ID: 969336599

View in Genome Browser
Species Human (GRCh38)
Location 4:6513992-6514014
Sequence ATACAGATGGGGTGTATAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 127}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969336599 Original CRISPR ATACAGATGGGGTGTATAAT TGG Intronic
901515958 1:9746150-9746172 ATGCAGGTGAGGTTTATAATAGG - Intronic
902706347 1:18207939-18207961 ATACAGAAGGGCTGTACACTTGG + Intronic
905238648 1:36567922-36567944 ATCCAGATGGGGCTTAGAATGGG - Intergenic
906762584 1:48389303-48389325 ATACAGATGATTTGTATATTTGG - Intronic
912272183 1:108222737-108222759 ACACAGACGGGGTGATTAATTGG + Intergenic
915533712 1:156520553-156520575 ATACATATGGGCTATATTATAGG + Intergenic
916278195 1:163018642-163018664 ATACAGATGGGGTTTATTTTGGG - Intergenic
916507713 1:165443203-165443225 AGACAGTTGGGGTGAATAAAAGG - Intronic
918203055 1:182285241-182285263 ATACAGAGAGGATGTTTAATGGG + Intergenic
918273499 1:182926948-182926970 CTACAGATGGGTTAAATAATTGG + Intronic
923783416 1:237044825-237044847 ATGCTGATGGGGTGAATAATGGG + Intronic
923788624 1:237092155-237092177 ATAAGGATGCGTTGTATAATGGG + Intronic
923961976 1:239095828-239095850 ACACTGATGGGGTTGATAATGGG + Intergenic
924621106 1:245661494-245661516 ATATATATGGTGTATATAATGGG - Intronic
1064704856 10:18061041-18061063 ATAAAGAGGGGTTGGATAATAGG + Intergenic
1067950098 10:50727309-50727331 ATAAAGAGGTGGTGTATAATGGG - Intergenic
1068478139 10:57554233-57554255 ATACTGATGTGGTCTATAAAAGG - Intergenic
1069219409 10:65864787-65864809 ATAGACATGGGGAGTATGATAGG + Intergenic
1070320520 10:75351561-75351583 ATACAGATGGGGTTCAGAAGTGG + Intergenic
1071687188 10:87771423-87771445 ATACAGTTTGGGAGTATAAGGGG + Intronic
1071995727 10:91147419-91147441 ATACAGAGGGAGTGAAGAATTGG - Intergenic
1079767496 11:24413610-24413632 ATACAGATGAGTTGTAAAAATGG - Intergenic
1082178849 11:49094454-49094476 TGACAGATGGGTTGCATAATGGG + Intergenic
1086686421 11:89738379-89738401 TGACAGATGGGTTGCATAATGGG - Intergenic
1086700077 11:89891710-89891732 TGACAGATGGGTTGCATAATGGG + Intergenic
1086706093 11:89952806-89952828 TGACAGATGGGTTGCATAATGGG - Intergenic
1090730965 11:129573224-129573246 AGACAGATGGGGAGTAAAACGGG - Intergenic
1092249099 12:6882099-6882121 ATACTGATAGGGGGTCTAATAGG - Intronic
1092367451 12:7888938-7888960 ATAGAGATGGAGTGTCAAATTGG - Intronic
1095674040 12:44895843-44895865 ATAAAGATGGAGTGCATAACTGG + Intronic
1096732443 12:53625653-53625675 AGATAGATGGGGTGGATTATTGG - Intronic
1097173811 12:57131346-57131368 AGAAAGATGGGGTGGAGAATGGG + Intronic
1099726431 12:86434496-86434518 ATTCAGATAGAGTTTATAATAGG + Intronic
1100362167 12:93889042-93889064 ATCCAGATGGGTTGTGGAATTGG + Intronic
1101425265 12:104583085-104583107 ATACATATGTGTTGTATACTGGG + Intronic
1104457765 12:128929391-128929413 AGCCAGATGGGGTGTACCATTGG + Intronic
1107798324 13:44078191-44078213 GTACAGAATGGATGTATAATAGG - Intergenic
1108603895 13:52017886-52017908 ATAAAGATGGTGTGTATGTTGGG - Intronic
1108674779 13:52727077-52727099 GTAGAGATGGGGTTTATAGTTGG - Intronic
1110636094 13:77768395-77768417 ATACAGATGGGGTTTCTACCTGG - Intergenic
1110729981 13:78868898-78868920 AGAAAAGTGGGGTGTATAATGGG + Intergenic
1110941738 13:81359451-81359473 ATAAAGAAGGGGTGAATATTTGG - Intergenic
1113645414 13:111991516-111991538 CTACATATGGGGATTATAATTGG - Intergenic
1114717470 14:24842931-24842953 ATAGAGCTGGGAAGTATAATAGG + Intronic
1114741469 14:25102633-25102655 ATACAGATTGTGTGTATTATGGG - Intergenic
1120619219 14:86742462-86742484 ATACTGATGGTGTGGAGAATAGG - Intergenic
1121275537 14:92665113-92665135 ATACAGCTCAGGTGTATAGTAGG - Intronic
1127010414 15:54620271-54620293 ACACAGGTAGGGTGTATAAATGG + Intronic
1134640654 16:15827126-15827148 ACACAGATGTGGTATATAGTAGG - Intronic
1140626678 16:76803165-76803187 ATACTGATGGGGTGCTTACTGGG - Intergenic
1140945564 16:79765046-79765068 ATAGAGATGGGGTGGATGTTGGG + Intergenic
1145180034 17:20740773-20740795 ATACATATCAGGTGTATAAATGG + Intergenic
1145856008 17:28158144-28158166 ATACAGCTTAGGTGTGTAATAGG - Intronic
1149100987 17:52906834-52906856 ATAAAGAAGGGTTGTATTATAGG + Intergenic
1158105180 18:53877409-53877431 ATAAAGATGGGATGGTTAATGGG - Intergenic
1168152953 19:54458770-54458792 ACACAGATGGGGTGGAGAAGAGG - Intronic
927913639 2:26919247-26919269 ATAAAGATGGTGTTTATAAAAGG + Intronic
932073039 2:68639724-68639746 ATACAGACTAGGTGTATAGTAGG + Intergenic
933433602 2:82215657-82215679 ATACAGCCTGGGTGTCTAATAGG - Intergenic
935508626 2:103940509-103940531 ACAAAAATGGGTTGTATAATAGG + Intergenic
937490869 2:122365836-122365858 CTACAGAAGGGGTGTAAAAGGGG + Intergenic
938079098 2:128359812-128359834 ATACAGAAAGGGGGTTTAATTGG - Intergenic
938552789 2:132396087-132396109 ATATAGATGGGGCATATAGTGGG - Intergenic
938563142 2:132492597-132492619 ATATAGATGGTGTGTATATATGG - Intronic
938945034 2:136204713-136204735 AAACAGATTTGGTGTCTAATGGG + Intergenic
939235823 2:139491110-139491132 ATATAGACTGGGTGTATAGTAGG - Intergenic
939560151 2:143722314-143722336 ATACTGATGAGGTATATATTAGG - Intronic
941205565 2:162568369-162568391 ATACAGCTTAGGTGTATAGTAGG + Intronic
941448680 2:165632744-165632766 ATAAAGATGGGGTGAATCATGGG - Intronic
942289134 2:174452306-174452328 ATTCAGATGGGATTTATATTTGG - Intronic
944098221 2:195993888-195993910 TGACAGATGGGCTGTAGAATGGG - Intronic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
1174727874 20:52882518-52882540 AGACTGATGGGATGTATAATGGG + Intergenic
952183485 3:30943703-30943725 ATACAAATGTGGTAAATAATAGG - Intergenic
959416792 3:106085928-106085950 ATACAGAAGCTGTGAATAATTGG - Intergenic
964069126 3:152610782-152610804 ATACAGATGGGGTTTCTACCTGG - Intergenic
965870387 3:173257473-173257495 ATAAAGAGGGGGTGGTTAATGGG + Intergenic
965955843 3:174367851-174367873 ATGCAGATGAGGTGTTTCATAGG + Intergenic
967446736 3:189575791-189575813 AAACAGAAGGGTTGTATAAAAGG - Intergenic
969336599 4:6513992-6514014 ATACAGATGGGGTGTATAATTGG + Intronic
972436708 4:39042370-39042392 TGACAGATGTGGTGAATAATAGG + Intergenic
973009853 4:45058835-45058857 ATACAGATGGAATTAATAATTGG + Intergenic
974486866 4:62516771-62516793 ATACAGCTGAGGTGTTAAATTGG - Intergenic
974695444 4:65363252-65363274 ATATAGATGAGGTTTAGAATGGG - Intronic
977149090 4:93486692-93486714 AAACAGATAGGGTTTATTATAGG - Intronic
978880011 4:113690323-113690345 ATTCAGATGAGATGTATTATTGG - Intronic
981296102 4:143133577-143133599 ATACAGCTTAGGTGTGTAATAGG + Intergenic
982540887 4:156669232-156669254 ATAAAGAGGGGATGTTTAATAGG - Intergenic
983348133 4:166553595-166553617 ATACTGAAAGGGTGTATAACAGG - Intergenic
983964916 4:173798525-173798547 ATAAAGATGGGTTGGTTAATGGG - Intergenic
984837569 4:184036026-184036048 AGACAAATGGGGTGAAGAATTGG + Intergenic
988399125 5:30738664-30738686 ATACATATTTGGTGAATAATTGG - Intergenic
991534116 5:67647839-67647861 ATACAGCTGTGGAGTACAATTGG - Intergenic
993709146 5:91206338-91206360 ATACAGCTTTGGTGTGTAATAGG - Intergenic
994115413 5:96056487-96056509 ACACAGATGGGTTGTTTTATTGG + Intergenic
994871202 5:105351883-105351905 AGACAGATGGAGTGGATAAGTGG + Intergenic
1003817743 6:9861166-9861188 ATACTGATAGACTGTATAATGGG + Intronic
1003848547 6:10198793-10198815 ATAGAAATGGGGTGTATTTTAGG - Intronic
1007103328 6:39266628-39266650 ATACAGCCGGGGTGTATAGCAGG + Intergenic
1007747949 6:44054787-44054809 AAACAGATGGTGTGGTTAATTGG + Intergenic
1009553051 6:65124823-65124845 ATACAAAAGAGGTGTGTAATGGG - Intronic
1010203457 6:73302447-73302469 ATATAGCTTGGGTGTATAGTAGG - Intronic
1012755187 6:103221720-103221742 ATAAAGATGGGTTGGTTAATGGG - Intergenic
1013499123 6:110729948-110729970 ATACAACTGGGTTGTATAACTGG + Intronic
1014016770 6:116540073-116540095 AAACAGAAGGGGAGTGTAATAGG - Intronic
1018402451 6:163438489-163438511 ATACAGCTGAGGTGTGTAGTAGG - Intronic
1020623060 7:10541611-10541633 ATTTATATGGGGTGTTTAATAGG - Intergenic
1022032450 7:26504771-26504793 ATACAGATGGGGTCTCTACCTGG - Intergenic
1027678019 7:81182888-81182910 ATACAGATATAGTGTTTAATAGG + Intronic
1028935667 7:96461474-96461496 ATAAAGATGAGGTGGTTAATGGG - Intergenic
1029340986 7:99944453-99944475 ATGCAGATGGGGTCTCTACTTGG + Intergenic
1029602364 7:101575285-101575307 ATGCAGATGGGGTCTCTACTTGG - Intergenic
1029971041 7:104789620-104789642 ATACAAATGTAGTGTAAAATTGG - Intronic
1031333351 7:120494978-120495000 ATAGCCATGGAGTGTATAATTGG + Intronic
1032424609 7:131812081-131812103 ATACTGATGGAGGGTTTAATTGG + Intergenic
1032526888 7:132584919-132584941 ATACAGATGGGGTGGAGGAGTGG - Intronic
1036218347 8:6899690-6899712 ATACAGATGGAAAGTAGAATGGG - Intergenic
1037732263 8:21536658-21536680 ATACTGCTTAGGTGTATAATAGG - Intergenic
1040815129 8:51499630-51499652 AGTCAGATGGGTTGTATAAATGG + Intronic
1046244659 8:111543381-111543403 ATACAGACGGGTTGGAAAATGGG - Intergenic
1046544938 8:115638070-115638092 ATTTACATGGGGTGTATAGTGGG - Intronic
1047889413 8:129291341-129291363 ATAGAGATGGGCAGTATTATGGG + Intergenic
1051059771 9:13032482-13032504 ACACAGTTGGTGTGTATAATGGG - Intergenic
1052223480 9:26055726-26055748 ATAGAGTTGGGGTGGAAAATAGG + Intergenic
1056227757 9:84512930-84512952 ATAAAGGTGGGGTGAATAACTGG + Intergenic
1056963064 9:91143607-91143629 ATACATATTTGGTGTATAGTAGG - Intergenic
1058697650 9:107573278-107573300 ATACAGTTTAGGTGTATAGTAGG + Intergenic
1059846778 9:118288380-118288402 ATAGAGGTGGGGTGGATAACAGG + Intergenic
1060022233 9:120141694-120141716 ATATAGAGGGGGTGAAAAATTGG - Intergenic
1187008798 X:15258929-15258951 ATACAGATGCTGTGTCTGATTGG - Exonic
1188634284 X:32408936-32408958 ATAGAGATGGGGTGGATAGATGG - Intronic
1195211273 X:102653688-102653710 ATACAGATAGAGTGTAGAACAGG - Exonic
1196757224 X:119168513-119168535 AGACAGATGGGGTGAGGAATTGG - Intergenic
1196930064 X:120673260-120673282 ATAGAGATGGGTTGAAAAATAGG + Intergenic
1198710383 X:139495357-139495379 TTACAGATGGGGTGTGGAGTGGG - Intergenic