ID: 969334950

View in Genome Browser
Species Human (GRCh38)
Location 4:6502353-6502375
Sequence TGATGTACGGTGCAGCTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 1, 2: 0, 3: 6, 4: 95}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969334946_969334950 -10 Left 969334946 4:6502340-6502362 CCCCTCTGGTCTGTGATGTACGG 0: 1
1: 0
2: 0
3: 2
4: 82
Right 969334950 4:6502353-6502375 TGATGTACGGTGCAGCTGTGTGG 0: 1
1: 1
2: 0
3: 6
4: 95
969334944_969334950 13 Left 969334944 4:6502317-6502339 CCTTAAAAGAAACAAGCGAATCT 0: 1
1: 0
2: 0
3: 17
4: 213
Right 969334950 4:6502353-6502375 TGATGTACGGTGCAGCTGTGTGG 0: 1
1: 1
2: 0
3: 6
4: 95
969334943_969334950 27 Left 969334943 4:6502303-6502325 CCTCTGGGACTTCACCTTAAAAG 0: 1
1: 0
2: 2
3: 8
4: 137
Right 969334950 4:6502353-6502375 TGATGTACGGTGCAGCTGTGTGG 0: 1
1: 1
2: 0
3: 6
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969334950 Original CRISPR TGATGTACGGTGCAGCTGTG TGG Intronic
901799801 1:11701409-11701431 TGATGTACAGCGCAGTTGAGAGG + Intronic
903215655 1:21842091-21842113 TGCTGCACGGTGCTGCTGGGCGG + Exonic
904293908 1:29505556-29505578 TCATGTACTGTGCTACTGTGTGG + Intergenic
905170426 1:36106647-36106669 TGATGGAGGGTGCAGCTGGGAGG + Intronic
907334793 1:53693025-53693047 TGAAGTGCTGTGCACCTGTGAGG - Intronic
914286662 1:146233171-146233193 TGGTTTACAGTCCAGCTGTGTGG - Intergenic
914547693 1:148683912-148683934 TGGTTTACAGTCCAGCTGTGTGG - Intergenic
919418386 1:197340312-197340334 TGAGATACAGTGGAGCTGTGAGG + Intronic
920221780 1:204409574-204409596 TCTTGTAAGGTGCAGCTGTTGGG - Exonic
1070312386 10:75283230-75283252 TGATGAAAGGGGCAGGTGTGAGG + Intergenic
1075069835 10:119313610-119313632 TGGTGAACAGTGCAGCTGTCAGG + Intronic
1077114299 11:876349-876371 AGATGAACAGTGCAGCTGAGAGG + Intronic
1078423034 11:11228071-11228093 TGATGACCTATGCAGCTGTGGGG - Intergenic
1079718725 11:23783772-23783794 TGAGTTACTGTACAGCTGTGAGG - Intergenic
1090153752 11:124414137-124414159 AGATGTACGGAGCAGGGGTGTGG + Intergenic
1092659915 12:10727061-10727083 TGATGTATGGTCCAGCTTTCAGG - Intergenic
1101328967 12:103741917-103741939 TGATGGAGGGTGGAGCTGGGTGG - Intronic
1101687939 12:107044167-107044189 AGATGTCCAGAGCAGCTGTGGGG - Intronic
1106603580 13:31208198-31208220 TGTTGTACAGTGCAGCTTTAAGG + Intronic
1108598647 13:51972073-51972095 TGTTGTGAGGGGCAGCTGTGTGG - Intronic
1110305015 13:73976165-73976187 TAATGTATGGGCCAGCTGTGGGG - Intronic
1122100114 14:99401835-99401857 TGATGGAAGCTGCAGGTGTGCGG + Intronic
1128956715 15:71954632-71954654 TCATATATGGTGCAGATGTGGGG + Intronic
1129330962 15:74826912-74826934 GGATGGACTGAGCAGCTGTGGGG - Intronic
1131146162 15:90014208-90014230 TGACATCCGATGCAGCTGTGTGG + Intronic
1133418543 16:5625460-5625482 TGAAGAACGGTGCAGCGGTCAGG - Intergenic
1135500662 16:22993134-22993156 TGATGTACAGTGTTGCTGAGTGG - Intergenic
1140214242 16:72994621-72994643 AGATGTGCGGGCCAGCTGTGAGG - Intronic
1141879443 16:86848026-86848048 TGAGGCACGGGGTAGCTGTGTGG + Intergenic
1142132061 16:88435671-88435693 GGATGGATGGTGCAGCTCTGGGG + Exonic
1143926003 17:10370824-10370846 TGAGGGAAGGTGCAGCTGTGTGG + Intronic
1147410750 17:40250117-40250139 TGATGTCCGGTCCAGCAGGGTGG - Intronic
1152584414 17:81182595-81182617 TGAGGCACGGAGCAGCTGGGGGG - Intergenic
1155434130 18:25793419-25793441 TGATGTACAGTGGACCTGTGAGG - Intergenic
1158841033 18:61387705-61387727 TGATGTACAGTGCAGTTGGCTGG - Intronic
1160431529 18:78816412-78816434 TGCTGTGTGGGGCAGCTGTGAGG - Intergenic
1167671527 19:50856373-50856395 TGATGCAGTGGGCAGCTGTGAGG - Exonic
925327814 2:3036684-3036706 TGATGAATGGTCCAGCTGTTTGG - Intergenic
926751404 2:16201456-16201478 TGCTGTTCAGTGAAGCTGTGTGG - Intergenic
927560513 2:24069176-24069198 TAATGCACGATACAGCTGTGTGG + Intronic
929001954 2:37355861-37355883 AGATGCACTGTGCACCTGTGGGG - Intronic
931631392 2:64304310-64304332 TGATGTGGGGTGTGGCTGTGAGG - Intergenic
931845183 2:66196319-66196341 TGATGTGCAGTGTGGCTGTGAGG + Intergenic
932994064 2:76827229-76827251 TGGTGTATGGTACAGCTCTGTGG + Intronic
935443039 2:103123977-103123999 TGAAGTTCTGTGCAGCTGGGTGG + Intergenic
938162225 2:128996254-128996276 TTATGTACTGTGCAGAGGTGGGG + Intergenic
938488250 2:131738663-131738685 CAATGTAGGTTGCAGCTGTGAGG + Intronic
939884572 2:147666902-147666924 TGTTGAACAGTGCAGCTCTGGGG + Intergenic
941159110 2:162015687-162015709 GGATGTAGGATGGAGCTGTGGGG - Intronic
944174903 2:196818364-196818386 TGATGGAAGCAGCAGCTGTGAGG - Intergenic
945966500 2:216193020-216193042 TGTTGAATGGAGCAGCTGTGTGG + Intronic
1170791487 20:19512669-19512691 TCATGCACGGGGCAGCAGTGAGG + Intronic
1171489799 20:25508812-25508834 GCATGTACGGTGCAGGTGTAGGG - Intronic
1172186715 20:33035539-33035561 TGGTGTACCATTCAGCTGTGTGG + Intronic
1175713367 20:61239123-61239145 TGATGTCAGGGGCTGCTGTGGGG - Intergenic
1175804498 20:61820054-61820076 TGAAGCAAGGTGCAGCTGAGGGG - Intronic
1176160746 20:63646698-63646720 GAGTGTAGGGTGCAGCTGTGCGG + Intronic
1179831785 21:44001430-44001452 TGATTTCAGGTGCAGCTGGGTGG - Intergenic
1181632334 22:24157746-24157768 TGAGGTCAGGAGCAGCTGTGGGG - Intronic
1184954995 22:47879999-47880021 GGATGCACGCTGCAGCCGTGTGG - Intergenic
954844988 3:53547599-53547621 TGATGGACGTTGCATTTGTGTGG + Intronic
956897897 3:73682590-73682612 AGAGGAACGGTGCAACTGTGAGG + Intergenic
957797024 3:85022362-85022384 TGATTTATGGTGCAGCAGTTGGG + Intronic
960225340 3:115161641-115161663 TGATGTAGTGTGCATCTGTGAGG - Intergenic
963130923 3:141856889-141856911 TGATGTACTGTGCCGCTCTCAGG + Intergenic
965413055 3:168356005-168356027 TGGTGTACTGTGCAGATCTGAGG - Intergenic
966234328 3:177683973-177683995 TGATGTACGGTGCAGCTGAGAGG - Intergenic
966492515 3:180543729-180543751 TGATGTAGGGTACAAATGTGAGG - Intergenic
969334950 4:6502353-6502375 TGATGTACGGTGCAGCTGTGTGG + Intronic
969480818 4:7445937-7445959 TGAGGAACTGTGCAGGTGTGAGG - Intronic
969959082 4:10924731-10924753 GGATGTAGGGTGCCGATGTGAGG + Intergenic
970742002 4:19250373-19250395 TGATGGAAGGGGCTGCTGTGAGG - Intergenic
977290743 4:95161960-95161982 TGAGGTGCGAAGCAGCTGTGAGG - Intergenic
980210527 4:129781708-129781730 TGAAGTAGGGTGCAGCTTTGAGG - Intergenic
980757426 4:137183811-137183833 TGATGCACACTGCAGGTGTGTGG + Intergenic
981042253 4:140233957-140233979 TTTTGTCCCGTGCAGCTGTGTGG + Intergenic
981219915 4:142219937-142219959 TTTTGTTTGGTGCAGCTGTGGGG - Intronic
983095151 4:163552681-163552703 GAATGAACCGTGCAGCTGTGTGG + Intronic
984111557 4:175622906-175622928 TGAAGTTAGGTGCAGCTATGCGG + Intergenic
986486120 5:8239564-8239586 TGATGTACTTTACTGCTGTGTGG - Intergenic
986679189 5:10218036-10218058 TAGTGTATGGAGCAGCTGTGAGG - Intergenic
990162471 5:52957322-52957344 TGATGTAAGGTGCAGATCTTGGG - Exonic
1018096147 6:160388891-160388913 TGATGCACAATGCAGCTTTGGGG - Intronic
1022146141 7:27542976-27542998 TGGTGTACTGTGGAGCTGTTGGG - Exonic
1028725502 7:94082746-94082768 TGATGTATGGTGCAGCTGCTGGG - Intergenic
1032462406 7:132121995-132122017 GAATGGACGGGGCAGCTGTGAGG - Intergenic
1032979892 7:137269386-137269408 TGATCTACAGTGCACTTGTGTGG + Intronic
1033704992 7:143877737-143877759 TGATGTCCTGTGCTGCTGAGTGG - Intronic
1039433505 8:37544008-37544030 TGGTTTAGGGGGCAGCTGTGGGG - Intergenic
1041433246 8:57808360-57808382 CAATGTAGGTTGCAGCTGTGAGG + Intergenic
1047305936 8:123652988-123653010 TGCTGGAGGGTTCAGCTGTGGGG + Intergenic
1047570891 8:126097677-126097699 TGACAAATGGTGCAGCTGTGCGG - Intergenic
1051473927 9:17481535-17481557 AGATGTACGCTGCAGTTGGGTGG - Intronic
1054760348 9:68999143-68999165 TGATGTTCTGTGCCTCTGTGTGG + Intronic
1058040309 9:100295149-100295171 TCAGGTAGGGAGCAGCTGTGGGG - Intronic
1058884247 9:109311430-109311452 TGGTCTACCCTGCAGCTGTGAGG - Intronic
1058992256 9:110265862-110265884 TGAAGAATGGTGCAGCTCTGTGG + Intergenic
1061952862 9:133945909-133945931 TGAGGTACAGAGAAGCTGTGTGG - Intronic
1187555856 X:20350494-20350516 TGATTTTCACTGCAGCTGTGTGG - Intergenic
1188704908 X:33315351-33315373 TAATGTATGGTGCAGCTTTTAGG + Intronic
1189980581 X:46506366-46506388 GGATGTGCAGTGCAGCTGTCTGG + Intronic
1196231030 X:113221619-113221641 TGATGTAAGGTGAAGTTGAGAGG + Intergenic
1196655339 X:118212041-118212063 TGGTGCTCAGTGCAGCTGTGAGG - Intergenic