ID: 969331895

View in Genome Browser
Species Human (GRCh38)
Location 4:6478627-6478649
Sequence CTGGCAAAGGGGGAGGTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 350
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 327}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969331895_969331904 2 Left 969331895 4:6478627-6478649 CCTGCTACCTCCCCCTTTGCCAG 0: 1
1: 0
2: 1
3: 21
4: 327
Right 969331904 4:6478652-6478674 GGTGGCTGAGCACTTCACATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969331895 Original CRISPR CTGGCAAAGGGGGAGGTAGC AGG (reversed) Intronic
900354046 1:2251409-2251431 CTGGGGCAGGGGGAGGGAGCGGG - Intronic
900876753 1:5348421-5348443 CAGGCAAAGAGGGAAGCAGCAGG + Intergenic
901034622 1:6328924-6328946 CAGGCCAAGGGGGAGGGAGAAGG - Intronic
901244171 1:7715590-7715612 CTGTGAAAGGGGGATGTGGCTGG - Intronic
901839022 1:11942398-11942420 CTGGCAGAGGGAGAAGGAGCAGG + Intronic
902385050 1:16071737-16071759 CTGGCAGAGGGGGCGGTGGAGGG + Intronic
902564584 1:17302886-17302908 GTGGCAGAGGGGAAGGTTGCAGG + Intergenic
902695582 1:18138628-18138650 CTGGCAAGGGGCGAGGAAGCTGG + Intronic
902790628 1:18765442-18765464 CTGGGAAAGGGGTAGGGTGCAGG + Intergenic
902820804 1:18942073-18942095 CAGCCAAAGCGGGAGGGAGCAGG + Intronic
903132537 1:21289508-21289530 CTGGAAAAGGGGCAGGGAGAGGG + Intronic
903188704 1:21644241-21644263 CTGGCCATGGGGGAGCTGGCAGG - Intronic
903690190 1:25167795-25167817 CTGGCAGATGAGGAGGTAGATGG + Intergenic
903853671 1:26322873-26322895 TTGAGTAAGGGGGAGGTAGCAGG - Intronic
903934090 1:26882866-26882888 CAGGAAAAGGAGGAGGGAGCAGG - Intronic
904493039 1:30871891-30871913 CTGGCAGAGGGGGAGGTTTGGGG - Intronic
904687885 1:32273995-32274017 CTGGCAGAGGGAGAGGGAGGGGG + Intronic
904954247 1:34269748-34269770 CTAGCAACGTGGGAAGTAGCGGG - Intergenic
905108671 1:35578666-35578688 CTGGAGAAGGAGGAGGGAGCTGG + Intronic
905942436 1:41874837-41874859 CTGGAGAAGGGAAAGGTAGCTGG - Intronic
906761267 1:48381740-48381762 CTCGCAGAGGGGGATTTAGCAGG + Intronic
906770777 1:48480189-48480211 CTCGCAGAGGGGGAGTTGGCAGG - Intergenic
906774059 1:48512723-48512745 ATGGAAAAGGGGCAGGTAGGAGG - Intergenic
907547456 1:55274699-55274721 ATGGAGAAGAGGGAGGTAGCAGG - Intergenic
907727311 1:57031848-57031870 CTGGTAAAGAGAGATGTAGCTGG + Intronic
909183233 1:72450712-72450734 CTAGCAGAGGGGGAAGAAGCAGG - Intergenic
909471474 1:76033706-76033728 CTGGAGGAGGGGGAGGCAGCAGG + Intergenic
915446937 1:155979210-155979232 CTGGCAGAGGCGGAGCTAGGAGG - Intronic
915627398 1:157123598-157123620 CTGGAAACATGGGAGGTAGCTGG - Exonic
915723081 1:157998236-157998258 CTGGCAAAGGAGAAGGGTGCAGG - Intronic
915914777 1:159934374-159934396 CTGGCCCAGGGGAAGGGAGCAGG + Intronic
919958789 1:202445110-202445132 ATGGTAATGGGTGAGGTAGCAGG - Intronic
919994788 1:202739515-202739537 CTCGCAGAGGGGGAGTTGGCAGG + Intronic
920375232 1:205504669-205504691 CTGGCCGAGGAGGAGGTAGAAGG - Exonic
921217874 1:212952006-212952028 ATGGGGAAGGGAGAGGTAGCGGG + Intronic
924651725 1:245934793-245934815 CTGGCAAAGGGAAATGTAGTTGG - Intronic
1063313387 10:4978119-4978141 CTGGGAAAGGGGCAGGTGACAGG + Exonic
1063314565 10:4989598-4989620 CTGGGAAAGGGGCAGGTGACAGG - Exonic
1065311115 10:24416754-24416776 CTTGCAAAGCGGAAGGGAGCTGG - Intronic
1066681318 10:37938840-37938862 CTGACAAAGGGGTGGTTAGCAGG - Intergenic
1067145087 10:43688889-43688911 CTGGGAAAGGGGGAGGTTGCTGG + Intergenic
1067354732 10:45513178-45513200 CTCGCAGAGGGGGAGTTGGCAGG - Intronic
1067766794 10:49092995-49093017 CAGTCAATGGGGGAGGTAGAAGG - Intronic
1067798104 10:49335362-49335384 CTGGAAAAGGGTGAGGTTTCAGG - Intergenic
1071151614 10:82641973-82641995 CTTGGAAAGGGGGAGGTTGAGGG - Intronic
1071399658 10:85256891-85256913 CTGGCAAAGGAGGAGATGGAAGG - Intergenic
1072688680 10:97555045-97555067 CTGGCAAAGAGGAAGGAGGCAGG + Intronic
1073048549 10:100653995-100654017 CTTGCTAAGGGGGAGGGAGAAGG - Intergenic
1073336521 10:102714308-102714330 CTGGTAACGGGGGAGGCAGCAGG - Exonic
1074809747 10:117091825-117091847 CTGGCAGAGTGGGAGGAAGAGGG - Intronic
1075179312 10:120195961-120195983 CAAGCAATGGGGGAGGTGGCTGG + Intergenic
1075187205 10:120273879-120273901 CTAGCAAAGGTGGAGGCAGTGGG - Intergenic
1075603551 10:123788324-123788346 CTGGTGAAGGGGGAGGTAAAAGG - Intronic
1076399749 10:130174216-130174238 CTTGCTAAGGTGGAGGGAGCTGG + Intronic
1076504884 10:130965072-130965094 CCTTCAAAGGGGCAGGTAGCTGG - Intergenic
1077552023 11:3204665-3204687 CTGGCAGAGGGGGTGGGGGCCGG - Intergenic
1078487307 11:11735582-11735604 CTAGCAGCGGGGGAGGTAACTGG + Intergenic
1078671352 11:13368543-13368565 CTGGCAATGTGGGAGGTAGATGG + Intronic
1081355045 11:42102388-42102410 ATGGCAAAGATGCAGGTAGCTGG + Intergenic
1081566471 11:44264014-44264036 CTGGGAGAGGGGGAGGCATCCGG - Exonic
1082082953 11:48026305-48026327 CTGGGAAAGGGGCAGTTGGCTGG + Intronic
1082238919 11:49852153-49852175 CCGGCAAAGGGGCAGGTGGGAGG - Intergenic
1083120972 11:60511122-60511144 CTGGCAGAGGGGGATTTGGCAGG - Intergenic
1083203174 11:61132200-61132222 CTGGGAAAGGGGCCGGTGGCAGG + Exonic
1083611746 11:64007709-64007731 CTGGCAAAGGGCGAGGGGGGAGG - Intronic
1083729638 11:64645828-64645850 ATGGCAAAGGTGGAAGGAGCAGG - Intronic
1084040372 11:66539286-66539308 CTGGCAAAGGGGCAGCTAGGCGG + Exonic
1084191295 11:67500151-67500173 CTGGCATCGGGGGAGGCATCTGG + Exonic
1084194776 11:67518238-67518260 AAGGTAAAGGGGGAGGAAGCAGG + Intergenic
1084206457 11:67597520-67597542 CTGGCAGAGGGGGATTTGGCAGG + Intergenic
1084495936 11:69503395-69503417 CTAGTAAAGGGTGAGGCAGCTGG + Intergenic
1084695757 11:70754641-70754663 CTGGCAAAGGCAGCGGTAGGAGG + Intronic
1085454996 11:76660645-76660667 CTGGGAAAGGGGGCGGCCGCTGG + Exonic
1089520286 11:119058659-119058681 CTGGCAGAGGGGGATTTGGCAGG + Intergenic
1089555305 11:119312696-119312718 CTGGATAAGGGGGAGCCAGCAGG + Intronic
1090365714 11:126203586-126203608 CAGGTGAAGGGGGATGTAGCGGG + Exonic
1091725758 12:2845504-2845526 CTTGGAAAGGGGGAGGTGGAGGG + Intronic
1092194407 12:6540657-6540679 CTGCCAGAGGGTGAGGCAGCAGG - Intronic
1094216944 12:27952439-27952461 CAGGGAAAGGGGGAGGGAGGGGG + Intergenic
1096002431 12:48140857-48140879 CTGGCCAAGGGGCAGGTATGGGG + Exonic
1096196471 12:49651933-49651955 CTGGTAATGGGGGAGGTGGAGGG + Exonic
1096466413 12:51849279-51849301 AGGGCAAAGGGGAAGGCAGCCGG + Intergenic
1102009969 12:109612173-109612195 CTGTCAAATGGGGTGGTAACAGG + Intergenic
1102201007 12:111057634-111057656 CTGGCAGAAGGGGAGGCTGCTGG - Intronic
1102376321 12:112424291-112424313 CTGGGAAGGTGGGAGGTAGGTGG + Intronic
1103556775 12:121771178-121771200 CTGGCCAGGGCAGAGGTAGCGGG + Intronic
1103568513 12:121829261-121829283 GTGGCCAAGGGGGCTGTAGCAGG + Intronic
1104307385 12:127621761-127621783 CAGCCATGGGGGGAGGTAGCCGG - Intergenic
1104651632 12:130538895-130538917 CAGGCAAGGTGGGAGGAAGCAGG + Intronic
1105524174 13:21160290-21160312 CTGACAAAGGAGGAGGAAGACGG + Intronic
1105645975 13:22317785-22317807 ATGGCAAAAGGAGAGGTAGGAGG - Intergenic
1105996054 13:25672959-25672981 GTGGAAAAGAGGGAGGGAGCAGG + Intronic
1107114216 13:36729234-36729256 CAGGGAAAGTGGGAGGAAGCTGG - Intergenic
1113631994 13:111894135-111894157 CTGGGAGAGGGGGTGGTAGCAGG + Intergenic
1114474029 14:22981799-22981821 CTGGCGGAGCTGGAGGTAGCCGG - Exonic
1114632002 14:24165031-24165053 CTGGCAGATAGGGAGGTAGCAGG - Intronic
1117653483 14:57930397-57930419 CTGGCACAGGGAGAGGTAAGAGG - Intronic
1118837265 14:69485749-69485771 CTGGAAAGGAGGGAGGCAGCTGG + Intronic
1119594716 14:75924324-75924346 CTCGCAGAGGGGGAGTTGGCAGG + Intronic
1119728448 14:76936386-76936408 CTGGCAAAGGGAGAAGTTGCCGG - Intergenic
1121033858 14:90682786-90682808 CTGGCAAAGGAGGCGGCAGTGGG + Intronic
1122205993 14:100148331-100148353 GTGGCAAAGGGGGCGGGAGGAGG - Intronic
1202903822 14_GL000194v1_random:57447-57469 CTGGCACACAAGGAGGTAGCTGG - Intergenic
1126427096 15:48539421-48539443 CTGGCATGGAGGGAGGGAGCTGG - Intronic
1126583009 15:50258358-50258380 CTCGCAATGGGGAACGTAGCAGG - Intronic
1127782729 15:62331615-62331637 CTCGCAGAGGGGGAGTTGGCAGG + Intergenic
1127833417 15:62770587-62770609 GTGGAAAAGGGTAAGGTAGCAGG - Intronic
1127874451 15:63099732-63099754 CTCGCAGAGGGGGAGTTGGCAGG - Intergenic
1128489505 15:68133775-68133797 CTCGCAGAGGGGGAGTTGGCAGG + Intronic
1129650943 15:77488642-77488664 CTGGTAGAGGTTGAGGTAGCTGG + Intergenic
1129699488 15:77759385-77759407 CTGGCAGTTGGGGAGTTAGCAGG - Intronic
1129741640 15:77992384-77992406 CTGGAGCAGGGGGAGGTGGCGGG + Intronic
1130112470 15:80977114-80977136 GTGGCAGAGGGAGAGGCAGCAGG - Exonic
1130350266 15:83085177-83085199 CTGGGAAGTGGGGAGGCAGCAGG + Intergenic
1131098893 15:89672826-89672848 CTGGCAGAGGCAGAGGCAGCCGG - Intronic
1135087689 16:19488089-19488111 CTGATAAAGGGGGCGGTTGCGGG + Intronic
1135189818 16:20345615-20345637 CTGGTAATGAGGGAGGTGGCAGG + Intronic
1135271230 16:21071468-21071490 ATGAAAAATGGGGAGGTAGCTGG - Intronic
1135289357 16:21221986-21222008 CTCGGAAAGGGGGATGTGGCAGG + Intergenic
1135691155 16:24539238-24539260 GTGGGGAAGGGGGAGTTAGCCGG + Intronic
1137401178 16:48155668-48155690 CTGCCCAAGTGGGAGGCAGCAGG - Intronic
1137420050 16:48325409-48325431 CTGGCAAGGGGAGAGATAGTGGG - Intronic
1138642017 16:58395370-58395392 CTCGCAAAGGGGGATTTGGCAGG + Intronic
1138648365 16:58441861-58441883 CAGGCACAGAGGGAGGTAGGGGG + Intergenic
1139386400 16:66575062-66575084 CTGGAACAGGGGTATGTAGCAGG - Intronic
1140200106 16:72888134-72888156 CTGGAAAAGGGGGTGGGAGAGGG + Intronic
1140880500 16:79193777-79193799 CTCACAAAGGGGGTGGCAGCTGG + Intronic
1141569059 16:84923155-84923177 CTGGCTAAGGTGGAGGTTGCTGG - Intergenic
1142395137 16:89828014-89828036 CTGGGAACGCGGGAGGGAGCCGG - Intronic
1143587050 17:7855557-7855579 CAGGCAGAGGCGGCGGTAGCTGG - Exonic
1144844649 17:18210284-18210306 CTGGTGAAGGGGGAGATGGCAGG + Intergenic
1145896315 17:28459718-28459740 CTCGCAAAGGGGGATTTGGCAGG - Intronic
1147326350 17:39671558-39671580 ATGGCAAAGGGGCTGGCAGCAGG + Exonic
1147440299 17:40443564-40443586 CGGGCGAACGGGGACGTAGCGGG - Exonic
1148324780 17:46776905-46776927 CTGGGAGAGGGGGAGGAAGGAGG - Intronic
1150218695 17:63484017-63484039 CTGGCAAAGGGTGTGGCAGGAGG + Intergenic
1150291133 17:63983087-63983109 TTGGCAAGAGGGGAGGTGGCTGG - Intergenic
1150586276 17:66520982-66521004 CTGGCAAATGAGGAGGCAGGAGG + Intronic
1152848661 17:82618275-82618297 CTAGCCAAGGGGGAGGCACCAGG + Intronic
1153172763 18:2335069-2335091 CTGGCAATGTGGCAGTTAGCAGG - Intergenic
1155414319 18:25581241-25581263 CTGGCAAAGGTTGAAGTAGAAGG + Intergenic
1157171386 18:45409633-45409655 CTGGGAAAGGGGTGGGTAGGAGG - Intronic
1157177286 18:45463230-45463252 TGGGCAAAGGGGGAGGCAGTTGG + Intronic
1157325931 18:46668920-46668942 CTGGCCATGTGGGAGGCAGCTGG - Intronic
1157580302 18:48770290-48770312 GTGGCAAAGAGGCAGGAAGCTGG - Intronic
1158425989 18:57340047-57340069 CTGGGAAAGGGAGAGGGAGAGGG - Intergenic
1160686538 19:439331-439353 CTGGGAAAGAGGGTGGTAGAGGG - Intronic
1160867650 19:1262825-1262847 CTGGCAACCGAGGAGGCAGCTGG - Intronic
1160928816 19:1560133-1560155 CTGTGAAAGGGGAAGGTAACAGG + Intronic
1161393188 19:4031879-4031901 CTGGCAAAGGGGCAGCTAGGAGG - Intronic
1161530375 19:4785380-4785402 CTGGCGCGGGGGCAGGTAGCGGG + Intergenic
1162291489 19:9784259-9784281 CTGGGCAAGGGGGATGTGGCAGG + Intronic
1162388487 19:10375259-10375281 CTGGGAATGGGGGAGGTAAGAGG + Intronic
1163906322 19:20152074-20152096 CTCGCAAAGGGGGATTTGGCAGG + Intergenic
1165253159 19:34556730-34556752 CTGACAGAGGGGTAGTTAGCAGG + Intergenic
1165421251 19:35723042-35723064 CGGGGAAAGGTGGAGGCAGCAGG + Exonic
1165427208 19:35752824-35752846 CTGGCAAAAGGTAAGGTGGCAGG + Exonic
1165957993 19:39514095-39514117 CAGGTAAAGGAGGAGTTAGCTGG - Intergenic
1166711748 19:44942172-44942194 CTGCCAAGCGGGGAGGTGGCCGG + Intergenic
1166785459 19:45364332-45364354 CTGGAGAAGGGGGAGAGAGCCGG + Intronic
1167727179 19:51224397-51224419 CGGGCACAGAGGGAGGTAGGGGG - Intergenic
1167900913 19:52621661-52621683 CAGGCTAAGGGGGAAGTAGGAGG - Intronic
1168078257 19:53992035-53992057 CTGGAAAAGGGGCCGGTGGCCGG - Intergenic
1168326186 19:55539619-55539641 CTGAGAAAGGGGGACGGAGCTGG + Intergenic
928091475 2:28377465-28377487 GTGGCCAAGGGGAAGCTAGCGGG - Intergenic
930025986 2:47029405-47029427 CTGGCAGTGGGGGAGCTGGCTGG + Intronic
931163791 2:59723254-59723276 CTGGAAAAGGAGGAGGAAGTAGG + Intergenic
931248776 2:60512427-60512449 GTGGCACAGGGGCAGGTAGAAGG - Intronic
931705986 2:64946525-64946547 CTGGCAAATGGGGAGGGTCCAGG + Intergenic
932336280 2:70933048-70933070 CTGGCAGAGGGGGCGGCAGTGGG - Exonic
932514879 2:72335311-72335333 CTTGCAAAGGAGGAGGGAGTGGG + Intronic
932865535 2:75337485-75337507 CTGGGAAAGGTAGAGGTAGGTGG + Intergenic
933840252 2:86280764-86280786 CTGGGAAAGTGGGAGATTGCGGG + Intronic
933840754 2:86284068-86284090 CAGGCCAAGGGGGAGGTGGCTGG + Intronic
934108819 2:88722889-88722911 ATGGCAAAGGGGGAAGAAGGAGG + Intronic
934766425 2:96882633-96882655 CTCCCAAAGGGAGAGGAAGCAGG - Intronic
935180497 2:100685616-100685638 CTTGGAAAGGGGGATGTGGCAGG - Intergenic
935208714 2:100920143-100920165 CTGTCAAAGGGGGAGGGAGTGGG + Intronic
935454387 2:103250206-103250228 CTGGCAAAAGGAGAGGGAGAAGG - Intergenic
936324197 2:111490958-111490980 ATGGCACAGGGGGAAGTTGCAGG + Intergenic
937038475 2:118802221-118802243 GTGGCAAGGAGGGAGGGAGCTGG + Intergenic
937613676 2:123893949-123893971 CTGGCAAGGGGGTATGCAGCAGG - Intergenic
937993625 2:127677583-127677605 CTGGAAAAAGGGGAGGTGGCAGG + Intronic
938631090 2:133168534-133168556 CAGGCAAAGCGGAAGGGAGCTGG - Intronic
938828685 2:135032654-135032676 CTCGCAGAGGGGGAGTTGGCAGG + Intronic
939305893 2:140410918-140410940 CTAGCAAAGGGGGAGGTGAAAGG + Intronic
940843082 2:158607516-158607538 GAGGCAAAGGGGTAGGTAGATGG + Intronic
943005943 2:182387371-182387393 CTGGCAGAGGGGGATTTGGCAGG - Intronic
943656314 2:190512689-190512711 CTGGCAAAGGGCCAGGGACCTGG + Intronic
944037345 2:195310753-195310775 CTGGCAGCAGGGGAGGTAGGTGG - Intergenic
944591299 2:201220312-201220334 CTGGCATAGAGGGAGGTGGGGGG + Exonic
944815411 2:203371969-203371991 CTCGCAGAGGGGGAGTTGGCAGG + Intronic
946171322 2:217897697-217897719 CTGGCACAGGGGCTGGTGGCAGG + Intronic
946198992 2:218060138-218060160 ATGGCAAGGGGTGAGGTACCAGG + Intronic
946490487 2:220144644-220144666 CTGCCAGAGGGTGAGCTAGCGGG + Intergenic
946695097 2:222348807-222348829 CTGGAAAAGGAGGTGGGAGCAGG - Intergenic
947861895 2:233366355-233366377 GTGGCGATGGGGGAAGTAGCTGG + Intronic
1169738406 20:8863039-8863061 CTTGCAAAGGGTGAGGGAGCTGG + Intronic
1170859507 20:20089754-20089776 CTGGCACAGGGGGCGGTGGCAGG - Intronic
1170914910 20:20613534-20613556 CAGGCACACAGGGAGGTAGCTGG + Intronic
1171962223 20:31503189-31503211 CTGGCTCATGGGGAGGCAGCAGG - Intergenic
1171973744 20:31580734-31580756 TTGGGAAGGGGGCAGGTAGCAGG - Intergenic
1172033147 20:31995544-31995566 CTGGCAACGGGGAAGGGAGGAGG - Intronic
1172257858 20:33535710-33535732 CTCGCAGAGGGGGAGTTGGCAGG + Intronic
1172279757 20:33700654-33700676 CTCGCAGAGGGGGATTTAGCAGG - Intergenic
1173098022 20:40056018-40056040 AAGGCAAAGGAGGAGGTAGAAGG + Intergenic
1173809721 20:45948489-45948511 CTGGCAATGAGAGAGGTGGCTGG - Intergenic
1174116894 20:48232418-48232440 CTGGGAGAGGGAGAGGTAGAGGG - Intergenic
1176623193 21:9072215-9072237 CTGGCACACAAGGAGGTAGCTGG - Intergenic
1177180431 21:17739086-17739108 CTAGGAAAGGGGGAGGTGGCAGG - Intergenic
1177491416 21:21830764-21830786 CTGGCAGAGAGGAAGGTAGCTGG + Intergenic
1183174458 22:36212633-36212655 CAGGCAGAGGGGGAGGAATCTGG - Intergenic
1183567069 22:38623159-38623181 CTGACAAAGGGTAAGATAGCAGG - Exonic
1184462277 22:44645975-44645997 CTGGCATTGGGGGAGGGAGCAGG - Intergenic
1185026693 22:48418052-48418074 CTGGCAAATCGGGAGGGAGAGGG + Intergenic
1185045966 22:48528903-48528925 CTGGAGAAGGGAGGGGTAGCAGG + Intronic
1185344433 22:50305173-50305195 CTGGCACAGGGTGAGGCAGGGGG + Intronic
950395043 3:12727796-12727818 CAGGGAAACGGGGAGGGAGCTGG + Intergenic
950708193 3:14796760-14796782 CTGAGAAAGGAGGAGGGAGCTGG - Intergenic
951290280 3:20866198-20866220 CTGGCAGAGGGGGATTTGGCAGG + Intergenic
953174419 3:40536610-40536632 GTGGCAAAGGTGGAGGGTGCTGG - Exonic
953551362 3:43906346-43906368 GTGGCAGAGGGGGAGGGAGAGGG + Intergenic
953856566 3:46503800-46503822 CAGGGAAAGGGGGAGGGTGCAGG - Intergenic
953918770 3:46937579-46937601 GTGGCAAAGGAGGCTGTAGCAGG + Intronic
959063581 3:101636418-101636440 CTGACAGAGGGGTAGTTAGCAGG - Intergenic
959620952 3:108398082-108398104 CTGGAAAAAAGGGAGGTAGGGGG + Intronic
961026160 3:123559881-123559903 CTTGCAAAGTGCGAGGTACCAGG + Intronic
961574019 3:127820376-127820398 CTGGCACAGGGGGAGGGTGGTGG - Intronic
969331895 4:6478627-6478649 CTGGCAAAGGGGGAGGTAGCAGG - Intronic
969413278 4:7043231-7043253 CTGGGAAAGGCGGCGGTGGCCGG + Intronic
971413066 4:26395641-26395663 ATGGCTAATGGGGAGCTAGCAGG - Intronic
971495031 4:27255131-27255153 CTGGCAAAATGGGAGGAAACTGG - Intergenic
971847036 4:31932265-31932287 CTGGCAAAGTGGTAGACAGCTGG - Intergenic
972296909 4:37747902-37747924 AAGGCAAAGGGGAAGGAAGCAGG + Intergenic
972852654 4:43070468-43070490 CTAGCACTGGGGGAGGCAGCTGG + Intergenic
973675002 4:53255253-53255275 CTCGCAGAGGGGGAGTTGGCAGG + Intronic
974346110 4:60683455-60683477 CTGGGATAGGGGGATGGAGCAGG - Intergenic
979811144 4:125037816-125037838 ATAGCAAATGGGGAGGAAGCCGG - Intergenic
982445922 4:155490607-155490629 GTGAGAAATGGGGAGGTAGCAGG + Intergenic
984913033 4:184692762-184692784 CTGGCAAAGTGTGAGGTAATAGG - Intronic
985444628 4:190015264-190015286 CGGGGAAAGAGGGAGGGAGCGGG - Intergenic
985645828 5:1084348-1084370 CTGGCGCGGGGGGAGGTTGCTGG - Intronic
986649430 5:9948925-9948947 GTGGCAAAGTGGGAGGCTGCAGG + Intergenic
988993478 5:36693154-36693176 CTGGCAGAAGGGGAGGTCGCTGG - Intergenic
992293790 5:75306667-75306689 CTGGCAAATGAGGAAATAGCTGG + Intergenic
993686319 5:90942623-90942645 CTGGCAAAAGGGGTGGTAACAGG + Intronic
995912536 5:117204626-117204648 CTGGCGAAGGGGGAGGGGGGGGG + Intergenic
996121754 5:119680900-119680922 CTGGCATAGGGGGAGCTTGTGGG + Intergenic
997380824 5:133436333-133436355 CTGGGTAAGGGGGAGGCAGTGGG + Intronic
997520916 5:134524494-134524516 CTGGCACATGGCGAGGAAGCGGG - Intronic
997531989 5:134587105-134587127 CTGGCAAGGGGGCATGCAGCAGG - Intergenic
998067718 5:139171654-139171676 CTCGCAGAGGGGGAGTTGGCAGG - Intronic
998359633 5:141573803-141573825 CAGGCAAAGGAGGAGGTGGGGGG + Exonic
998672961 5:144374501-144374523 CAGGCTAAATGGGAGGTAGCAGG + Intronic
999747129 5:154600896-154600918 CTGGCAAAGGGAGAAGGGGCAGG - Intergenic
1001309661 5:170601896-170601918 CTGGCAATGGGGAATGGAGCAGG + Intronic
1001617994 5:173057349-173057371 AGGGCAAAGGGCGAGGGAGCCGG + Intronic
1001667156 5:173442803-173442825 CAGGCTCAGGGGGAGGTAGTAGG + Intergenic
1001902189 5:175441877-175441899 CTGAAAAAGGAGGAGGCAGCTGG - Exonic
1002407096 5:179043498-179043520 CAGGCACAGAGGGAGGTGGCGGG - Intergenic
1002501413 5:179649863-179649885 CTGGCAGAGGGGGATTTGGCAGG + Intergenic
1002772853 6:304218-304240 CTGGCCAAGGGTGAGGTGGGCGG + Intronic
1004302104 6:14468012-14468034 TCAGTAAAGGGGGAGGTAGCTGG + Intergenic
1004552119 6:16658130-16658152 ATGACACTGGGGGAGGTAGCAGG + Intronic
1005738686 6:28771824-28771846 CTGACAGAGGGGTAGTTAGCAGG + Intergenic
1005901611 6:30221528-30221550 CTCGGAAAGGGGGATGTGGCAGG + Intergenic
1006830719 6:36966637-36966659 CTGGCAAAGGGAGGGGTGACAGG - Intergenic
1007733399 6:43965453-43965475 CTGGCTAAGAGGGAGGGAGATGG - Intergenic
1007761005 6:44133745-44133767 CTGGCAAAGGAGGGGGGAGTGGG - Intronic
1008592464 6:53008346-53008368 CTGGCATGGGGGGAGGTAAGGGG + Intronic
1010300508 6:74254556-74254578 CTGGCAGAGGGGGATTTGGCAGG + Intergenic
1012464045 6:99497247-99497269 ATGGGGAAGGGGGAGGTAGAGGG + Intronic
1012959690 6:105609433-105609455 CTGGTAAAGGGAGAGGAAGGAGG - Intergenic
1012983415 6:105853146-105853168 CTCGCAGAGGGGGAGTTGGCAGG + Intergenic
1013204949 6:107935743-107935765 CTCGCAGAGGGGGAGTTGGCAGG - Intronic
1014254161 6:119144800-119144822 CTGGCCTAGGGGGTGGTAGATGG + Intronic
1014694130 6:124597460-124597482 CTGGTATAGGGGAAGGTAGTAGG - Intronic
1018443952 6:163837995-163838017 ATGGGAAAGGGAGAGGGAGCAGG - Intergenic
1019549163 7:1593703-1593725 CTGGCCAAGGGGAAGGAAGGAGG + Intergenic
1019786816 7:2982440-2982462 CTGGGAAATAGGGAGGAAGCCGG + Intronic
1019930984 7:4222940-4222962 GAGGCCAAGGGGGAGGGAGCTGG + Intronic
1020039987 7:4994774-4994796 CTGGAAAAGGGAGAGGCAGGTGG + Intronic
1020461794 7:8435518-8435540 CGGGGAAAGGGGGTCGTAGCGGG - Intronic
1021388557 7:20063563-20063585 CTGGAAAAGGGAGAGGCATCTGG + Intergenic
1021745028 7:23731585-23731607 CTGGAAAAGGGGAAGGAAGGAGG - Intronic
1024115944 7:46193182-46193204 CTGCTAAAGGAGGATGTAGCAGG - Intergenic
1024270069 7:47635472-47635494 CTGGCAGAGGGCGGGGCAGCCGG + Intergenic
1026008613 7:66619155-66619177 CTCGCAGAGGGGGATGTGGCAGG + Intergenic
1026536837 7:71245470-71245492 TTGGAAAAGGGGGAGGCAGGTGG + Intronic
1028696216 7:93716271-93716293 CTGACAAGGGAGGAGGAAGCTGG - Intronic
1029058122 7:97768081-97768103 CAGGCAGAGGAGGTGGTAGCTGG + Intergenic
1030651270 7:112118758-112118780 TTGGCAAGGGGAGAGGAAGCAGG + Intronic
1031959732 7:127977917-127977939 CTGGAAGAGGAGGAGGTAGGTGG + Intronic
1032197276 7:129796599-129796621 CTGGGAGAGGGGCAGGCAGCAGG + Intergenic
1032464352 7:132134533-132134555 CTGGAAAATGGGGAGGCAGAGGG + Intronic
1033494095 7:141876713-141876735 CTGGCAAAAGGGCAGGGTGCTGG + Intergenic
1033608940 7:142947167-142947189 CAGGGACAGGAGGAGGTAGCTGG + Intronic
1034207738 7:149332603-149332625 CTGGCAGAGGGGGATTTGGCAGG + Intergenic
1034283049 7:149866726-149866748 CTGACAAAGGGGAACGGAGCAGG - Exonic
1034394083 7:150807022-150807044 CTGGGAGAAGGGGAGGAAGCAGG - Intergenic
1034536600 7:151729394-151729416 CTGGCAAAAGGAGAGGTGGGTGG + Intronic
1035654351 8:1294196-1294218 CTGGCAAGGGGAGAGGTGGGAGG - Intergenic
1036421691 8:8602087-8602109 CTGACAAAGGGGAAGGAAACAGG - Intergenic
1036640439 8:10580104-10580126 CAGGGAAAGGGGGAGGCAGGTGG + Intergenic
1039152973 8:34528029-34528051 CTCGCAGAGGGGGAGTTGGCAGG + Intergenic
1040370143 8:46762310-46762332 CAGGCAGAGGAGGTGGTAGCTGG - Intergenic
1040412562 8:47169197-47169219 ATGGCAGAGGGTGAGGAAGCAGG - Intergenic
1041111437 8:54486585-54486607 CATGCAAAGATGGAGGTAGCAGG + Intergenic
1041373695 8:57191323-57191345 AAGGCAAAGGGGGTGGTAGAGGG - Intergenic
1042424335 8:68629454-68629476 CTGGAAAAGGGAGATGTGGCAGG - Intronic
1045254119 8:100505437-100505459 CTTGCAAAAGGGGAGCTGGCAGG - Intergenic
1045277431 8:100721167-100721189 GTCGCAAAGGAGGAAGTAGCCGG + Intronic
1046922695 8:119749798-119749820 ATGGGGAAAGGGGAGGTAGCTGG - Intronic
1048371759 8:133784536-133784558 CAGCCAAAGGGGCAGGTAGGTGG - Intergenic
1049591560 8:143465200-143465222 CTGGCAAGGGTGGAGTGAGCTGG - Intronic
1049618504 8:143587151-143587173 CTGGCTTAGTGGGAGGCAGCTGG - Intronic
1050366430 9:4877801-4877823 CTCTGAAAAGGGGAGGTAGCGGG - Intronic
1052416463 9:28184182-28184204 ATGGGAAAAGGGGAGGTAGGTGG + Intronic
1052812148 9:33070866-33070888 CTGGGAAGGGTGGAGGTGGCGGG + Intronic
1053209164 9:36213056-36213078 CTTGGAAACGGGGAGGTAGCAGG - Intronic
1053417104 9:37953676-37953698 CTAGCACAGAGGGAGGTAGGAGG - Intronic
1053424953 9:38004473-38004495 CTGGCAAAGGTGGGGGGACCAGG + Intronic
1056762796 9:89426972-89426994 GTGGCAAAGGGGGAACTCGCTGG - Intronic
1057796660 9:98162563-98162585 CATACAAAGGGAGAGGTAGCTGG - Intronic
1059780514 9:117521521-117521543 TTGGCAATGGGGGTGGTTGCTGG + Intergenic
1061492088 9:130950958-130950980 CTCCCAAAGGGCGAGGGAGCTGG - Intergenic
1061621353 9:131813220-131813242 CTGACAAAGGATGAGGTGGCAGG + Intergenic
1061855235 9:133438352-133438374 CTGGCAGAGCGAGAGGTAGGCGG + Exonic
1061991524 9:134161842-134161864 CTGGCAGTGGGGGAGGCAGCCGG + Intergenic
1062190334 9:135244768-135244790 CTGGCAAAGAGGCAGGTGGGAGG + Intergenic
1062537084 9:137025779-137025801 ATAGCAATGGGGGAGGCAGCCGG - Intronic
1062707898 9:137955323-137955345 CTGGCACAAGGGGAGGGAGGAGG + Intronic
1203746377 Un_GL000218v1:42642-42664 CTGGCACACAAGGAGGTAGCTGG - Intergenic
1185582024 X:1217111-1217133 CTGGGAAAAGGGGAAGTGGCCGG + Intergenic
1186383832 X:9089367-9089389 CTTGCAAAGGGGTGGGTAGGGGG - Intronic
1189195202 X:39146914-39146936 CTGGAACAGTGGGAGGTAGAAGG + Intergenic
1189398767 X:40646517-40646539 CTGGGAATGGGGTAGGCAGCCGG - Intronic
1192091225 X:68158651-68158673 CAGGGGAAGGGGGAGGGAGCAGG - Intronic
1193793144 X:85841102-85841124 CTGGCAGTGGTGGTGGTAGCAGG - Intergenic
1193861274 X:86671582-86671604 AAGGCAAAGGGGAAGGAAGCAGG - Intronic
1196316331 X:114229192-114229214 CTGGCCAAGGAGGAGGGAGGAGG - Intergenic
1196554325 X:117069748-117069770 CGGGGGAAGGGGGAGGAAGCTGG + Intergenic
1197455900 X:126674878-126674900 CTGGCAGAGGGGGATTTGGCAGG - Intergenic
1198414302 X:136404250-136404272 CGGGCAAAGGGGGAGGATGGAGG - Intronic
1199086748 X:143636233-143636255 CTGGGGAAGGGGGTGGTAGTTGG + Intergenic
1199944128 X:152652212-152652234 CTGCGAAGGAGGGAGGTAGCTGG - Intronic
1200100093 X:153685924-153685946 CTGGCAAAGGGCGGGGAAGAAGG + Intronic
1200781518 Y:7220594-7220616 CTGGCACAGGGAGATGTAGGAGG - Intergenic
1201159709 Y:11157656-11157678 CTGGCACACAAGGAGGTAGCTGG - Intergenic
1201335924 Y:12879505-12879527 CTCGCAAAGGGGGATTTGGCAGG - Intergenic