ID: 969334542

View in Genome Browser
Species Human (GRCh38)
Location 4:6499920-6499942
Sequence ACTTGGAAGAAGAAAGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 776
Summary {0: 1, 1: 0, 2: 5, 3: 73, 4: 697}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969334542_969334547 5 Left 969334542 4:6499920-6499942 CCTTCCCCTTTCTTCTTCCAAGT 0: 1
1: 0
2: 5
3: 73
4: 697
Right 969334547 4:6499948-6499970 CACCACCAGTGATTAGACACAGG 0: 1
1: 0
2: 0
3: 6
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969334542 Original CRISPR ACTTGGAAGAAGAAAGGGGA AGG (reversed) Intronic
900558136 1:3290229-3290251 ATTTGGAAGTAGACATGGGAAGG + Intronic
900666580 1:3819612-3819634 AGATGGAAGGAGAAAGGGCAGGG + Intronic
900758061 1:4451241-4451263 ACTGGGAAGGAGGAAGGGGCTGG - Intergenic
901161859 1:7183638-7183660 ACTGTGAAAAAGAAAGAGGATGG + Intronic
901232775 1:7650462-7650484 ACTTGCAAGAAGAAAGAATACGG + Intronic
901337396 1:8462934-8462956 ACTGGGAGGAAAAAAGGGGGAGG + Intronic
901376574 1:8843852-8843874 AATTGGAAAGAGAATGGGGAAGG - Intergenic
901750624 1:11405142-11405164 AATTGAAAGAAGAAAGGAGGGGG - Intergenic
901765809 1:11499333-11499355 CCTTAGAAGAAGAAAGCTGATGG - Intronic
902353148 1:15873680-15873702 ACTTGGATGAAGAAGAGAGAAGG + Intronic
902449105 1:16485379-16485401 GCTGGGAGGAAGAAATGGGATGG + Intergenic
902505639 1:16937902-16937924 GCTGGGAGGAAGAAATGGGATGG - Intronic
902682341 1:18052191-18052213 ACAAAGAAGAAGAAAGGGGGGGG - Intergenic
902688967 1:18097723-18097745 TCAGGGAAGAAGAAAGGAGAAGG - Intergenic
903017187 1:20368840-20368862 ATTTGAAAGAAGAAAGAGGGTGG + Intergenic
903491845 1:23735003-23735025 GAGTGGAATAAGAAAGGGGAAGG - Intergenic
903690918 1:25172990-25173012 ATTTATAAGAAGAAAGGTGAAGG + Intergenic
904269771 1:29342360-29342382 ACCTGGGAGAAGAATGGGGAAGG - Intergenic
904538363 1:31216121-31216143 GCTGGGAAGATTAAAGGGGAGGG + Intronic
904552259 1:31328824-31328846 ACTTCTAGGAAGAAAGAGGAGGG - Intronic
905186092 1:36197902-36197924 TCTTAGAAGAAAACAGGGGAAGG - Intergenic
905950762 1:41948630-41948652 ACTCAGAAGAAGAAATGGAATGG + Intronic
906128300 1:43441160-43441182 ACTGGGAAGAGGAAAGGTGTGGG - Intronic
906779185 1:48557263-48557285 CCTAGGAAGAAGAAAAGGAATGG - Intronic
907155252 1:52327667-52327689 CCATGGGAGAAGAAAAGGGAAGG + Intronic
907343135 1:53751784-53751806 AACAGGAAGAAGGAAGGGGAGGG - Intergenic
908840755 1:68277966-68277988 GCTTAGAAGATGAATGGGGATGG - Intergenic
909052910 1:70788940-70788962 AAATGGGAAAAGAAAGGGGAAGG + Intergenic
909059687 1:70865946-70865968 ACTTTGAAGAAGAAATGAGTAGG - Intronic
909253659 1:73390571-73390593 AGTTAGAAGAAGAAGGAGGAAGG - Intergenic
909404089 1:75266922-75266944 ACTAGGAAGAGGAATGGTGACGG + Intronic
909620782 1:77664267-77664289 ACCTTAAAGAAGAATGGGGAGGG + Intronic
909775843 1:79483727-79483749 CTTTGGAAGAAGAAAGGCAAAGG + Intergenic
910447484 1:87313366-87313388 ACTAGAGAGGAGAAAGGGGATGG + Intergenic
910508052 1:87972569-87972591 ATCTGGAAAAAGAAAAGGGAAGG + Intergenic
911721211 1:101193272-101193294 ACTTGGAAGAATGAAGTGGGAGG + Intergenic
912595874 1:110875284-110875306 ACTTGGCACCAGAAAGTGGAGGG + Intronic
912716413 1:111987127-111987149 ACTAGGAGAATGAAAGGGGAAGG - Intronic
912843477 1:113059534-113059556 CCTTGGAAGGATAAAGGGGCAGG + Intergenic
913069975 1:115289981-115290003 AATTGGAAGAAGAGAGATGAGGG - Intronic
913343746 1:117787047-117787069 ACCTGAAAGAGGAAAGGGCAAGG - Intergenic
913940199 1:125096235-125096257 ACCTGCAAGGAGAAAGAGGACGG + Intergenic
914688224 1:150001653-150001675 ATTTGGGAGAAGGAAGGGGTGGG - Intronic
914856651 1:151356921-151356943 ACTTGGAAGATGAAAGTGGGAGG + Intergenic
915166528 1:153951203-153951225 ACATGGCAGGAGAAAAGGGAAGG + Intronic
915419735 1:155770419-155770441 ACTTGGAAGGCTAAAGTGGAAGG + Intronic
916291063 1:163166685-163166707 TTCTGGAGGAAGAAAGGGGATGG + Intronic
916427937 1:164699603-164699625 ACTATGAAGATGAAAGGGGGAGG + Intronic
916504593 1:165416704-165416726 TATTGGAAGAAAAAAGGAGACGG + Intronic
916805950 1:168261344-168261366 AGATGGAAGATGAAAGGGGGAGG - Intergenic
917034821 1:170736621-170736643 ACTGGGAAGAGGACAGGGTAAGG - Exonic
917554348 1:176068209-176068231 AGAAGGAAGAAGGAAGGGGAAGG - Intronic
917651372 1:177081187-177081209 ACCTGGAGGAAGAAAGGTCAAGG + Intronic
918496962 1:185150948-185150970 AAATGGAAGAAGGAAGTGGAAGG + Intronic
918595640 1:186289587-186289609 ACTTGGAGGAACAAAGGGTCTGG + Intergenic
919016777 1:192048585-192048607 AAGAGGAAGAAGAAAGGAGAAGG + Intergenic
919743691 1:200995391-200995413 ACTTGGAAGGTCCAAGGGGAGGG + Intronic
920830632 1:209462079-209462101 AGCTGGAAGTAGAAAGGAGAAGG + Intergenic
920858078 1:209679663-209679685 ACTTGGGGGGAGATAGGGGAGGG - Intergenic
920913318 1:210237344-210237366 CTTTGGGAGAAGAAAGTGGAGGG + Intronic
921046318 1:211480227-211480249 ATCTGGAGGAAGAAAGGGGAGGG + Intronic
921147993 1:212377706-212377728 GCTTGGAGGAAGGAAGGAGAAGG + Exonic
921275305 1:213513168-213513190 ACTTTGAAGATGAAGGAGGAGGG + Intergenic
921357544 1:214299982-214300004 ACTAGGAAGGAGAGAGGGGAGGG + Intronic
921764882 1:218959865-218959887 ACCTGAGAGAAGAAAGGAGAGGG + Intergenic
921888486 1:220329893-220329915 ACTGGGAAGAGGGAAGGAGAAGG + Intergenic
922023635 1:221730077-221730099 AATTGAAAGGAGAAAGAGGAGGG - Intronic
923226019 1:231939660-231939682 GCTTGGAAGAAGAGGGAGGATGG - Intronic
923791251 1:237113018-237113040 TCTTGGATGCAGAAAGGAGAAGG - Intronic
923837487 1:237628880-237628902 CCTTGGAAAAAGAAGGGGTAGGG + Intronic
924002742 1:239571785-239571807 ACTTGTAAGAGAAAAGGAGATGG - Intronic
924511076 1:244729771-244729793 ACTTAGAAGAACAAAGGGAAAGG - Intergenic
1063099822 10:2940040-2940062 ACTTGGAAAAAAAAAGGTGGAGG - Intergenic
1063103819 10:2975102-2975124 ACTTGGATGAAGGAAGGTGCTGG - Intergenic
1063105267 10:2986997-2987019 ACCTGGGAGCAGAAAGGAGAAGG - Intergenic
1063201982 10:3792936-3792958 ACTGAGAGAAAGAAAGGGGAAGG + Intergenic
1063228446 10:4039682-4039704 AATAAGAAGAAGAAAGAGGAGGG - Intergenic
1063361755 10:5465135-5465157 ACATGGCAGAAGAAATGGAAAGG - Intergenic
1063464805 10:6236189-6236211 ACATGGAAGAAGCCAGGAGATGG - Intergenic
1063505440 10:6593824-6593846 ACTGGGAAGAGGGATGGGGAGGG - Intergenic
1063535433 10:6878113-6878135 ACCCGGAGGAAGAAAGAGGAGGG - Intergenic
1063812918 10:9734761-9734783 ACTTGGAAAGAGAGAGGGAATGG - Intergenic
1063884603 10:10564596-10564618 TCTTAGAAGAGGAAAGGGCAAGG - Intergenic
1063968776 10:11367159-11367181 AGTTGGGAGGAGAAGGGGGAGGG - Intergenic
1064460333 10:15529002-15529024 ACAGGGAGGAAGGAAGGGGAAGG - Intronic
1064665928 10:17651188-17651210 ACCTGCAAGAAAAAAGTGGAAGG - Intronic
1064735588 10:18378873-18378895 AGTTGGGAGCAGAAAGAGGAAGG - Intronic
1065638681 10:27757528-27757550 ACATGGCAGAAGAATGGGAAGGG + Intergenic
1066162619 10:32750433-32750455 ACCTTGAAGAGGAAAGGAGAAGG + Intronic
1066259634 10:33716648-33716670 AAGGGGAAGAAGAAAGAGGAAGG - Intergenic
1067751374 10:48973945-48973967 ACTGGGAAGAAGAAAAGGGGAGG - Intronic
1068656136 10:59578011-59578033 ACTTGGAGGAAAATGGGGGAAGG - Intergenic
1068733641 10:60387789-60387811 ACTTGGAAGCAAAATAGGGAAGG - Intronic
1068846424 10:61680867-61680889 ACAGGGAAGAAAGAAGGGGAAGG + Intronic
1068901345 10:62272973-62272995 GCTTGGGAGAAGTAAGGGGTAGG + Intergenic
1069054856 10:63834125-63834147 ACTTGGAAAAAGGAAGATGATGG + Intergenic
1069263179 10:66425580-66425602 ACTTGGGAGAAGGAAGAGGAAGG - Intronic
1069575423 10:69523910-69523932 ACTTGTCAAAGGAAAGGGGATGG + Intergenic
1070760226 10:79019644-79019666 ACTCGGGAGTTGAAAGGGGAAGG - Intergenic
1070902931 10:80046718-80046740 ATGTAGAAGAAGGAAGGGGAAGG + Intergenic
1071854593 10:89610799-89610821 ACATGGAAGAAGGAAGGGTTGGG - Intronic
1072539565 10:96388028-96388050 CCTAGGAAGAAGAAAGGATATGG + Intronic
1072575182 10:96693054-96693076 ACATGGAAGAACAGAGGGGCAGG - Intronic
1072745487 10:97936365-97936387 ACCTGGAGGAGGAATGGGGAGGG + Exonic
1073144972 10:101274531-101274553 ACCTGAGAGAAGAAAAGGGATGG + Intergenic
1073758963 10:106610219-106610241 CCTTGGAATAAGGAAGAGGATGG + Intronic
1074039009 10:109769744-109769766 ACTTGGCAGATGAAAGGAGCTGG + Intergenic
1074062628 10:109981300-109981322 ACCTGGAAAGGGAAAGGGGATGG + Intergenic
1075236312 10:120732921-120732943 AGTAGGCAGAAGAAAGTGGAAGG + Intergenic
1076277628 10:129217278-129217300 ACTTGGGAGAAGATAGAGGTAGG + Intergenic
1076418744 10:130312762-130312784 ACTTGGAAGAATGGAGGGGATGG + Intergenic
1076821668 10:132942731-132942753 GGCGGGAAGAAGAAAGGGGAGGG + Intronic
1077786021 11:5384278-5384300 ACTTGGAAGAATAAGGTGGGAGG - Intronic
1077885626 11:6385524-6385546 ACTTAGTAGGAGAAAGGGAAAGG + Intergenic
1078407578 11:11084049-11084071 AATTGGAAAAAGAAAGAGAAAGG - Intergenic
1078432623 11:11299472-11299494 ACTTGGAGGAAGAGGTGGGAGGG - Intronic
1078634367 11:13035120-13035142 ATTTGGAAAAGGAGAGGGGATGG + Intergenic
1078637455 11:13065365-13065387 ACTTTGAAGAAACACGGGGAAGG - Intergenic
1079069719 11:17333576-17333598 TCCTGTAAGAACAAAGGGGATGG - Intronic
1079734328 11:23976572-23976594 ATATGGATGAAGAAAAGGGAAGG - Intergenic
1080463807 11:32478574-32478596 ACTTGGAGGAAAAAAAGAGATGG + Intergenic
1080510885 11:32970063-32970085 ACTTTGAATAAGAAAGGCTACGG - Intronic
1080687837 11:34530170-34530192 ACTTGGAAGAAGAGAAGGTGAGG + Intergenic
1081168550 11:39837465-39837487 AGTTGGAAAAAAAAAGAGGAAGG + Intergenic
1081527144 11:43934971-43934993 AGATGGAAGCAGAGAGGGGAGGG - Intronic
1081739179 11:45426126-45426148 AACAGGAAGAAAAAAGGGGAGGG - Intergenic
1081755658 11:45542448-45542470 GCTTGGATGAAGAGATGGGATGG + Intergenic
1081814615 11:45931535-45931557 CCTGGGAAGATGAAAGGCGATGG + Intronic
1083045297 11:59729140-59729162 ACAAGGAGGAAGGAAGGGGATGG - Intronic
1083799273 11:65037035-65037057 AGTGGGAAGAAGGAATGGGAGGG + Intronic
1084210177 11:67617168-67617190 ACTGGGGAGAAGAGAGGAGAGGG - Intergenic
1085356257 11:75840396-75840418 ACCTGGCAGAAGAATGGGGCGGG + Intronic
1085646066 11:78223712-78223734 ACTAGCAAGAAGAAACAGGAAGG + Intronic
1085713354 11:78850690-78850712 AGGTGGAAGGAGAAAGAGGATGG + Intronic
1085880881 11:80464643-80464665 ACTTGGAGGCAGAAGAGGGAAGG - Intergenic
1086050960 11:82589756-82589778 ACTTGAGAGAAGAAACAGGAGGG + Intergenic
1086217431 11:84400681-84400703 AATTTGAACAAGAAAGGGAAAGG - Intronic
1086855440 11:91860106-91860128 ATGTGGAAGAGGAAAGTGGAGGG - Intergenic
1087346185 11:96973769-96973791 ATTGGGAAGAGGAAAGGGGAAGG + Intergenic
1087762835 11:102120637-102120659 AATTGGAAGAAGACAAAGGAAGG - Intronic
1087820533 11:102706690-102706712 AATTGGTAGAAGAAAAGGGGAGG - Intergenic
1087953422 11:104254342-104254364 ATTTTGAAGAAGAGAGGGGCTGG - Intergenic
1088422637 11:109666162-109666184 AATTGGCAGAAGAAAGAGGAAGG - Intergenic
1088688981 11:112308952-112308974 ACCTGGCAGGAGAAAGGGAATGG + Intergenic
1088791794 11:113232905-113232927 ATTGGGAAGAAGAAAGGGCCAGG + Intronic
1088821636 11:113461984-113462006 GTTTGGAGGAAGAGAGGGGAAGG - Intronic
1088940589 11:114451354-114451376 ACTGAGAAGGAGAAAGGGGAGGG - Intergenic
1088973961 11:114798392-114798414 TCTGGAAAGAAGAAAAGGGAAGG - Intergenic
1089459052 11:118642123-118642145 AAGAGGAAGAAGGAAGGGGAAGG - Intronic
1089715219 11:120352934-120352956 AGTGGGAAGAAGAAGGGGAATGG - Intronic
1090415045 11:126534880-126534902 GCTGGGAACAATAAAGGGGAGGG + Intronic
1091175612 11:133554802-133554824 CCTTAGAAGATGAAAGGGCATGG - Intergenic
1091192652 11:133707595-133707617 AAAGGGAAGAAAAAAGGGGAAGG + Intergenic
1092337148 12:7643178-7643200 ACTTGGATTAAGCAAGGGAAAGG + Intergenic
1092659168 12:10721128-10721150 GCTTGGCAAAGGAAAGGGGATGG + Intronic
1093548283 12:20373037-20373059 TCTTGAAAGAAAAAAAGGGAGGG - Intronic
1093814428 12:23527949-23527971 ATTTGGTAGAAGAAAGAGGGTGG + Intergenic
1093863610 12:24198230-24198252 AATTGTAAAAAGAAAGGAGAGGG + Intergenic
1093905847 12:24691116-24691138 ACTTGGGGGGAGAAAGGGGAGGG + Intergenic
1093926027 12:24909301-24909323 ACATGGCAGGAGTAAGGGGAGGG - Intronic
1094137798 12:27147614-27147636 ATTTGCAAGATGAAAGGAGAAGG + Intergenic
1094357108 12:29589615-29589637 ATCTGGTAGAACAAAGGGGAAGG + Intronic
1094527831 12:31244329-31244351 ACTAGGAAGGAGAATGGGAAGGG + Intergenic
1094634281 12:32209547-32209569 ACTTGTAGGAAGAAAAGGGTTGG - Intronic
1094742610 12:33307061-33307083 ACTTGTAAAGAGAAAGGGAAAGG + Intergenic
1095218147 12:39574582-39574604 ACTTGAAAGAAGAAAGGGAAAGG - Intronic
1095350393 12:41203798-41203820 ACTTTGAAGAAATTAGGGGAAGG + Intronic
1095599101 12:43994799-43994821 ACTGGGAAGAGGAATTGGGATGG + Intronic
1095603931 12:44044903-44044925 ACTTGGAAGAAGCATGGTCAGGG + Intronic
1095960339 12:47830499-47830521 TTTTGGAAGAGGAAAGAGGAAGG - Intronic
1096521051 12:52184895-52184917 ACCAGGAAGCAGGAAGGGGATGG - Intronic
1096745018 12:53721176-53721198 ATTTGGAAGAAGAGAATGGATGG - Intronic
1097048848 12:56208446-56208468 GCTTGGACGAAGAAAGTGAAGGG - Intronic
1097077082 12:56403034-56403056 ACTTGGAAGAGGTATGTGGATGG + Intergenic
1097248856 12:57621432-57621454 GGGTGGAAGAAGAAAGGAGAAGG + Intronic
1097271008 12:57773982-57774004 ACTTGGAAAAGGAAAAGGTAAGG + Intronic
1097922076 12:65086633-65086655 ACTTGGGAGAAGAAGGGAGAGGG + Intronic
1098038595 12:66332299-66332321 AATGGGAACAAGAAAGGGGAGGG - Intronic
1098231129 12:68372919-68372941 ATTTGGTAGAGAAAAGGGGAAGG + Intergenic
1098307349 12:69115360-69115382 AGGAGGAAGAAGAAAGGAGAAGG + Intergenic
1098603973 12:72367423-72367445 AGCTGGAAGGAGGAAGGGGAAGG - Intronic
1098608462 12:72423896-72423918 ACTTTGAAGATGGAGGGGGAGGG + Intronic
1100178087 12:92053365-92053387 AATAGGAAGAAGAAATGGTAAGG - Intronic
1100738181 12:97561514-97561536 ACATGAAAGGAGGAAGGGGAGGG + Intergenic
1101056031 12:100914921-100914943 ACTTGGGAGACTAAAGCGGAAGG - Intronic
1101196368 12:102386897-102386919 CCTTGGGATGAGAAAGGGGAAGG + Intergenic
1101994457 12:109514898-109514920 AAAAAGAAGAAGAAAGGGGATGG - Intronic
1102185219 12:110942336-110942358 CCTAGGAAGGATAAAGGGGAGGG - Intergenic
1102928661 12:116845924-116845946 ACTGGGCAGAAGAGAGGGGATGG - Intronic
1103216849 12:119208281-119208303 ACTTGGGGGAAGGAAGGGAAGGG - Intronic
1103328602 12:120138170-120138192 TCTTGGAAGACAACAGGGGAAGG + Intronic
1103737968 12:123072489-123072511 TCTTGGGAGAAGACAGGAGAGGG - Intronic
1105433829 13:20360600-20360622 AGTTGGATGAGGAAATGGGAAGG - Intergenic
1105782693 13:23718033-23718055 TCTGGGAAGAAGGAAGGGAAGGG - Intergenic
1106481986 13:30143572-30143594 ACCAGGCAGAAGAAAGGGGAGGG - Intergenic
1106575628 13:30971887-30971909 AGTTGGAGGAAGAGATGGGAAGG - Intronic
1106664502 13:31837460-31837482 ACAAGGAAGGAGAAAGTGGAGGG + Intergenic
1107035498 13:35898111-35898133 TCTTGGAAGCAGTAATGGGAGGG - Intronic
1108018954 13:46105699-46105721 ACTTTCAAGATGATAGGGGATGG - Intergenic
1108477103 13:50831136-50831158 AGAGGGAAAAAGAAAGGGGAAGG + Intronic
1108835486 13:54541625-54541647 TCTTGAAAGAAGCAAGGGCAGGG - Intergenic
1108965236 13:56290341-56290363 ACATGGAAGAAGAAAGAGAAAGG + Intergenic
1110743341 13:79023282-79023304 ATTGGGAAGAAAAAATGGGATGG + Intergenic
1110903797 13:80860291-80860313 ACTTGAAAGAAGAAAGTTTAAGG - Intergenic
1110939967 13:81337833-81337855 AGTTAGCAGAAGAAAAGGGAAGG - Intergenic
1112064360 13:95776883-95776905 ACATGGGAAAAGAAAGGGGAAGG - Intronic
1112143574 13:96673059-96673081 AACTGGAAAAAGAAAGGAGAGGG - Intronic
1112641372 13:101279407-101279429 CATTGGAAGAAGAATGAGGAAGG + Intronic
1112863552 13:103865174-103865196 ACTTGGAAATAGAAAGGAAAAGG + Intergenic
1112926433 13:104680441-104680463 CCTTGGAAGAGGAAAGTGGAAGG - Intergenic
1113270914 13:108673347-108673369 AAAAGGAAGAAGAACGGGGAGGG - Intronic
1113437965 13:110307618-110307640 GCTTGGGAGTAGAAAGGGGGAGG + Intronic
1113592396 13:111510424-111510446 GCTTGGAAGAAGACATGGCATGG + Intergenic
1113873315 13:113578296-113578318 ACTTGGAAGGAAGAAAGGGAGGG - Intergenic
1114263983 14:21060416-21060438 ACTGGGAAGAAGCCAGGGGATGG - Intronic
1114395431 14:22354807-22354829 ACTTGGACACAGGAAGGGGAAGG + Intergenic
1114704691 14:24713349-24713371 ACATGGAGGAGGGAAGGGGAAGG + Intergenic
1115037420 14:28875380-28875402 ACTTGGGAGAAGAAGGAAGAGGG + Intergenic
1115165899 14:30448479-30448501 AATGGGAAGATGAAAGGGAAAGG - Intergenic
1115211889 14:30975393-30975415 ACTTGAGAGAAAAAATGGGAGGG + Intronic
1115752216 14:36504599-36504621 AAATGGGAGAAGGAAGGGGATGG + Intronic
1116063097 14:39948611-39948633 CCCTGGAAGCATAAAGGGGAGGG + Intergenic
1116863873 14:50015849-50015871 ACATGGCAGAAGAGAGGGAAGGG - Intergenic
1118459984 14:65978825-65978847 ACTGGGTAGCAGACAGGGGATGG + Intronic
1118787760 14:69060280-69060302 ACTGGGAAGAACAAAGGGCAGGG + Intronic
1118844320 14:69535340-69535362 ACCTGGAAAAGGAAAGGGTAGGG - Intergenic
1119354779 14:73997062-73997084 GCTTGGAAGGGGAAAGGTGAAGG + Intronic
1119472022 14:74906346-74906368 ACTTGGGAGAGCAAAAGGGAGGG - Exonic
1119876499 14:78064250-78064272 ACATGGCAGAAGAGATGGGAGGG - Intergenic
1119925383 14:78488764-78488786 ATGAAGAAGAAGAAAGGGGAGGG + Intronic
1120281612 14:82445879-82445901 ATCTGGAAGAAGAAAAAGGATGG + Intergenic
1120417089 14:84233029-84233051 AGTAGAAAGAAGAAAGGAGATGG + Intergenic
1120609501 14:86623029-86623051 ACATGGCAGAAGAAATGGAAGGG + Intergenic
1120622680 14:86784407-86784429 TTTTGGAATAAGAAATGGGAAGG + Intergenic
1120757914 14:88261454-88261476 CCATGAAAGAAGAAAAGGGATGG + Intronic
1120852750 14:89186167-89186189 ACTTGGAAGCACACTGGGGAGGG + Intronic
1120891554 14:89496342-89496364 CCTTGGGAGAAGAAATGGGTGGG - Intronic
1121173338 14:91872379-91872401 AGTGTGAAGAAGAAAAGGGATGG + Intronic
1121643130 14:95499724-95499746 GCTGGGGAGAAGAAAGGGGCAGG - Intergenic
1122492874 14:102131643-102131665 ACTTGAAAGAAGTAAGGAGGTGG - Intronic
1125537692 15:40451832-40451854 ACTGGGAAGAAGCTGGGGGAAGG + Intronic
1125687633 15:41572876-41572898 ACTGGAAGGAAGGAAGGGGATGG - Intronic
1125697662 15:41652314-41652336 AGGTGAAAGAAGAGAGGGGAGGG - Intronic
1125934809 15:43625917-43625939 TGTTGGAGGAAAAAAGGGGAAGG + Intergenic
1126599263 15:50412728-50412750 ACTTGGGAGGAGAAGGGAGAGGG - Intergenic
1126690050 15:51281925-51281947 AAATGGAAGCAGAAAGGGAAGGG + Intronic
1127573229 15:60264473-60264495 ACAAGGAAGAAGAAAAGGAATGG + Intergenic
1127835428 15:62787189-62787211 ACATGGAAGAAAAAAGTGGCTGG - Intronic
1127973254 15:63978716-63978738 ACTTGGAAGGAGATGGGGGGTGG - Intronic
1128095628 15:64952432-64952454 ACTAAGAAGAAGAAAGGAGGAGG - Intronic
1128120892 15:65145303-65145325 ACATGTAACAAGAAAGAGGAGGG - Intergenic
1128225380 15:65997956-65997978 TCTAGGAAGAAGAAAGGGCCCGG + Intronic
1128232485 15:66045351-66045373 GCTTGGCAGGAGAGAGGGGAGGG + Intronic
1128404847 15:67325158-67325180 AGTAGGCAGAAGAAAGGGTAGGG - Intronic
1128416065 15:67447258-67447280 ACTTGGGAAAGGAAAGAGGAAGG - Intronic
1128790491 15:70429958-70429980 CCCTGGAGGAAGAAAGAGGAGGG + Intergenic
1128875676 15:71199252-71199274 AATTGAAAGGAGGAAGGGGACGG - Intronic
1129753951 15:78084625-78084647 TCTAGGAAGCAGAAAGGTGAAGG - Intronic
1129966167 15:79737743-79737765 TCTTGGGAGAAGAGAGGGAAAGG - Intergenic
1130119814 15:81038184-81038206 ACATGGAGGAGGAAAGAGGAGGG + Intronic
1131289721 15:91096663-91096685 ACTTGGAAGAAGAAAAAAGGTGG + Intergenic
1132032615 15:98450810-98450832 ACCTGAAACAAGAAAGAGGAGGG + Intronic
1132034995 15:98475111-98475133 ACTTATAGGAAGAGAGGGGAAGG + Intronic
1132277731 15:100583599-100583621 TCTTGGAATAAAAAAGGGTATGG - Intronic
1132333441 15:101027925-101027947 AGAGGGAAGAAGGAAGGGGAGGG - Intronic
1132412970 15:101598982-101599004 TCTTTGAAGAGGAAAAGGGAAGG - Intergenic
1132977534 16:2718043-2718065 GCTTGGAAGGAGCAAGGGGTCGG - Intronic
1133108278 16:3528492-3528514 ACATGGAACTAAAAAGGGGAGGG - Intronic
1133444346 16:5847234-5847256 AGTTGGTAGAAGTAGGGGGAAGG + Intergenic
1133510720 16:6454784-6454806 AATGGGAAGAAGCAAGGGGAGGG - Intronic
1133749483 16:8713311-8713333 CCCTGGAAGGAAAAAGGGGAGGG + Exonic
1133971551 16:10571760-10571782 ACTGAGATGAAGAGAGGGGATGG + Intronic
1134038684 16:11051450-11051472 ACTTGGAAGGAGGAAGGGGCCGG - Intronic
1134040397 16:11063971-11063993 GATTGGAGGAAGAAAGGGGAAGG + Intronic
1134449426 16:14354283-14354305 ACAGGGAAGGGGAAAGGGGAGGG + Intergenic
1134543992 16:15093832-15093854 ATTTGGACGAAGAAGAGGGAAGG + Intronic
1135117183 16:19733677-19733699 ACCTGGAGGCAGACAGGGGAGGG - Exonic
1135361566 16:21819982-21820004 ATTTGGACGAAGAAGAGGGAAGG + Intergenic
1135530309 16:23247345-23247367 AGCTGGAAGAGGAAAGGGCATGG - Intergenic
1135668483 16:24355219-24355241 AGAGGGAAGAAGAAAGGGGCAGG + Intronic
1135848835 16:25944062-25944084 ACTAGGGACAAGAGAGGGGAGGG - Intronic
1135905099 16:26504667-26504689 ACTTGAAAGATGAAAAGGGCCGG - Intergenic
1136043693 16:27599708-27599730 AGTTGGAGTAAGAAAGGGGTTGG - Intronic
1136260971 16:29075412-29075434 ATTTGGACGAAGAAGAGGGAAGG - Intergenic
1136404495 16:30036214-30036236 ACTTGGAAAAAGGAAGGGAGGGG + Intronic
1136698368 16:32107364-32107386 ACCTGCAAGGAGAAAGAGGACGG - Intergenic
1136798872 16:33050661-33050683 ACCTGCAAGGAGAAAGAGGACGG - Intergenic
1137063409 16:35812196-35812218 GCTTGAAAGAAGAAATGGGCTGG - Intergenic
1137830137 16:51536496-51536518 ACTGGGAAGTAGATAGGGCATGG + Intergenic
1137953254 16:52803635-52803657 AGGAGGAAGAAGAAAGGGGAAGG + Intergenic
1138563514 16:57816146-57816168 GCTGGGGAGAGGAAAGGGGAGGG + Intronic
1138784131 16:59826106-59826128 ACTTCCAAGAAAAATGGGGAAGG - Intergenic
1139279951 16:65762004-65762026 AATAGGCAGAAGAAAGGAGATGG + Intergenic
1139868125 16:70080073-70080095 ACTGGGGAGAAGAAAGAGAAGGG - Intergenic
1140257382 16:73348973-73348995 ATTTGGAGCAAGAATGGGGATGG + Intergenic
1140387210 16:74551780-74551802 ACTGGGGAGAAGAAAGAGAAGGG + Intronic
1140731212 16:77858287-77858309 GATTGGAAGAAGAAAGAGGAAGG + Intronic
1140772100 16:78214474-78214496 ACTTGGAGGATGACAGGGGTGGG - Intronic
1140984277 16:80142707-80142729 ACTGGCAGGAAGACAGGGGAGGG + Intergenic
1140986511 16:80162962-80162984 AGTTTTAAGAAGAAGGGGGAAGG - Intergenic
1141690437 16:85593534-85593556 ACGTGGAAGCAGGAAGGAGAAGG - Intergenic
1144116652 17:12100026-12100048 ACTTGCAAGGAGAAAGAAGAGGG - Intronic
1144955514 17:19017070-19017092 ACTTGGCAGAAGAGGTGGGAAGG - Intronic
1145108125 17:20137234-20137256 AGACTGAAGAAGAAAGGGGACGG - Intronic
1145904503 17:28508823-28508845 ATTTGGAAGGACAGAGGGGAGGG - Intronic
1146458358 17:33024528-33024550 AATTGGAAGAAGAGAGGAGAGGG - Intronic
1146471479 17:33128435-33128457 ACTGGGAAGCAGAATGGGGATGG + Intronic
1146763249 17:35496481-35496503 AGTCGGAAGAAGGAAGGGTAGGG - Intronic
1146785658 17:35718682-35718704 AATTGGAAGAAAAAAAGGGTTGG + Intronic
1146962325 17:36993263-36993285 AGTGGGAAGAAGAAGGGGAATGG - Intronic
1147462491 17:40582325-40582347 ACCAGGATGAAGAAAAGGGAAGG + Intergenic
1148666516 17:49379006-49379028 GCCTGGAAGAGAAAAGGGGAAGG + Intronic
1148692008 17:49534169-49534191 ACATCCTAGAAGAAAGGGGATGG + Intergenic
1149010818 17:51854526-51854548 ACTTGGATGAAGAGATGAGATGG + Intronic
1149443138 17:56691712-56691734 TCTAGTAAGAAGAAAGGGGAAGG - Intergenic
1149853770 17:60060197-60060219 AATTGGAAGAATAAAGGCAATGG + Intronic
1149857111 17:60092491-60092513 AATAGGAAGAAGACAGTGGAAGG - Intergenic
1149959390 17:61090948-61090970 ACTAGAAAGAAGAAAGGGCCAGG - Intronic
1150316590 17:64174377-64174399 ACTAGTAAGCAGAATGGGGAGGG + Intronic
1150417824 17:65001698-65001720 ACTTGGAAGCAGCAGGTGGAGGG - Intergenic
1150793826 17:68222097-68222119 ACTTGGAAGCAGCAGGTGGAGGG + Intergenic
1151190503 17:72394501-72394523 AGTGGGAAGAAGACACGGGAGGG + Intergenic
1151194258 17:72420645-72420667 ACGTGGAGAAAGAAAGGAGAAGG + Intergenic
1151196400 17:72434705-72434727 ACTTGGAAGAAGGAAGCAAAAGG + Intergenic
1151459500 17:74246096-74246118 CCCTGGAAGAAGGAAGGGGAAGG + Intronic
1151541620 17:74767652-74767674 CCTTGAAAGAAGAAGGTGGATGG - Intronic
1152526967 17:80893875-80893897 CCTCGGAAGCAGAAAGGGGCAGG - Intronic
1155011531 18:21783853-21783875 ACTTGGAAGGCTAAAGTGGAAGG - Intronic
1155804627 18:30152331-30152353 TCTTGCAAGAATAAAGGTGAAGG - Intergenic
1156825529 18:41426361-41426383 ATTAGGAAGAAAAGAGGGGAGGG + Intergenic
1156835916 18:41554422-41554444 ACTAGAAGGAAGAAATGGGAAGG + Intergenic
1157035112 18:43962258-43962280 ATGTGGAAGAGGAAAGGGAAGGG - Intergenic
1157119593 18:44896480-44896502 ACTTGGATGTAGAGTGGGGAGGG - Intronic
1157422681 18:47559574-47559596 AAGGGGAAGGAGAAAGGGGAAGG - Intergenic
1157423820 18:47568274-47568296 ATTGGGAAGCAGAGAGGGGATGG + Intergenic
1157467493 18:47959961-47959983 ACTTGGAAGGCAAGAGGGGAGGG - Intergenic
1158891737 18:61878726-61878748 ACGTGGCAGAAGAAATGGAAGGG + Intronic
1159579422 18:70218532-70218554 ACTTGGAAGAAGAGAGAGTATGG + Intergenic
1160007858 18:75081382-75081404 ACTTGGAAGAAAAAAAAAGAAGG + Intergenic
1160678609 19:403422-403444 ACTTGGAAGTGGAGGGGGGAGGG + Intergenic
1161153012 19:2719549-2719571 GCCTGGAAGGAGGAAGGGGAGGG - Intronic
1162139466 19:8577264-8577286 ATCTGGAAGAAGAAAGAGGAGGG - Intronic
1162513100 19:11131613-11131635 ACATGGAAGATGAAAGGGGAGGG + Exonic
1163212634 19:15852433-15852455 ACTTGGAAAAAAAGAGGGAAGGG - Intergenic
1163295203 19:16407279-16407301 AGTGGGGAGAAGAAAGGGAAGGG - Intronic
1163453977 19:17395200-17395222 AGTAGGAGGAAGGAAGGGGAGGG - Intergenic
1164439398 19:28261118-28261140 ACTTGGAAGAAGAAAGATGTAGG - Intergenic
1166648137 19:44547950-44547972 ACTGAGATTAAGAAAGGGGAAGG - Intergenic
1166966233 19:46530824-46530846 ACCTGGAAGGAGAGTGGGGAGGG - Intronic
1167383301 19:49150591-49150613 ACTGGGCAGGAAAAAGGGGAGGG - Exonic
1167579069 19:50331484-50331506 AAGGGGAAGAAGAAGGGGGAGGG - Intronic
1202672185 1_KI270709v1_random:65709-65731 ACCTGCAAGGAGAAAGAGGACGG - Intergenic
925826192 2:7850444-7850466 GCTTTGAAGAAGAAACAGGAAGG - Intergenic
926289549 2:11517501-11517523 ACTTGAAAAAAAAAAGAGGAAGG + Intergenic
926368186 2:12152864-12152886 ACTTGGAACCAGAAAGCTGATGG + Intergenic
927288904 2:21385431-21385453 ACTTGGAAAAAAACAGAGGAAGG - Intergenic
927361059 2:22234438-22234460 ATTTGGAAGAAGAATGGAAATGG - Intergenic
927364887 2:22283251-22283273 ATTTGGAAGATGAAATGGGCAGG - Intergenic
928651714 2:33410947-33410969 ACTCTGAAAAAGAAAGGGAATGG - Intergenic
929124519 2:38511068-38511090 CCTTGGAAGAAGAAAGTCGAGGG + Intergenic
929407893 2:41664147-41664169 AGGTGGAAGAAGCAAGGGAATGG + Intergenic
929456744 2:42071581-42071603 ACAGAGAAGAAGAAAGGAGAGGG - Intergenic
929608283 2:43250566-43250588 ACATGAAAAAAGAAAGGGGCTGG + Intronic
930160808 2:48154866-48154888 ACTTGGAAGAAGTATGGGAAGGG + Intergenic
930188085 2:48429834-48429856 ACCTGTGACAAGAAAGGGGATGG + Intergenic
930417659 2:51109227-51109249 ACAGGGAAGAAGTAAGGAGAAGG + Intergenic
930480855 2:51946720-51946742 AGCAGGAAGAAGAAAGTGGAAGG - Intergenic
930565024 2:53007960-53007982 ACATGGGAAAAGAAATGGGATGG - Intergenic
930731908 2:54735973-54735995 AGGTGGAAAAAGAATGGGGAAGG + Intronic
932064089 2:68534773-68534795 ACTTGGAAGAAGTAGGAGAAAGG - Intronic
932354834 2:71060144-71060166 ACTGGACAGAAGAAAGAGGACGG - Intergenic
932530124 2:72521161-72521183 ACATGGCAGAAGAGATGGGAGGG - Intronic
932568210 2:72922689-72922711 ACTTGGAGGAAGTAAGGTCAGGG + Intronic
932625123 2:73291372-73291394 AGTTGGAAGAAGAGCGGGGAGGG + Exonic
932785185 2:74594766-74594788 ACTTGGGAGACGAAAGTGGGAGG + Intronic
933148974 2:78891429-78891451 TCTGTGAAGAAGAAATGGGAAGG - Intergenic
933164792 2:79064143-79064165 ACATGGCAGAAGTAAGAGGAAGG - Intergenic
933174319 2:79158773-79158795 AGGTGGAAGAAGAGGGGGGAGGG + Intronic
933206209 2:79511768-79511790 ACTTGGAAGCAAAAGGGGGGAGG + Intronic
933619350 2:84519593-84519615 AATAGGAAGAAGAAGGGGAAGGG - Intronic
933847935 2:86340389-86340411 TCTTCCCAGAAGAAAGGGGAAGG - Intergenic
933848096 2:86342092-86342114 TCTTCCCAGAAGAAAGGGGAAGG - Intergenic
934657337 2:96123118-96123140 CCTTGGAAGGAGAAAGGGCTGGG - Intergenic
934898306 2:98138096-98138118 ATGTGGAAGAGGAAAGTGGATGG - Intronic
935757117 2:106284834-106284856 GCCTGGAAGAAGGAAGGGCATGG + Intergenic
936226339 2:110656973-110656995 ATTTGGTAGAATAAAGCGGATGG + Intronic
936400330 2:112159938-112159960 AGTTGGAAGATGGAAGGTGATGG - Intronic
936496544 2:113027207-113027229 ACTGAGGAGAAGAAAGAGGAGGG + Intronic
937443943 2:121940871-121940893 ACCTTGGAGAAGAGAGGGGAGGG - Intergenic
938478983 2:131643524-131643546 TCTTGAAAGAAGGAAGGGAAGGG - Intergenic
938665692 2:133533555-133533577 ACTAGGTACAGGAAAGGGGAAGG + Intronic
939269885 2:139924887-139924909 ACTTGGATGTAGAAAGTGAAAGG + Intergenic
939364759 2:141217261-141217283 ACTAGGAGCAAGAAAGTGGAGGG - Intronic
939581186 2:143947885-143947907 AGAGGGAAGAAGAAAGGGAAGGG + Intronic
939662245 2:144904363-144904385 AATTTGAAGTATAAAGGGGAAGG + Intergenic
939679583 2:145113991-145114013 ACATGGTGGAAGAAAGGGAAAGG + Intergenic
940305701 2:152223943-152223965 GCTTGAAAGAAGAAAGATGAAGG - Intergenic
940988488 2:160074017-160074039 ACTAGGAAGGAGACAGTGGAAGG + Intergenic
942097972 2:172551432-172551454 ACTTTGTAGAGCAAAGGGGAAGG - Intergenic
942141112 2:172978308-172978330 ACTAGTGAGAGGAAAGGGGATGG - Intronic
942228420 2:173837109-173837131 ACTTAGAGGAAGAATGGTGAAGG + Intergenic
943644824 2:190399061-190399083 ACATGGCAGAAGGAAGGGAAGGG + Intergenic
943867344 2:192943509-192943531 ACTTGTAAACACAAAGGGGAAGG - Intergenic
944927416 2:204479407-204479429 ACTTAAAGGAAGAAAGGGAAAGG - Intergenic
945436768 2:209827791-209827813 TCTTGGAAGAAAAAAGGCTAGGG - Intronic
945685792 2:212968222-212968244 ACTAGGAAGAAGAGAAGGAAAGG + Intergenic
946100623 2:217317527-217317549 GCATGGAAGAAGAAAGGGTCTGG - Intronic
946159248 2:217826065-217826087 ACTGGGAAGGAGAAAGGAGGTGG - Intronic
946634387 2:221708110-221708132 ACTGGGAATAGGAAAGTGGAGGG - Intergenic
946968845 2:225069317-225069339 ACTTGGAAGAAGCAAAGGAGAGG + Intergenic
947232328 2:227901068-227901090 ACTGTGAAAAAGAAATGGGAGGG + Intronic
947943711 2:234081705-234081727 ACTTTCCAGAAGAAAGTGGAAGG - Intergenic
1169178628 20:3542567-3542589 AAGGGGAAGGAGAAAGGGGAAGG - Intronic
1169443761 20:5654464-5654486 ACTGGAAAGGGGAAAGGGGAAGG - Intergenic
1169639850 20:7739584-7739606 ACTTGGAAGAAGGGAAGGAAGGG + Intergenic
1169681681 20:8221226-8221248 ACTTAAAAAAAGAAAGGTGACGG + Intronic
1169951748 20:11052306-11052328 TTTTGGAAGAAGAAAGTGTAGGG - Intergenic
1169959027 20:11138179-11138201 TCTATGAAGAATAAAGGGGAAGG - Intergenic
1169992741 20:11521774-11521796 ACTTGGAAGAAAGAAGGAGAAGG + Intergenic
1170805046 20:19622159-19622181 ACTTGAAAGGAGACTGGGGATGG + Intronic
1170975988 20:21165276-21165298 GCTTTGAAGGAGAAAGAGGAGGG + Intronic
1171317555 20:24208930-24208952 ACATGGAAAAAGAAAAGAGAGGG + Intergenic
1173053019 20:39583667-39583689 AAAGGGAAGAGGAAAGGGGAAGG + Intergenic
1173310987 20:41895628-41895650 ACTGAGAGGGAGAAAGGGGAGGG + Intergenic
1173385286 20:42581980-42582002 ACTTGGAACAAAAAAGGGGCTGG + Intronic
1174202075 20:48813659-48813681 ACAGGGAAGAAGAAAGGAAAGGG + Intronic
1174317242 20:49713012-49713034 AAGTAGAGGAAGAAAGGGGAGGG + Intronic
1174450320 20:50616113-50616135 AAGAGGAAGAAGAAAGGGAAAGG + Intronic
1174828340 20:53789852-53789874 AATGGGAAGAAGAAAGAGGCAGG - Intergenic
1176957626 21:15124330-15124352 ACAGGGAAGAAGGAGGGGGAAGG + Intergenic
1177159688 21:17534525-17534547 CCTGGGAAGAAGAAAGGCAAAGG + Intronic
1177300811 21:19243852-19243874 CCTTAGAAGAATAAAGGGAAAGG - Intergenic
1177713254 21:24807344-24807366 ACTTGAAAGAGGATATGGGAAGG + Intergenic
1179239217 21:39574137-39574159 ATTTGGAAGAAGCAAGTGAATGG - Intronic
1181455189 22:23055326-23055348 ACTGGGAAGAAGAAAAGTGAAGG - Intergenic
1181976863 22:26736557-26736579 ACAGGGAAGAAATAAGGGGAAGG - Intergenic
1182064962 22:27424335-27424357 ATTTGGAAAAAGAAAGAGGGTGG - Intergenic
1182264754 22:29105552-29105574 AATTTTAAGAAGAAAGGGGCAGG + Intronic
1182547379 22:31084105-31084127 AAGAGGAACAAGAAAGGGGATGG - Intronic
1182746046 22:32606193-32606215 CCTTGGAAGCAGGAAGGGAAGGG + Intronic
1183310351 22:37106385-37106407 GCTTGGAGGATGAGAGGGGAGGG - Intronic
1183624791 22:38995221-38995243 ACTTTGCAGATGAATGGGGAGGG - Intergenic
1183652990 22:39169718-39169740 ACTTGGGAGAAGAAGAGGGCAGG - Intergenic
1183838736 22:40479473-40479495 AATAGGCAGAAGAAAGGGAAAGG - Intronic
949269602 3:2199254-2199276 ACTGGGAAGAAGGAAGTAGAGGG - Intronic
949560952 3:5202001-5202023 ATTTGGGAGAAGGAATGGGATGG + Intronic
950275352 3:11655945-11655967 TCTTGAAAGAACAAATGGGAAGG + Intronic
950327624 3:12126944-12126966 ACTTGGTAGGGGGAAGGGGAAGG - Intronic
951528998 3:23681446-23681468 AGCTGGCAGAAGAAAGTGGAAGG + Intergenic
952245031 3:31578683-31578705 GCATGGAAGGAGAAAGGGGGAGG - Intronic
952809770 3:37391414-37391436 TCTTTTAAGAAGAAAGGAGAAGG + Intronic
952857484 3:37784237-37784259 ATTTGGAAGAAGACAGGGACTGG - Intronic
953043408 3:39274582-39274604 ATTTTGAAGAGGAAAGGGAAGGG - Intronic
953153899 3:40351427-40351449 GCTCGGAAGAAACAAGGGGATGG + Intergenic
953293584 3:41690661-41690683 CCCTGGATGAAGAAAGGGGATGG - Intronic
953360068 3:42288211-42288233 ACTTGGAAGAAGGAGGGGTTGGG - Intergenic
953373745 3:42411468-42411490 ATTTGGTGGAAGAAAGGGAAGGG + Intergenic
954200621 3:49021339-49021361 ACTTGGATCAAGACGGGGGACGG + Exonic
955386707 3:58486560-58486582 AATTGGGGGAAGAAAGGGAAGGG + Intergenic
956721658 3:72123299-72123321 ATACGGCAGAAGAAAGGGGATGG + Intergenic
956739741 3:72266547-72266569 CCTGGGGAGAAGATAGGGGAAGG - Intergenic
957887378 3:86305355-86305377 AAATGGAAGAAGGAAGGGGAGGG - Intergenic
958993328 3:100873050-100873072 TCCTGGAAGAAGGAAGAGGAAGG - Intronic
959145653 3:102541478-102541500 ACCTGGAAGAAAAAAGAGTAGGG + Intergenic
959291781 3:104484583-104484605 ATTTGGAAGGAGTAAGTGGATGG + Intergenic
959931231 3:111985364-111985386 AGTTGGAAGGAGAAAGGGATGGG + Intronic
959951822 3:112187743-112187765 ATGTGGAAGAAGAAATGAGAAGG - Intronic
960218042 3:115066825-115066847 ATTTGGGAGAAGACAGGGGAAGG - Intronic
960630828 3:119728838-119728860 TCGTGGAAGAAGAAAGGATAGGG - Intronic
960906418 3:122606225-122606247 ATGTGGAAGAATATAGGGGATGG - Intronic
960954927 3:123025576-123025598 GCTTGGAAAAAGAAAAGGGATGG + Intronic
961487129 3:127224510-127224532 TGCTGGAAGAAGGAAGGGGAGGG - Intergenic
962446286 3:135468782-135468804 ACCTGGAAGAAGCAAAGGGAGGG + Intergenic
963755876 3:149234764-149234786 ACTTGGAAACTGAAAGAGGAAGG + Intergenic
963935204 3:151045335-151045357 GCTGGGAAGAATTAAGGGGAAGG + Intergenic
964877549 3:161385457-161385479 ACTAGGAGGGAGAAAGGGGAAGG + Intergenic
965366958 3:167812964-167812986 TCTTGGAAGGTGTAAGGGGAAGG + Intronic
965567564 3:170136928-170136950 AGAGGGAAGAAGAAAGGGGGAGG + Intronic
965737083 3:171832182-171832204 GCTTGGAGGATAAAAGGGGATGG + Intergenic
966056945 3:175705136-175705158 GCTGGAAAGAAGAAAGGCGATGG + Intronic
966756456 3:183376022-183376044 AAGCGGAAGAAGAAAGGCGAGGG + Intronic
967003747 3:185363267-185363289 AATTGGAAAAATAAAGGGGAGGG - Exonic
967390372 3:188948634-188948656 ACAAGAAAGAAGAAAGAGGAGGG - Intronic
967403561 3:189091208-189091230 CACTGGAAGAAGAAAGGGGGTGG - Intronic
967635323 3:191794849-191794871 ATTTTGAAGAAGAAAAGGTAGGG + Intergenic
967836612 3:193970082-193970104 ATTTGGAAGAAGAAACGGTATGG + Intergenic
968036887 3:195555162-195555184 AAGTGGAAGTAGAAAGGCGAAGG - Intergenic
968191358 3:196670041-196670063 CCTTGAAAGAAGCAAAGGGAGGG - Intronic
969240654 4:5894774-5894796 TCTTGGAAGAGGAAACAGGAGGG + Intergenic
969334542 4:6499920-6499942 ACTTGGAAGAAGAAAGGGGAAGG - Intronic
969399210 4:6942747-6942769 ACGAGGAAGAAGGAAGGTGAGGG + Intronic
969605674 4:8201196-8201218 GGTTGGAAGAAGAAGGGAGAGGG - Intronic
970244265 4:14042159-14042181 AGCTGGAAAAAGAAAGGAGAAGG - Intergenic
970405533 4:15759596-15759618 ATGAGGAAGAAGAAAGGGGATGG - Intergenic
970696734 4:18686604-18686626 ATAAGGAAGAAGAAAGAGGAGGG + Intergenic
971513002 4:27450562-27450584 AGTTGGTAGTAGAAAGGTGAGGG - Intergenic
971978957 4:33729717-33729739 ATTTTGAAGAAGAAAGAGAACGG + Intergenic
972386370 4:38570319-38570341 AGTGGGAGGAAGAAAGGGGTTGG - Intergenic
972822831 4:42721950-42721972 ACCTGGAAGAACACAGGGGAGGG - Intergenic
973067245 4:45811044-45811066 GCTGGGAAGAAGAAGGGGAAGGG - Intergenic
973563356 4:52159318-52159340 ACTTGGAAGGATGAAGTGGAAGG - Intergenic
973624503 4:52757938-52757960 ACTTGGAAGACTAAGTGGGAAGG - Intergenic
973758317 4:54095865-54095887 ATCTAGAAGAAGAAAGGGGGGGG + Intronic
973790351 4:54372479-54372501 ACTAGGAAGATGAAAAGAGATGG + Intergenic
974020311 4:56687177-56687199 ACTTGGATACAGAGAGGGGAAGG + Intergenic
975077297 4:70226992-70227014 ATTTAGAAGAAGAAAGAGGCAGG - Intronic
975149495 4:71005226-71005248 ACCTGGAAGGTGAAAGGGGTGGG - Intronic
975489026 4:74968530-74968552 GCATGGAAGAAGAAAGAGGAAGG + Intronic
976324892 4:83759959-83759981 ATTTGGAAGGAGGAAGTGGAGGG + Intergenic
976330946 4:83830429-83830451 GCATGGAGGAAGACAGGGGATGG + Intergenic
976622842 4:87146528-87146550 ATTTGTAAGAAGAAAGGTAAAGG - Intergenic
977152476 4:93530109-93530131 AATTGGAAGTAGAAAGTGAAAGG - Intronic
977362630 4:96025546-96025568 ATTTAGAAAAAGAAATGGGAAGG - Intergenic
978296490 4:107211223-107211245 ACTTGGCAGAGGAGACGGGAAGG - Intronic
979104069 4:116662269-116662291 ACTTGCAGGAATAAATGGGATGG + Intergenic
979141002 4:117174500-117174522 AGGTGGAAGGAGAGAGGGGAGGG + Intergenic
979207255 4:118053608-118053630 ATCTGGGAGAAGAAAAGGGAGGG + Intronic
980582946 4:134776013-134776035 ACTTAGAAGAAGAAAGGAGCTGG - Intergenic
981217456 4:142187700-142187722 ACTTGGGAGACTAAAGTGGAAGG - Intronic
982514506 4:156327779-156327801 ACATGGCAGAAGAAATGGAAGGG - Intergenic
983509156 4:168588868-168588890 ACTTGAAAGAAGAAATTGGCTGG - Intronic
983713488 4:170749208-170749230 ACTTGGAGGGAGAGGGGGGAAGG - Intergenic
983783469 4:171701989-171702011 AGTGGGAAGAAGAAAGGTTAAGG + Intergenic
983848954 4:172556126-172556148 ACTAGGAACAAGAAATGGAATGG - Intronic
984878290 4:184388856-184388878 TCATGGAGGAAGAAAGGGGGAGG + Exonic
986191399 5:5499504-5499526 TCTTGGAAGAAGAAAGATGCTGG + Intergenic
986767650 5:10942154-10942176 ACTTTGAAGGAGAAAGGGTTGGG - Intergenic
986787194 5:11125286-11125308 TCGTGGAAGAATGAAGGGGATGG - Intronic
986851732 5:11820360-11820382 ACTTAGAAGAAGAATGGTGCCGG + Intronic
987185916 5:15419025-15419047 ACTTGTAAGAAGAAAATGAAAGG - Intergenic
987426659 5:17780577-17780599 ACTTGGAAGAAGATAGTGCGAGG + Intergenic
989088396 5:37700942-37700964 ACTGTAAAGAAGAAAGGGAAGGG - Intronic
989129848 5:38096391-38096413 ACTTGGAAAGATAAAAGGGAAGG + Intergenic
989209113 5:38842693-38842715 AGATGGAAGATGAAAGAGGATGG + Intergenic
990056154 5:51581231-51581253 AGATGGAAGAGGAAAGTGGAGGG + Intergenic
990214863 5:53519225-53519247 ACATGGCAGAAGAAATGGAAGGG + Intergenic
990553249 5:56905014-56905036 ACTTGGAAGCAGGAAGATGAGGG + Intergenic
990652445 5:57917415-57917437 GCTTGGAAGAATAGAGGGAAGGG - Intergenic
990848744 5:60176266-60176288 ACCTGCAAGAAGAAAGAGGATGG - Intronic
991196512 5:63940726-63940748 ACTTGGACCAAAAAAGGTGATGG + Intergenic
991202041 5:64006041-64006063 AGTGGGAAGAAGACAAGGGATGG - Intergenic
991278665 5:64883570-64883592 AATTCTAAGAAGAAAGGAGAAGG + Intronic
991456624 5:66810964-66810986 ACTTAGAAGAATAGAGGGAAAGG - Intronic
991925108 5:71697987-71698009 ACTTGGGAAAAGAAAGGGAGGGG - Intergenic
992557739 5:77919735-77919757 ATTTGGATGAATAAAAGGGAAGG - Intergenic
992794539 5:80243941-80243963 TCTCTGAAGAAAAAAGGGGATGG + Intronic
993603130 5:89953450-89953472 ACTTGGACGCAGAATGGGTAAGG + Intergenic
993879087 5:93342082-93342104 ACTTCGACAAAGAAAGGGGAGGG - Intergenic
994452107 5:99955915-99955937 CCTGGGAGGAAGAAAGGGGTGGG - Intergenic
995042602 5:107605853-107605875 ACTGGGAGGAAGCAGGGGGAGGG + Intronic
995176942 5:109189012-109189034 AGGTGGAAGTAGAAATGGGAGGG - Exonic
996940162 5:128995055-128995077 ACTTGGAAGATTAAAAGTGAGGG - Intronic
997203653 5:132027884-132027906 ACTTGAAAGAAGAAGAAGGAGGG - Intergenic
997735361 5:136209035-136209057 ACTAGGAGGGAGAAAGAGGAAGG - Intergenic
998154289 5:139775663-139775685 AAAAGGAAGAAGAAAGGAGAAGG - Intergenic
998155023 5:139781056-139781078 GACTGGAAGATGAAAGGGGATGG - Intergenic
998524661 5:142831606-142831628 ACTTTGGAGAAGGGAGGGGAGGG - Intronic
999115209 5:149156865-149156887 ATTTAGAAGAATAAAGGTGAAGG + Intronic
999177446 5:149641223-149641245 ACTTGGAAGAAATACGGGGAAGG - Intergenic
999384246 5:151143030-151143052 ACTTGGAATAAGAGAGGGAAAGG + Intronic
999900426 5:156080842-156080864 ACTCAGAAGAAGATAGGAGATGG - Intronic
1000101604 5:158022234-158022256 AAATGAAAGAAGGAAGGGGAAGG - Intergenic
1000265648 5:159633710-159633732 AGCTGGAGGAATAAAGGGGAGGG - Intergenic
1000380373 5:160623555-160623577 CTTTGGAAGAAAAAAGAGGACGG + Intronic
1001322450 5:170693804-170693826 ATTAGCAAGAAGAAAGTGGAGGG + Intronic
1002761938 6:209185-209207 CCTAGGAAGAAGAAAGGGGAAGG + Intergenic
1002901455 6:1413051-1413073 ACTTGGAAGGAGCAAGGAGCGGG + Intergenic
1003000520 6:2328014-2328036 TCTCAGAAGAAGAAGGGGGAAGG - Intergenic
1003463059 6:6350424-6350446 TCTTGGAAGAATAAAGGGTCAGG + Intergenic
1003510968 6:6780027-6780049 ACTGGGAAGAAGAGAAAGGAGGG + Intergenic
1003613903 6:7637598-7637620 ACTTGGGAGAAAAAAAAGGAAGG + Intergenic
1003693186 6:8375049-8375071 ATTTTGATGAAGAAAGGAGATGG - Intergenic
1005895424 6:30173283-30173305 ACTTGAGAGGAGAAAGGGTAGGG - Intergenic
1006410929 6:33872816-33872838 ACCTGGAAGAAGCAGGTGGAGGG + Intergenic
1007263739 6:40582043-40582065 CCTGGGAAGAAGAAATGAGAGGG + Intronic
1007468292 6:42070824-42070846 ATTTGGTAGACGAGAGGGGATGG + Intronic
1007470806 6:42089046-42089068 AGATGGAAGAAGAAAGAAGATGG - Intergenic
1007765717 6:44158705-44158727 ACTGAGAAGGAGAAAAGGGAAGG + Intergenic
1008236386 6:49056934-49056956 ACTGGGAACAAGAAGGGGGGTGG + Intergenic
1008514627 6:52307406-52307428 GCTTGGAGGAAGCTAGGGGAAGG - Intergenic
1008648605 6:53541770-53541792 ATTTGGAACAAGAAATGTGAAGG + Intronic
1008764319 6:54892630-54892652 TTTTGGAAGAAAAAAGGGAAAGG - Intronic
1009401876 6:63265486-63265508 ACTTGCAAGAGGGAAGAGGATGG - Intergenic
1010145159 6:72659617-72659639 ACGTGGAAGAAGGAATGGAAGGG + Intronic
1010253229 6:73730067-73730089 ACTTGGAATAGGAAATGGCAAGG + Intronic
1010375912 6:75169789-75169811 ACTAGGAAGAATAAAGTGTAAGG - Intronic
1011177096 6:84575703-84575725 TTTTGGATGAAGAAAGGGCAGGG + Intergenic
1011254753 6:85408909-85408931 ACTTGGAATATGGAAGGGTAGGG - Intergenic
1011912568 6:92460673-92460695 ACTTGAAAGAGGAAATGGGATGG - Intergenic
1012033080 6:94098039-94098061 ACTTGGAAGAAGAAAGGAACTGG + Intergenic
1012526855 6:100188098-100188120 ACTTGGAAGCATAAAAGTGATGG - Intergenic
1013234928 6:108189811-108189833 ACTTCCAAGAAGAGATGGGATGG + Intergenic
1013725310 6:113088277-113088299 CATAGGAAGAAAAAAGGGGATGG + Intergenic
1013868833 6:114731273-114731295 ACTTGGCAGAAGAAATGATATGG + Intergenic
1014708108 6:124773290-124773312 AATGGGAAGGAGAAAGAGGAGGG + Intronic
1015015424 6:128407043-128407065 AGTTGGAAGCAGAAATTGGAGGG - Intronic
1015875310 6:137816650-137816672 ACTTGGAAAAAGGGAGGGGAGGG + Intergenic
1016290803 6:142526495-142526517 ACCTGCAGGAAGGAAGGGGAGGG + Intergenic
1016417763 6:143851013-143851035 AGGTGGAAGAAGGAGGGGGAGGG + Intronic
1016774715 6:147892679-147892701 GCTTGGAATAAGAGATGGGATGG + Intergenic
1017835298 6:158171857-158171879 ACTTGGAAAAGCAAAGGGGGTGG + Intronic
1018478016 6:164162038-164162060 ACTTGGAGGTAGGGAGGGGAGGG + Intergenic
1019969144 7:4526137-4526159 AAGAGGAAGAAGAAAGGGGAAGG + Intergenic
1020442607 7:8234341-8234363 ATGTGGACGAAGCAAGGGGAGGG - Intronic
1020521214 7:9189711-9189733 AATAGGAAGAAGAAAGAGAAAGG + Intergenic
1020631010 7:10639773-10639795 ACTTCAGAGAAGGAAGGGGACGG + Intergenic
1020983783 7:15107013-15107035 ACTAGGGAGAATAGAGGGGAGGG - Intergenic
1021402227 7:20222555-20222577 AGTTGGAAAAGGCAAGGGGATGG - Intergenic
1021450383 7:20778434-20778456 GCTGGGAAGAGGAAAGCGGAGGG + Intergenic
1021479759 7:21103211-21103233 ACTAGGCATAAGAAAGAGGAAGG + Intergenic
1021536153 7:21707105-21707127 ACTTGGGGGAAGAAGGGGGAAGG - Intronic
1021702195 7:23330434-23330456 ACTTGTGAGAGGAGAGGGGAAGG - Intronic
1021827270 7:24567858-24567880 ACCTGCAAGAAAGAAGGGGATGG + Intergenic
1022050986 7:26671580-26671602 TATTGGAAGAACAAAGTGGAGGG + Intronic
1022229061 7:28395529-28395551 AGTTGGAAAAAGAAAGGAGTAGG - Intronic
1022329196 7:29361579-29361601 ACTTGGAGGAGGGAAGGGGAAGG - Intronic
1022632998 7:32103207-32103229 ATTTGGAAGCAGAAAAGGGAGGG + Intronic
1022652372 7:32288946-32288968 ACTAGGAAGAAGAAAAGGGAAGG + Intronic
1023771314 7:43559144-43559166 ACTTGGAAAAATAGAGGAGACGG + Intronic
1024332337 7:48168727-48168749 ACTTAGAAGAAGCAAGGGTCTGG + Intergenic
1024593632 7:50913526-50913548 ACTAACAAAAAGAAAGGGGAAGG - Intergenic
1024805096 7:53130185-53130207 ACCTGCAAGGAGAAAGAGGACGG + Intergenic
1026997608 7:74628628-74628650 ACACGGAAGAGGAAAGGGAAAGG - Intergenic
1027457342 7:78409503-78409525 ACTTTGAAGAAGTAAGAGGTAGG + Intronic
1028092933 7:86725845-86725867 ACATGGCAGAAGAAGGGGGAAGG + Intronic
1028990110 7:97040143-97040165 ACTTGGCTGAAGAAATGAGATGG - Intergenic
1030190535 7:106806112-106806134 AAATGGAAGGAGAAAGAGGAGGG + Intergenic
1030314393 7:108099149-108099171 ACCTGTAAGAAGGAAAGGGAGGG + Intronic
1030484759 7:110151471-110151493 AGTTTCAAGAAGAAAGGGGTAGG + Intergenic
1031114244 7:117650439-117650461 ACATGGAAGAACAAAGAGGCTGG + Intronic
1031148984 7:118030647-118030669 ATTTTGAAGAAGAAAAGGAAAGG - Intergenic
1031713497 7:125078124-125078146 TTCTGGTAGAAGAAAGGGGAGGG + Intergenic
1031888304 7:127263688-127263710 AAAGGGAAGAAGAAAGGGTAGGG + Intergenic
1032444703 7:131972280-131972302 ATTTGGAGAAAGAAAGTGGATGG + Intergenic
1032464830 7:132137673-132137695 ACTTGGAGGCAGGAATGGGAGGG + Intronic
1032609900 7:133401551-133401573 ACTTGGGAGTATAAAGTGGAAGG + Intronic
1032940520 7:136784007-136784029 ACTTTGAAAAAAAAAGGGGGTGG - Intergenic
1033019374 7:137707251-137707273 TTTTGGAAGAAGGAAGGAGAAGG + Intronic
1033569822 7:142616882-142616904 AGATGGGGGAAGAAAGGGGAGGG + Intergenic
1033606878 7:142933919-142933941 ATTTGGAAAAAGAAAAGGGATGG + Intergenic
1033681337 7:143599156-143599178 ACTTTGAAGAAGATAAGGGTTGG + Intergenic
1033703554 7:143862657-143862679 ACTTTGAAGAAGATAAGGGTTGG - Intronic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1034784861 7:153916417-153916439 ACTTCGAAGAGGGGAGGGGAGGG - Intronic
1035168665 7:157006000-157006022 ACTTAGAAGCAGAATGGGGAGGG + Intronic
1035649262 8:1252844-1252866 ACTTGGAAGAGGAAAGACGTTGG + Intergenic
1036597796 8:10229829-10229851 ATTTGGAAGAGGAAAGGGAGAGG + Intronic
1037483711 8:19328107-19328129 AGAGGGCAGAAGAAAGGGGAGGG - Intronic
1038071342 8:24017564-24017586 ACTTGGAAGACCAAGGAGGATGG + Intergenic
1038324314 8:26561046-26561068 CCTTGAAAGAAGCAGGGGGAGGG + Intronic
1038531818 8:28324453-28324475 ACGTCGCAGAAGAAAGGGAAGGG - Intronic
1038555796 8:28513964-28513986 ATTTGAAAGAAGAAAGAGAATGG + Intronic
1039422764 8:37458164-37458186 ATTTGGAAGAAGGAAGAGTATGG - Intergenic
1039594097 8:38775550-38775572 ATTTGGCAGAAGAAGGGAGAGGG + Intronic
1039889564 8:41674837-41674859 ACTAGGAAGAACAAGGAGGAAGG + Intronic
1039990277 8:42481840-42481862 ACCTGGAAGGAAAAAGGGCAGGG - Intronic
1040496467 8:47969745-47969767 ACTCGGAGGAAGATATGGGAAGG + Intronic
1040730048 8:50433801-50433823 ACTTGGAGGAAAAAAGTCGAGGG + Intronic
1040850303 8:51894433-51894455 ACTTGGAAGAAGACATGGTTGGG + Intronic
1041008251 8:53516404-53516426 TCTTGGAAGAAGGAAGGAGGGGG + Intergenic
1041303478 8:56437139-56437161 TCTTAGGAGAAGATAGGGGAGGG - Intronic
1041348391 8:56924577-56924599 ACCTTAAAGAAGGAAGGGGATGG + Intergenic
1041788635 8:61664809-61664831 ACAGGGAAGCAGGAAGGGGAAGG + Intronic
1041936806 8:63341195-63341217 ACTTGATAAAAGAAAGGGGATGG - Intergenic
1042411730 8:68474051-68474073 ACTTGAAAGAACAAAGGCAAAGG - Intronic
1042761979 8:72280989-72281011 ACTTCAAAGAAGTAAGGGAAAGG + Intergenic
1042852748 8:73233107-73233129 AGTGGGAAGAAGAAGGAGGAAGG - Intergenic
1043211000 8:77517727-77517749 ACTTGCAAGAACAATGAGGATGG + Intergenic
1043238762 8:77903637-77903659 ACATAGAGGAAAAAAGGGGATGG - Intergenic
1043542075 8:81275346-81275368 AGTGTGAAGAAGAAAGGGCAGGG + Intergenic
1043614025 8:82103372-82103394 AGTGGGCAGAAGAAAGTGGAAGG + Intergenic
1043938263 8:86167934-86167956 ACTATGAAAAAGAAAGGGGAGGG + Intergenic
1043965157 8:86465782-86465804 ACCTTGAAGTATAAAGGGGAGGG + Intronic
1044216194 8:89613504-89613526 ACTTTGAAAAAGTTAGGGGACGG - Intergenic
1044399825 8:91757856-91757878 AGTTGGAAGAAGTAAGGAGATGG - Intergenic
1044538889 8:93388222-93388244 AAGTGGAAGAAGAAAATGGAGGG + Intergenic
1045058288 8:98388640-98388662 ACTTGCAAGAAAAAAGGGGAAGG + Intergenic
1045194140 8:99912883-99912905 ATTTGGAAGAATAAAGGATAAGG - Intergenic
1045278622 8:100729129-100729151 ACTTGGAATAAGGAAAGGAAAGG + Intergenic
1045309539 8:100988800-100988822 ACTTGGAAGAAGTAAATGGGTGG - Intergenic
1045464463 8:102456961-102456983 ACTTGGAAGAATAACTTGGAAGG + Intergenic
1046148408 8:110191596-110191618 ACTTTAAAGAATAAAGAGGAGGG - Intergenic
1047238094 8:123060268-123060290 AATTGGAAGAAAAAAGGGCGAGG - Intronic
1047311556 8:123696718-123696740 GGTTGGAAGGAGAAAAGGGAGGG - Intronic
1048370745 8:133774015-133774037 GTTTGGGAGAAGGAAGGGGAGGG + Intergenic
1048642588 8:136380844-136380866 GCTTGGAAGAAGCAAGGTAATGG - Intergenic
1049436542 8:142588722-142588744 ACATGGAACAAGGAAGGGGCAGG - Intergenic
1049519340 8:143080278-143080300 ATTTGGAAGCAGACGGGGGAGGG - Intergenic
1049687179 8:143943678-143943700 GCTTGGAAACAGGAAGGGGAGGG + Intronic
1050014554 9:1219982-1220004 ACTAAGAAAAAGAAAGGGTAGGG + Intergenic
1050203517 9:3174477-3174499 ACTTCGAAGAAGAAGAGGTATGG - Intergenic
1050298174 9:4228053-4228075 ACTTATAAGAACAAAAGGGAAGG + Intronic
1052655118 9:31349139-31349161 GGTTGGGGGAAGAAAGGGGAGGG + Intergenic
1052719978 9:32162660-32162682 ACTTGGCAAAAGAAAGAGGAGGG - Intergenic
1052976328 9:34413214-34413236 ACATGGAGGCAGAAAGGGGGTGG + Intronic
1053186254 9:36019111-36019133 TCTTGTAAGAAGAAAGATGAGGG - Intergenic
1053283013 9:36833551-36833573 ACTTGGGAGAAAACAGGGGTGGG - Exonic
1053475490 9:38379243-38379265 ACTAGCAAGACGAGAGGGGAAGG + Intergenic
1054791420 9:69260192-69260214 ACCTGGAAGAAAGGAGGGGAGGG + Intergenic
1054937124 9:70699890-70699912 ACTTACAAGAATAAAGGGCAGGG + Intronic
1055024426 9:71704203-71704225 ACTTGGCAGAAGAAAGTAGTGGG - Intronic
1055307371 9:74943688-74943710 TCTTAGAAGCAGAATGGGGATGG - Intergenic
1055576583 9:77666025-77666047 ACCAAGAAGAAGGAAGGGGAAGG - Intergenic
1055592518 9:77832435-77832457 ACTTGGAAGAGGATGGAGGAAGG + Intronic
1055749785 9:79492304-79492326 ACTGGGAAGATCAAAGGGCATGG - Intergenic
1056178917 9:84062621-84062643 CCTTGGAGGAATAGAGGGGAGGG + Intergenic
1056625948 9:88253384-88253406 ACTTGGCAGAAGCCAGGGAAAGG + Intergenic
1056823225 9:89859270-89859292 ACTTGGAAGAAGAAACCCGTGGG + Intergenic
1057382020 9:94576952-94576974 ACTTGGAAGAAGTGGGGGGAGGG - Intronic
1057398171 9:94698973-94698995 AATTGGAAGAAGAATGTGAAGGG + Intergenic
1057725985 9:97568514-97568536 ACAGGGAAGCAGAAAGGGAAGGG + Intronic
1057743529 9:97733413-97733435 ACATGGAAGAAGACGGGGGTGGG - Intergenic
1057940610 9:99279949-99279971 GAATGGAAGAAGAAAGGAGATGG - Intergenic
1058122757 9:101156762-101156784 AATGGGAAGAGGAGAGGGGAAGG + Intronic
1058616188 9:106830515-106830537 TCCTGCAAGAAGAAAAGGGAAGG + Intergenic
1058788805 9:108419917-108419939 ACATGGTAGAAGAAATGGAAGGG - Intergenic
1058944303 9:109841896-109841918 AGTTGGAAGGATAGAGGGGAGGG + Intronic
1059382999 9:113943065-113943087 ACTGGGAAGGAGATAGGGTAGGG + Intronic
1060455434 9:123789666-123789688 AGAAGTAAGAAGAAAGGGGAGGG - Intronic
1061312703 9:129774667-129774689 AGTACGGAGAAGAAAGGGGAGGG + Intergenic
1062109873 9:134776455-134776477 ACTTGGAAGCAGAGGGTGGAAGG + Intronic
1062182162 9:135196496-135196518 AATGGGAAGGAGAAATGGGAAGG - Intergenic
1062182262 9:135196758-135196780 AGTGGGAAGAAGAAGAGGGAAGG - Intergenic
1185922125 X:4104991-4105013 AAATGGAAGAAGAGAGGAGAGGG + Intergenic
1186527153 X:10259128-10259150 ACTTGGAAGATGAAGGGAGGAGG + Intergenic
1186612069 X:11147455-11147477 ACTTGGAAGCAGAATTGTGAGGG + Intronic
1186942784 X:14529224-14529246 AATTTGAAGCAGAAAAGGGAAGG - Intergenic
1186947642 X:14586756-14586778 ACATGAAAGAAAAAAGGAGAAGG + Intronic
1187252480 X:17611324-17611346 ACTAGGAAAAGGAAAGCGGAGGG - Intronic
1187301760 X:18057809-18057831 TGCTGGAAGCAGAAAGGGGATGG - Intergenic
1187678174 X:21738893-21738915 ACTTGTAAGGAAAAATGGGAGGG - Intronic
1187718700 X:22129968-22129990 AATTGGAAGAAAAAGAGGGATGG - Intronic
1187960583 X:24563348-24563370 ACCTGGAAGAGATAAGGGGAGGG + Intronic
1188137600 X:26508849-26508871 CCATGGAATAAGAAAGGAGATGG - Intergenic
1188598258 X:31927983-31928005 AATAGGAAGAACAAAGTGGAAGG + Intronic
1189000796 X:36942575-36942597 TCTTCTAAGAAGAAAAGGGAAGG - Intergenic
1189330901 X:40144650-40144672 ACTCTGAAGAACAAAGTGGAGGG - Intronic
1189480184 X:41386390-41386412 ACATGTGAAAAGAAAGGGGAAGG + Intergenic
1189590464 X:42505768-42505790 ATTTGGAAGCAGAATGAGGATGG + Intergenic
1190252937 X:48740877-48740899 ACTCGAAAGGGGAAAGGGGAAGG + Intergenic
1190882290 X:54500409-54500431 GCTTGGGAGAAGGAGGGGGAGGG + Intergenic
1191591182 X:62887380-62887402 AGAGGGAGGAAGAAAGGGGAAGG - Intergenic
1192330382 X:70170720-70170742 ACTTGGACAGAGAAAGGGAAGGG - Intergenic
1192486817 X:71534219-71534241 ACTGGGCTGAAGAATGGGGATGG - Intronic
1193386051 X:80872686-80872708 AAATGGAAGAAGTAATGGGATGG - Intergenic
1193772153 X:85600416-85600438 ATTTAGAAGAAGAAAGGTCAAGG + Intergenic
1194737610 X:97531232-97531254 GACTGGAAGAAGGAAGGGGAAGG - Intronic
1195295791 X:103475259-103475281 ACTTAGACCAAGAAAGGGAAAGG - Intergenic
1195347639 X:103966361-103966383 AGTTGGATGGAGAAAGGGGCAGG + Intronic
1195359803 X:104072480-104072502 AGTTGGATGGAGAAAGGGGCAGG - Intergenic
1195446743 X:104960707-104960729 ACTTGGAGGGAGGAGGGGGAAGG - Intronic
1195463655 X:105155814-105155836 AGTTGGGAGAGGAAATGGGAGGG + Intronic
1195545533 X:106108387-106108409 ACATGGCAGAAGAAATGGAAAGG + Intergenic
1195981914 X:110588012-110588034 AATTGGTGGAAGAAAAGGGAAGG - Intergenic
1196797090 X:119511074-119511096 CCTGGGAAGCAGCAAGGGGAAGG - Intergenic
1196911996 X:120493101-120493123 ACTTGGAAGGAGGAAGGGTTGGG - Intergenic
1197301225 X:124783673-124783695 ACTTGGAAGAAGGGAAGGCATGG + Intronic
1197382710 X:125765371-125765393 AAGTGGAAGAAAAAAGGGGAAGG - Intergenic
1197831905 X:130651876-130651898 CTTTGAAAGAAGAAAGGGAAGGG - Intronic
1198137674 X:133770441-133770463 ACCTGGAAGAAGAGAGGGTATGG + Intronic
1198457320 X:136829205-136829227 ACTTGCAAGTGGAAAGGGGTGGG + Intergenic
1198517821 X:137427053-137427075 GCTTGGAGGGAGGAAGGGGATGG + Intergenic
1198547064 X:137703561-137703583 TCTTGGTAGAAGAAAGGAAAAGG - Intergenic
1198576357 X:138014053-138014075 GGTGGGAAGAAGAAAGAGGAAGG + Intergenic
1199067712 X:143440146-143440168 GCTTGGAAGAAGTGGGGGGATGG - Intergenic
1199560829 X:149160822-149160844 TCCTGGAAGAAGAGAGGGTAAGG - Intergenic
1199599830 X:149535340-149535362 AGGTGGAGGAAGAAAGGAGAAGG - Intergenic
1199650812 X:149944912-149944934 AGGTGGAAGAAGAAAGGAGAAGG + Intergenic
1200375697 X:155777449-155777471 ACTTGGTAGAAGAAATTGAAGGG + Exonic
1200782545 Y:7229742-7229764 ACTTGCAAGAAGATAGGATATGG - Intergenic
1201340237 Y:12925579-12925601 AGCTGGAAGGAGAAAGGGTAAGG + Intergenic
1201851440 Y:18486669-18486691 ACGTGGAAAAAGAAAAGGAAAGG + Intergenic
1201881879 Y:18833710-18833732 ACGTGGAAAAAGAAAAGGAAAGG - Intergenic
1202021599 Y:20470254-20470276 AGCTAGAAGCAGAAAGGGGAAGG - Intergenic
1202076966 Y:21045792-21045814 ATTTAGAAGAAGCAAGGGAAAGG + Intergenic
1202115245 Y:21465551-21465573 ACTAAGAAGGAGAAAGAGGATGG + Intergenic