1064981955 10:21174165-21174187 CCTGCGCGGCGGCGGCGGCGAGG - Intronic
1066126323 10:32346577-32346599 CCCGCTGGGCCGCGGCGGCCGGG + Intronic
1067053963 10:43040689-43040711 CCTGCTATGCTGTGGGGGGAGGG + Intergenic
1069842408 10:71348039-71348061 CCTGCCATGCTGAGGCAGCAGGG + Intronic
1071271093 10:84008342-84008364 CCTGAGAGGTTGCGGCTGCAGGG + Intergenic
1071676384 10:87659715-87659737 CCGCCTAGGCGGCGGCGGCCGGG + Exonic
1077008157 11:368961-368983 CCTGCAGGGCTGGGGCCGCAGGG - Intergenic
1083768565 11:64853937-64853959 GCTGCTAGGCTGAGGCTGCATGG - Exonic
1084677738 11:70646115-70646137 GCTGGTAGCCTGTGGCGGCAAGG + Intronic
1088223550 11:107593139-107593161 CCTGCCAGGCTGCTTCTGCAAGG + Intronic
1089735268 11:120546458-120546480 CCTGCTGGGCTAGGGCGACATGG + Intronic
1090428700 11:126628348-126628370 CCTTCCAGGCTGTGGAGGCAGGG + Intronic
1090817776 11:130314424-130314446 CCCGCCAGGCTGGGGCGGCGAGG + Exonic
1091401059 12:180995-181017 CTTGGGAGGCTGAGGCGGCAGGG - Intergenic
1091711466 12:2743583-2743605 CCAGCTAGGCTGAGGTGGCTGGG - Intergenic
1099014121 12:77324933-77324955 GCTGCTAGGTGGCGGCGGCGCGG + Intergenic
1103204295 12:119116346-119116368 CTTGCCAGGCTGCGGCTGCACGG - Intronic
1103852510 12:123942341-123942363 CATGCTAGGCGGCAGCGACACGG + Intronic
1107078206 13:36346271-36346293 CCTGCGCGGCCGCCGCGGCACGG + Intronic
1108696259 13:52905065-52905087 CCTCAAAGGCTGGGGCGGCAGGG - Intergenic
1112811797 13:103226597-103226619 CCTGCTGGGCTGGGGAGGGATGG + Intergenic
1119479661 14:74951609-74951631 CCAGCTGGGCTGCGGGGCCATGG + Intronic
1121039342 14:90732451-90732473 CCTGCGAGGTTGAGGCTGCAGGG - Intronic
1121315908 14:92960867-92960889 CCAGGTAGGCTGCGGCAGGAGGG + Intronic
1121749729 14:96340808-96340830 CTTGCGAGGCTGAGGCGGGAGGG + Intronic
1122150220 14:99721645-99721667 CCTGCTGTGCGGCGGCAGCATGG - Intronic
1124835857 15:33195201-33195223 ACGGCTAGGCTGAGGGGGCAGGG - Intergenic
1127084005 15:55408095-55408117 CCTCCTAGGCTGGGGCTGCTCGG - Intronic
1129464426 15:75716007-75716029 CATGCTTGGCTGGGGAGGCATGG - Intergenic
1129720820 15:77877005-77877027 CATGCTTGGCTGGGGAGGCATGG + Intergenic
1132690761 16:1180886-1180908 CCTGCTGGGCCGCGTTGGCAGGG + Intronic
1132932707 16:2467157-2467179 GCTGCCAGGCTGCGGTGGCAGGG - Intergenic
1136234701 16:28906218-28906240 CCTGCTGGGCTGGGGCAGGAGGG + Intronic
1136408846 16:30065060-30065082 CCAGCCTGGCTGCGGCGGCCCGG + Intronic
1141638646 16:85328896-85328918 TCTGCCAGGCTGCGGGGGCAGGG - Intergenic
1142243971 16:88960218-88960240 CCTGCTGGGCTGGGAGGGCAGGG + Intronic
1146145491 17:30412601-30412623 CCTGCGAGGCTGCAGCCTCATGG - Intronic
1147393329 17:40122822-40122844 CCCGGCCGGCTGCGGCGGCAAGG + Intronic
1149886573 17:60345935-60345957 CATGCTGGAGTGCGGCGGCATGG - Intronic
1151365076 17:73611818-73611840 CCAGCTTGGCTGCAGGGGCAGGG - Intronic
1152688133 17:81704695-81704717 CCTCCTGGGCTGCTGCAGCAGGG - Exonic
1155300729 18:24426718-24426740 CCTGGCAGGCGGCGGCTGCAGGG + Exonic
1156364804 18:36415844-36415866 CTTGCAGGGCTGCTGCGGCATGG - Intronic
1159864653 18:73689966-73689988 CCTCCGAGGCTGTGGCTGCATGG - Intergenic
1161779265 19:6280091-6280113 CCTGCCGGGCTGCGGCCGGAGGG + Intergenic
1162145283 19:8609453-8609475 CCGGCCAGGCTGCGGGGACAGGG + Intronic
1162871393 19:13589386-13589408 CCTGCCAGGCTGGGGAGCCATGG + Intronic
1163714647 19:18866691-18866713 CCTGCTGGCCCGCGGCGGCGAGG + Exonic
1164984356 19:32637745-32637767 CTTACGAGCCTGCGGCGGCAGGG - Intronic
929815009 2:45223631-45223653 CCTGCCATGCTGTGGCGGCGGGG - Intergenic
931159124 2:59668752-59668774 CCTGCTAGGCTGCAGAGTCAAGG + Intergenic
933872068 2:86576310-86576332 CCTGGGAGGCAGGGGCGGCAGGG + Intronic
937313288 2:120915258-120915280 CCTGCTAGGCTGTGTCTGCAGGG + Intronic
937376373 2:121338515-121338537 CCTGCAGGGAGGCGGCGGCAAGG + Exonic
946103662 2:217351032-217351054 CATGCTAGTCTGCTGCAGCAAGG + Intronic
947745611 2:232505948-232505970 ACTGGGAGGCTGCGGCAGCAGGG + Intergenic
1170533328 20:17315780-17315802 CCTGCAGGGCTGCGGCGTCCTGG + Intronic
1171346789 20:24471182-24471204 CGTGCTAGGCTGCGACCTCAAGG + Intronic
1173304307 20:41833598-41833620 TCTGCTATGCTGCATCGGCATGG - Intergenic
1175463265 20:59171096-59171118 ACTGCTGGGCTGAGGCTGCAAGG + Intergenic
1175814031 20:61874307-61874329 CCACCCAGGCTGCGGCGGCCTGG + Intronic
1175958007 20:62621258-62621280 CCTGCCAGGCTGCGACCCCAGGG - Intergenic
1176521040 21:7824578-7824600 CCTGCTAGGCTGGGTCGCCATGG + Intronic
1178655060 21:34454590-34454612 CCTGCTAGGCTGGGTCGCCATGG + Intergenic
1180956286 22:19742843-19742865 CCTGCCAGGCTGTGGGGGCTGGG + Intergenic
1181163586 22:20971759-20971781 CCTCCCAGGCTGCTGCTGCAGGG - Intronic
1185278620 22:49960653-49960675 CCCGCGAGGCGGCGGCGGCCGGG - Exonic
949894866 3:8761487-8761509 ACTGCTGGCCTGGGGCGGCAGGG + Intronic
953849013 3:46450915-46450937 CCTGCCAGGCAGCAGCTGCACGG - Intronic
956080133 3:65549057-65549079 CCGCCTTGGCTGCGGCGCCAGGG - Intronic
960144255 3:114182685-114182707 CCTGGTAGGCTGAGGTTGCAGGG - Intronic
968778374 4:2559761-2559783 CCTGCCAGACTCCGGCTGCACGG + Intronic
968843973 4:3029542-3029564 CCTACTGGGCTGCAGGGGCAGGG - Intronic
969330714 4:6472311-6472333 CCTGCTAGGCTGCGGCGGCATGG - Intronic
969652814 4:8477907-8477929 CCTTCCAGGAGGCGGCGGCAGGG - Intronic
972233010 4:37097256-37097278 CCTGCTAAGATGTGACGGCAGGG + Intergenic
977771710 4:100868526-100868548 CCTGCTATGCTGCAGCTGGAAGG - Intronic
982610966 4:157574466-157574488 CCTCCGAGCCTGCGGGGGCAAGG - Intergenic
983919979 4:173334541-173334563 CCTGCTAGGCTGGGGCGTGGAGG - Exonic
991569729 5:68041475-68041497 CCTGAGAGGCTGCGGTGGCCGGG - Intergenic
996684546 5:126266188-126266210 CCTGCCAGGCTGAGTGGGCAGGG + Intergenic
1004228863 6:13813827-13813849 CCTGCTCGGCCGCGGTGGCGGGG - Intronic
1006358747 6:33575792-33575814 CCTGCTAGGTTGCAGAGGTAAGG + Exonic
1011209160 6:84936272-84936294 CTTGCTAGGCTCCGTAGGCATGG - Intergenic
1015373612 6:132484497-132484519 CTGGCCAGGCTGTGGCGGCATGG + Intronic
1018401306 6:163423210-163423232 CCTGGTAGGCGGCGGTTGCAGGG + Intronic
1020278401 7:6637766-6637788 CCTTCTCGGCCGCAGCGGCAGGG + Intronic
1022045518 7:26619524-26619546 CCTGCTAGGTTTTGGAGGCAGGG + Intergenic
1024692592 7:51819071-51819093 GCTGCCAGGCTGCGCTGGCATGG + Intergenic
1029733306 7:102451768-102451790 CCTCCCAGGCTGCCCCGGCAAGG + Exonic
1032391215 7:131556523-131556545 CCGGCTCTGCTGCAGCGGCAGGG - Exonic
1037773031 8:21814038-21814060 TCTGCTCGGCAGGGGCGGCAGGG - Intergenic
1040567920 8:48583037-48583059 CCTGTGAGGCTGAGGCCGCAGGG - Intergenic
1042871851 8:73406801-73406823 CATGCTAGGCTGGGGAGGCGAGG + Intergenic
1043986686 8:86701057-86701079 TGTTCTAGGCTGCGGAGGCAGGG - Intronic
1046398805 8:113676544-113676566 CCTGCCTGGCTGCTGCTGCAGGG + Intergenic
1047749219 8:127867278-127867300 ACTGCCAGGCTGTGGCGGCTTGG - Intergenic
1049795624 8:144496146-144496168 CCTGCTAGGCTGCTCCTCCAGGG - Intronic
1050387006 9:5101303-5101325 CCTGCCAGGCTGCTGCCTCACGG - Intronic
1051425572 9:16928293-16928315 CCTGCAAGGCTGCAGCAGGATGG - Intergenic
1051618344 9:19027856-19027878 CCTGCTACGCTAGGGCGGCCTGG + Intronic
1056475275 9:86946746-86946768 GCTGCTGGGCGGCGGCGGCGAGG - Exonic
1061807425 9:133144269-133144291 CCTGCGAGGCTGCAGGGGCCAGG - Intronic
1061987093 9:134136179-134136201 CCTGCCGGGCCGCGGCGGCGGGG - Exonic
1062076064 9:134590629-134590651 ACTGCTAGGATCCGGGGGCAAGG + Intergenic
1187269143 X:17764119-17764141 CCTGGCAGGCTGAGGCGGGAGGG + Intergenic
1195729268 X:107949273-107949295 CCTGCCAGGCTGCTGCCTCACGG + Intergenic
1200143976 X:153916437-153916459 CCTGCTAGGCTTTGGCTGGAGGG + Intronic