ID: 969336752

View in Genome Browser
Species Human (GRCh38)
Location 4:6515134-6515156
Sequence CTGTATTAGCATCCTGTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969336752_969336759 24 Left 969336752 4:6515134-6515156 CCCACAACAGGATGCTAATACAG 0: 1
1: 0
2: 0
3: 2
4: 127
Right 969336759 4:6515181-6515203 AGAATCAAATCAGCTCTTAATGG No data
969336752_969336758 0 Left 969336752 4:6515134-6515156 CCCACAACAGGATGCTAATACAG 0: 1
1: 0
2: 0
3: 2
4: 127
Right 969336758 4:6515157-6515179 GTGGCGGCTGGTCACTTTAAAGG 0: 1
1: 0
2: 0
3: 4
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969336752 Original CRISPR CTGTATTAGCATCCTGTTGT GGG (reversed) Intronic
902181589 1:14693285-14693307 CTCCCTTAGCATCCTGTTGCCGG - Intronic
902845769 1:19109683-19109705 ATTTATTAGCATCATGATGTTGG - Intronic
908521540 1:64948054-64948076 ATGTATTACCCTCCTGTTCTTGG - Intronic
909416311 1:75409750-75409772 CTGTAGTAGCATTGTGTTTTGGG - Intronic
910424285 1:87103286-87103308 CTTTATTACCATCCTGTGGGAGG - Intronic
912319109 1:108693281-108693303 CAGTATTGGCCTCGTGTTGTTGG + Intronic
917406705 1:174714301-174714323 CTCTCTTAGCACCCTGTGGTTGG + Intronic
918000812 1:180493392-180493414 CTGTCCTGGCAGCCTGTTGTGGG - Intronic
919025521 1:192164661-192164683 CTGTACTACCTTCTTGTTGTGGG + Intronic
921274927 1:213510060-213510082 ATGAATTAGCACCCTATTGTAGG - Intergenic
923478815 1:234363448-234363470 ATGTATTTGCATCCTTTTTTGGG - Intergenic
1062957340 10:1549019-1549041 CTCTTTTAGCATCTTGTAGTTGG - Intronic
1064321411 10:14308891-14308913 CCGTATTAGCAGCATCTTGTAGG - Intronic
1068624420 10:59225787-59225809 TTTTAATAGCATCCTCTTGTAGG + Intronic
1078348612 11:10573854-10573876 CTCTATTTGCATCCTGTCTTTGG + Exonic
1080459648 11:32442262-32442284 CTGTTTTAGGGTCCTGGTGTAGG - Intergenic
1083468450 11:62865199-62865221 CAGTTTTAGCATCCTTTCGTAGG + Intronic
1085947306 11:81286885-81286907 CTGTCCTAGCATCCATTTGTGGG + Intergenic
1090490347 11:127155262-127155284 CTGTTTTACCATCCTGTTACAGG - Intergenic
1093899673 12:24617033-24617055 TTGTATTAGTATCATGTTTTAGG - Intergenic
1097258924 12:57702284-57702306 CTGTATGAGTTTCCTGTTCTAGG + Intronic
1097781640 12:63713477-63713499 TTGGATAAGCATCCTGATGTGGG - Intergenic
1098747700 12:74260863-74260885 CTGTGTTAGCCACCTATTGTGGG - Intergenic
1099689709 12:85937435-85937457 CTGTATTAGGGTCCTCTAGTTGG - Intergenic
1101852268 12:108413152-108413174 CTTTATTTGGATCCTGTGGTGGG + Intergenic
1104498352 12:129261922-129261944 ATGTTTTAGTATCCTGTTATGGG - Intronic
1108205212 13:48081903-48081925 CTGGATTAGTGTCCTGTTTTTGG - Intronic
1111200005 13:84923133-84923155 CTGATTTAGCAACCTTTTGTTGG - Intergenic
1118296991 14:64579427-64579449 CTGTAAAAGCTTCCTGTTTTTGG - Intronic
1119343485 14:73901629-73901651 CTGTATTAGCATGATTTTTTTGG + Intronic
1120572090 14:86132148-86132170 TTGTATTAGTTTCCTGTTGCTGG + Intergenic
1120714285 14:87823424-87823446 CTTTAGTATCATCCTGTTTTTGG - Intergenic
1121550597 14:94796604-94796626 CTGTTTTAGGATACTGTTTTAGG + Intergenic
1122388231 14:101363152-101363174 CTGTATCTGCATCCTCTAGTAGG + Intergenic
1125039043 15:35161850-35161872 TTGTTTAAGCATCCAGTTGTTGG + Intergenic
1125106870 15:35981892-35981914 AGGTATTATCATCCTGTTTTAGG - Intergenic
1125931803 15:43605386-43605408 CTGTAATAGGATCCAGTTGATGG - Exonic
1126430015 15:48573115-48573137 CTTTCTTAGCCTCCTGTTTTCGG - Intronic
1127334119 15:57966880-57966902 GTGGAGTCGCATCCTGTTGTAGG - Intronic
1132058536 15:98670927-98670949 CTCCAGTAGCTTCCTGTTGTAGG + Intronic
1137327362 16:47455405-47455427 GTCTTTTAGCATACTGTTGTTGG - Intronic
1137682816 16:50365633-50365655 TTGAATTAGCACCCTGTTCTTGG - Intronic
1138415577 16:56869736-56869758 CTGGATCATCATCCTGCTGTCGG + Exonic
1140199061 16:72879749-72879771 CTGTGTTAGGCTCCTGTTGGAGG - Intronic
1145346211 17:22042828-22042850 CTGTATTTGAACCCTGTTGAAGG - Intergenic
1148289083 17:46426637-46426659 TTGTATTAGCCTTCTATTGTTGG + Intergenic
1148311252 17:46644214-46644236 TTGTATTAGCCTTCTATTGTTGG + Intronic
1155431738 18:25766375-25766397 CTGAACTAGCCTCCTCTTGTAGG - Intergenic
1158896370 18:61917744-61917766 CTGTATGAGGATTCTGTTATGGG + Intergenic
1163375644 19:16928590-16928612 CAGTATTAGCTTCCTGTGTTGGG + Intronic
1163948562 19:20563319-20563341 CTTTAGTAACATCCTGTTGCAGG + Intronic
928138491 2:28707096-28707118 CTGTATTAGTTTCCTGTGGCTGG - Intergenic
928879101 2:36076967-36076989 CTGTCTTGGAATCCTGTTGATGG - Intergenic
932115942 2:69047214-69047236 CTGTATTCGCATTCAGTTCTTGG + Intronic
935259826 2:101344507-101344529 CTGCAATCCCATCCTGTTGTCGG + Intergenic
939400209 2:141683118-141683140 CTGTATTAGGTTCCTGTTGCTGG - Intronic
941082534 2:161078470-161078492 CTGAATGACCATTCTGTTGTGGG - Intergenic
942356632 2:175120807-175120829 CTGTATTAGCTGCCTTTTTTTGG - Intronic
942856929 2:180560092-180560114 CTGTCTTGGCATCTTGTTCTTGG + Intergenic
945373137 2:209046168-209046190 CTGAATTATCATCCAGTTTTAGG + Intergenic
1171521351 20:25776638-25776660 CTGTATTTGAACCCTGTTGAAGG + Intronic
1171555460 20:26079233-26079255 CTGTATTTGAACCCTGTTGAAGG - Intergenic
1176198737 20:63850061-63850083 CTCACTTAGCATCCTGTTTTTGG + Intergenic
1176655181 21:9581751-9581773 CTGTATTTGAACCCTGTTGAAGG + Intergenic
1177394914 21:20521464-20521486 CTGTATTAGTTTCCTATTGCTGG + Intergenic
1184636900 22:45839862-45839884 GTGTTTTTGCCTCCTGTTGTTGG - Intronic
1185199952 22:49495176-49495198 TTGTCTCTGCATCCTGTTGTGGG - Intronic
955345275 3:58156433-58156455 ATGTTTTAGCCTGCTGTTGTTGG + Intronic
955591659 3:60542322-60542344 CTATCTTAGCATCCCATTGTTGG + Intronic
956515755 3:70046079-70046101 TTGTATTAGCATCCATTTCTTGG + Intergenic
956730850 3:72195253-72195275 CTGTATTAGCATTCTCTAGAGGG + Intergenic
958266393 3:91442680-91442702 ATCTATAAGCCTCCTGTTGTAGG + Intergenic
959311871 3:104748716-104748738 CTGTTTTAGCATCTTGTGGAAGG + Intergenic
962261660 3:133913230-133913252 CTGTATTTGCATCCTGACTTCGG + Intergenic
969336752 4:6515134-6515156 CTGTATTAGCATCCTGTTGTGGG - Intronic
971937126 4:33165670-33165692 CTTTATTAGCATTTTATTGTAGG - Intergenic
972646985 4:40978034-40978056 CTATATGAGCACCTTGTTGTAGG - Intronic
975362929 4:73492982-73493004 TTCTAATAGCATCCTGTTCTAGG + Intronic
978094474 4:104758640-104758662 CAGCATGAGCTTCCTGTTGTTGG - Intergenic
978380871 4:108127174-108127196 CAGTTTTAGCATTCTGTTCTTGG - Intronic
978396971 4:108291157-108291179 CTGGACTAGCATTTTGTTGTAGG - Intergenic
980461144 4:133115787-133115809 CTGTATTATCATTCACTTGTAGG + Intergenic
981711649 4:147714926-147714948 ATTTATTAGTTTCCTGTTGTTGG + Intergenic
983021033 4:162675615-162675637 CTGTATTATCATCCTGTTTGGGG + Intergenic
985052823 4:186009963-186009985 CTCTATTAGAATCCTGGTTTGGG + Intergenic
985245287 4:187974433-187974455 CTGTGTCAGCATCATCTTGTTGG - Intergenic
986395739 5:7327907-7327929 CTGTGAGAGCATCCTGTTGGTGG + Intergenic
986859364 5:11907824-11907846 GTGTATTGGCTTCCTGTTATGGG + Intergenic
987614736 5:20259005-20259027 CTGTATTTGTTTTCTGTTGTGGG - Intronic
995667863 5:114564929-114564951 CTATATTATGATCCTGCTGTTGG + Intergenic
1002943556 6:1739448-1739470 CTGCAATAGCATCCTGCTATAGG + Intronic
1003359186 6:5408094-5408116 CTGGATTTGCACCCTGTTGCAGG + Intronic
1007047621 6:38793325-38793347 CCGTTTTAACATCCTGTTCTTGG + Intronic
1008061331 6:47000240-47000262 CTGAGTTAGCATGATGTTGTCGG + Exonic
1008988879 6:57579277-57579299 ATCTATAAGCCTCCTGTTGTAGG - Intronic
1009177421 6:60477514-60477536 ATCTATAAGCCTCCTGTTGTAGG - Intergenic
1009299061 6:61991747-61991769 CTGTCTTGGCATCCTGCTGCTGG - Intronic
1014666847 6:124248835-124248857 CTGTGTTAGCACACTGATGTCGG - Intronic
1015417793 6:132969407-132969429 CTGTCTTAGCATCTGGTGGTTGG + Intergenic
1018067681 6:160134963-160134985 CTGTATCAGCGTCCAGTGGTAGG + Intronic
1021121794 7:16804109-16804131 CTGTACAAACATCCTGCTGTGGG + Intronic
1022002095 7:26235797-26235819 CTGTATCAGCAAACTATTGTGGG - Intergenic
1022356682 7:29622409-29622431 CTGTATTACCTTCCTGTTCCTGG + Intergenic
1022940240 7:35229571-35229593 TTGGATAAGCATCCTGATGTGGG - Intronic
1025281818 7:57631596-57631618 CTGTATTTGAACCCTGTTGAAGG + Intergenic
1025302911 7:57833921-57833943 CTGTATTTGAACCCTGTTGAAGG - Intergenic
1028279032 7:88897549-88897571 ATGTATTAGTTTCCTATTGTAGG - Intronic
1030065048 7:105652948-105652970 TTGTATTAGAATCCGGTTCTGGG + Intronic
1030287740 7:107843945-107843967 TTGTATCAGCCTCCTGTTGAAGG + Intergenic
1033354742 7:140590553-140590575 TTATATTAGCATCTTGTTCTTGG - Intronic
1037097158 8:14999853-14999875 CAGGATGAGCATCCTGTTTTAGG + Intronic
1037563427 8:20095515-20095537 TTGTATTAGTTTCCTATTGTTGG - Intergenic
1038591128 8:28838962-28838984 CTTTATTAGCAGCATGTTCTGGG + Intronic
1042221773 8:66481572-66481594 CTGTATTAAAATCATGTTGCAGG + Intronic
1042501047 8:69509478-69509500 CTGTATTAGATACTTGTTGTTGG + Intronic
1051972520 9:22907727-22907749 ATGTTTTAGCATCCTTTTGGAGG - Intergenic
1054872314 9:70059240-70059262 CTGTCTTTCCATCCTGTAGTGGG + Intronic
1054920460 9:70537794-70537816 CTGACTAAGCATCCAGTTGTTGG + Intronic
1056845357 9:90032678-90032700 CTGAATTTGCACCCTGTAGTGGG - Intergenic
1056847192 9:90050043-90050065 ATATATTACCATACTGTTGTTGG + Intergenic
1060388103 9:123252209-123252231 CTGTATTTGCACCGTGATGTTGG + Intronic
1203632903 Un_KI270750v1:85223-85245 CTGTATTTGAACCCTGTTGAAGG + Intergenic
1187171778 X:16859224-16859246 CTGAATTAGCATCTTATTTTAGG + Intronic
1187932602 X:24307260-24307282 CTGTATTAGATTTCTGTTTTGGG - Intergenic
1188378763 X:29465880-29465902 CAGTATGAGCATCCTATTGGTGG - Intronic
1189737517 X:44086833-44086855 CTGTATTTTCACCGTGTTGTGGG + Intergenic
1193287343 X:79727907-79727929 CTCTTTTTGCATCCTGTTTTGGG + Intergenic
1194970879 X:100342259-100342281 CTGTATCAGCATCCAATAGTGGG - Intronic
1196267131 X:113663270-113663292 CTGTATTAAAATCATGTTTTGGG - Intergenic
1196613249 X:117737787-117737809 CTGTTTTGGCATCATTTTGTAGG + Intergenic