ID: 969337935

View in Genome Browser
Species Human (GRCh38)
Location 4:6522559-6522581
Sequence GCCCCCGGAGTCACCGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 126}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969337922_969337935 10 Left 969337922 4:6522526-6522548 CCATGTTCCCCACACGGGGATGG 0: 1
1: 0
2: 1
3: 12
4: 142
Right 969337935 4:6522559-6522581 GCCCCCGGAGTCACCGGGCATGG 0: 1
1: 0
2: 2
3: 5
4: 126
969337914_969337935 20 Left 969337914 4:6522516-6522538 CCCTCCAGCCCCATGTTCCCCAC 0: 1
1: 1
2: 3
3: 58
4: 481
Right 969337935 4:6522559-6522581 GCCCCCGGAGTCACCGGGCATGG 0: 1
1: 0
2: 2
3: 5
4: 126
969337916_969337935 16 Left 969337916 4:6522520-6522542 CCAGCCCCATGTTCCCCACACGG 0: 1
1: 0
2: 4
3: 15
4: 190
Right 969337935 4:6522559-6522581 GCCCCCGGAGTCACCGGGCATGG 0: 1
1: 0
2: 2
3: 5
4: 126
969337913_969337935 28 Left 969337913 4:6522508-6522530 CCTGTGTTCCCTCCAGCCCCATG 0: 1
1: 0
2: 3
3: 41
4: 398
Right 969337935 4:6522559-6522581 GCCCCCGGAGTCACCGGGCATGG 0: 1
1: 0
2: 2
3: 5
4: 126
969337915_969337935 19 Left 969337915 4:6522517-6522539 CCTCCAGCCCCATGTTCCCCACA 0: 1
1: 1
2: 2
3: 49
4: 571
Right 969337935 4:6522559-6522581 GCCCCCGGAGTCACCGGGCATGG 0: 1
1: 0
2: 2
3: 5
4: 126
969337926_969337935 3 Left 969337926 4:6522533-6522555 CCCCACACGGGGATGGCAGGGCT 0: 1
1: 0
2: 3
3: 12
4: 147
Right 969337935 4:6522559-6522581 GCCCCCGGAGTCACCGGGCATGG 0: 1
1: 0
2: 2
3: 5
4: 126
969337921_969337935 11 Left 969337921 4:6522525-6522547 CCCATGTTCCCCACACGGGGATG 0: 1
1: 0
2: 0
3: 7
4: 70
Right 969337935 4:6522559-6522581 GCCCCCGGAGTCACCGGGCATGG 0: 1
1: 0
2: 2
3: 5
4: 126
969337912_969337935 29 Left 969337912 4:6522507-6522529 CCCTGTGTTCCCTCCAGCCCCAT 0: 1
1: 1
2: 3
3: 43
4: 384
Right 969337935 4:6522559-6522581 GCCCCCGGAGTCACCGGGCATGG 0: 1
1: 0
2: 2
3: 5
4: 126
969337920_969337935 12 Left 969337920 4:6522524-6522546 CCCCATGTTCCCCACACGGGGAT 0: 1
1: 0
2: 1
3: 5
4: 77
Right 969337935 4:6522559-6522581 GCCCCCGGAGTCACCGGGCATGG 0: 1
1: 0
2: 2
3: 5
4: 126
969337928_969337935 1 Left 969337928 4:6522535-6522557 CCACACGGGGATGGCAGGGCTGG 0: 1
1: 0
2: 3
3: 32
4: 298
Right 969337935 4:6522559-6522581 GCCCCCGGAGTCACCGGGCATGG 0: 1
1: 0
2: 2
3: 5
4: 126
969337927_969337935 2 Left 969337927 4:6522534-6522556 CCCACACGGGGATGGCAGGGCTG 0: 1
1: 0
2: 2
3: 14
4: 163
Right 969337935 4:6522559-6522581 GCCCCCGGAGTCACCGGGCATGG 0: 1
1: 0
2: 2
3: 5
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969337935 Original CRISPR GCCCCCGGAGTCACCGGGCA TGG Intronic
900595765 1:3479510-3479532 TCCCCAGGAGTGACCGGGCACGG + Exonic
900598357 1:3492712-3492734 ACCCCCGCAGTCACAGTGCAGGG + Exonic
901443515 1:9293250-9293272 GCCCCCGGAGCCACCGCGGGAGG - Intronic
903540136 1:24092203-24092225 GCCCCGGGTGTCACTGGGCGGGG + Exonic
903650190 1:24917264-24917286 GCCCCTGGAGACATAGGGCAGGG + Intronic
903741862 1:25562998-25563020 TCCCCAGCAATCACCGGGCAGGG - Intronic
906513352 1:46423996-46424018 GCTGCCGGAGTCACTGGGCCAGG - Intergenic
907418442 1:54330376-54330398 GCCCAGGGAGTCACCTGGCCTGG + Intronic
911176122 1:94820252-94820274 GCGCCCGCAGTCGCCGGGCCAGG + Intergenic
915462124 1:156076548-156076570 GGCCCCGGAGGCATGGGGCACGG + Exonic
915912702 1:159924522-159924544 GCCCCAGGAGGCACAGGGCGCGG + Intronic
916922688 1:169485735-169485757 GCCCGCCGAGACACCGGGCCGGG + Exonic
924189772 1:241538331-241538353 GGCCCAGGAGTCAATGGGCAAGG + Intronic
924571423 1:245240970-245240992 GCCCCCAGAGTCCCCGCCCAGGG + Intronic
924741913 1:246799146-246799168 GCCGCAGGAGTCACCAGGGAGGG - Intergenic
1067474715 10:46557604-46557626 GCCCCCGGCGTCACGGGACCGGG - Intergenic
1067499159 10:46786486-46786508 CGCCCCGGAGTCACCGTGCCCGG - Intergenic
1067595482 10:47553866-47553888 CGCCCCGGAGTCACCGTGCCCGG + Intergenic
1067951159 10:50739574-50739596 CACCCCGGAGTCACCGTGCCCGG - Intronic
1070032645 10:72692312-72692334 GCGCCCGGAGGCTCCGGGGAGGG + Intronic
1070319444 10:75343656-75343678 GGACCTGGAGTCACTGGGCAGGG - Intergenic
1077158138 11:1100585-1100607 GCTCTCAGAGTCACCAGGCAGGG - Intergenic
1077698167 11:4414057-4414079 GCCCCAGGACTCAGCTGGCAAGG + Intergenic
1083430852 11:62612924-62612946 GCCCCCGGATTCCCAGGGGACGG + Exonic
1084368050 11:68716566-68716588 GCCCCAGGAGTCACAGGGCATGG - Intronic
1084459292 11:69287228-69287250 CGCCGCGCAGTCACCGGGCAGGG + Intergenic
1090537295 11:127657577-127657599 GCCCCCGGAGTCACAGGGCTGGG - Intergenic
1096143827 12:49264690-49264712 GCCCCCGCACCCACCGGGGACGG + Intronic
1096404038 12:51329819-51329841 GCCCCCAGAGTCACCCTGCAGGG + Exonic
1101754187 12:107608048-107608070 GCCCTCGGAGTCAGCAAGCAGGG + Intronic
1102587333 12:113932580-113932602 GCTCCCCGAGTCACCAGGCCAGG + Intronic
1104546938 12:129721504-129721526 GCTCCCGGGGTCACCTGGGAGGG + Intronic
1113640959 13:111956398-111956420 CACCCCGGAGTCACAGGCCAGGG + Intergenic
1113909266 13:113834504-113834526 GCCCCCGGAACCACCGTGAAGGG + Intronic
1114266313 14:21074575-21074597 GCCACCGGAGACACCGGGCGTGG + Exonic
1118144815 14:63123969-63123991 GCCCCTGGAGTGAGAGGGCAGGG + Intergenic
1118718371 14:68576262-68576284 GCCCCAGGGGTCACAGAGCAGGG + Intronic
1119027586 14:71166319-71166341 ACCCCGGGAGTCAAAGGGCAGGG - Intergenic
1123059187 14:105586777-105586799 GCCCCCCGAGGCTCAGGGCAGGG + Intergenic
1128126352 15:65195885-65195907 GCCCCCTAAGTTACAGGGCAGGG - Exonic
1128156551 15:65395253-65395275 GTCCCCCGTGTCACCAGGCATGG - Exonic
1128263475 15:66249438-66249460 CCCCACAGAGCCACCGGGCATGG + Intronic
1128611092 15:69074250-69074272 GCCCCGGGAGTCTCCAGGCGCGG + Intergenic
1132056028 15:98650349-98650371 GCCCCCGGCGTCCCGGGGCTGGG + Intronic
1132353348 15:101154305-101154327 ACCTCCGTAGTCACGGGGCAGGG - Intergenic
1132665686 16:1080444-1080466 GTCCCCGGAGTCCCTGGCCAGGG + Intergenic
1132840839 16:1977880-1977902 GCCATCGGAGTCAGCAGGCAGGG - Intronic
1133325113 16:4937326-4937348 GCCTCCGGAGTCCCCCGGCTGGG - Intronic
1133347654 16:5081214-5081236 GCCCCTGGGGCCACCTGGCAGGG - Intronic
1136242161 16:28951233-28951255 GCCCCCGGAGCCCCCGGGGCCGG + Exonic
1139506372 16:67400031-67400053 GCCCAGGGAGGCACCGGGGAAGG + Intronic
1139952509 16:70679132-70679154 GCCCCCGGGGTCCCTGGCCAGGG - Intronic
1140470902 16:75213781-75213803 GCACCCTGAGACACAGGGCAAGG - Intergenic
1141560270 16:84863146-84863168 GCCTCCGGAGGCACATGGCAGGG + Intronic
1141732109 16:85829786-85829808 GCCCCGGGGGCCACCGTGCAGGG + Intergenic
1142264356 16:89056964-89056986 GCCCCCAGCATCACTGGGCATGG - Intergenic
1144727302 17:17508259-17508281 GCCCCCAGGCTCACCGGCCATGG - Intronic
1144854543 17:18260762-18260784 GCCCCCAGGGTCACCGGGCTCGG + Intronic
1148860509 17:50602035-50602057 ACACCCGGAGTCACAGGGTAAGG + Intronic
1149578035 17:57727715-57727737 GTCCCCTGAGTCTCCTGGCACGG - Intergenic
1150143503 17:62749827-62749849 GCCCCCGGTGCCACCGCTCAGGG + Intronic
1151155571 17:72121465-72121487 GCCCGCGGAGTCCTCGGACATGG - Exonic
1151665655 17:75543904-75543926 GGCCCTGGAGTCACAGGCCATGG + Intronic
1152748331 17:82051402-82051424 GCCCCCGGAGGCTCCGCGCGGGG - Intronic
1152897784 17:82923123-82923145 GCACCCAGAGTAACGGGGCAGGG - Intronic
1158427619 18:57353406-57353428 GCCCGCGGAGTCTGCGGACAGGG - Intronic
1160807449 19:998686-998708 GCCCCCGGGGACACCTGGCCAGG + Intergenic
1160862807 19:1244852-1244874 GCTCCCGGCTTCACCGGGCCAGG - Intergenic
1161019442 19:2001205-2001227 AACCCAGGAGGCACCGGGCACGG + Intronic
1162174799 19:8823033-8823055 GGCGCCGGAGTCCCCGGGGAAGG - Intronic
1163251730 19:16129818-16129840 GCCTGGGGATTCACCGGGCACGG - Intronic
1165349149 19:35267211-35267233 CCCCCCGGAGTCCCAGGGGATGG + Exonic
1166688361 19:44809130-44809152 GCCCCCGGACGCACCGGCCCAGG + Exonic
1168246927 19:55117191-55117213 GCCCCGGGAGACGCCGGGCGGGG + Intronic
925609830 2:5693278-5693300 GCCCCCGTAGTCCCCGGACTGGG - Exonic
927519799 2:23691868-23691890 GCCCCCGGGCTCACCGAGAAAGG - Exonic
927853900 2:26516217-26516239 ACCCCCGAGGTCACTGGGCAGGG - Intronic
931711101 2:64989506-64989528 GCCCCGGGGGTCTCCGGGCCTGG - Exonic
937299171 2:120828329-120828351 GTCCTCGGAGTCTCCGGGCAGGG - Intronic
942054842 2:172172722-172172744 GGCCCCGGAGGCCCCCGGCACGG - Intergenic
948368881 2:237475185-237475207 GGCCCCGGGGTCCCCGGGAAGGG + Intergenic
948844912 2:240678452-240678474 ACCCCCGGTGTCCCCGGGCTTGG - Intronic
948848948 2:240696427-240696449 ACCCCCGGTGTCCCCGGGCTTGG + Intronic
1169265968 20:4167622-4167644 GGCCCAGGGGTCACCTGGCAAGG + Intronic
1170629709 20:18056711-18056733 GCCCTCGGCGTCGCCGGGCTCGG + Exonic
1174080083 20:47964689-47964711 GTCCCCGGACTCACACGGCAGGG + Intergenic
1174408900 20:50321195-50321217 TCCGCCTGAGTCACCGGGCTGGG - Intergenic
1178407410 21:32335923-32335945 GCCCAGGGAGTCACAGGACAGGG - Intronic
1178906586 21:36642035-36642057 GCCCCAGGAGTCCACAGGCAGGG - Intergenic
1179596283 21:42445050-42445072 GCCCTTGGAGTCACCCAGCATGG + Intronic
1180150024 21:45942744-45942766 GCACTGGGGGTCACCGGGCATGG - Intergenic
1180218747 21:46344480-46344502 GCCCCCGGAGGAACTGGACAGGG - Intronic
1181671349 22:24426946-24426968 GTTCCAGGAGTCACTGGGCAGGG + Intronic
1183722158 22:39568858-39568880 GCTCCCGGGGGCAACGGGCAGGG - Intergenic
1185105750 22:48868821-48868843 GACCCGAGAGTCACCAGGCACGG - Intergenic
952410673 3:33047242-33047264 GCCCCTGCAGTCACTGTGCAAGG + Intronic
954694018 3:52410667-52410689 GCCGGCGCAGTCACCGCGCAGGG + Exonic
968584661 4:1410619-1410641 GCCCCCGGAGGCCACGGGCTCGG + Intergenic
968593644 4:1471848-1471870 CACCCCCGAGACACCGGGCAGGG - Intergenic
968913026 4:3485360-3485382 GCACCCGGATTCACGGGGCCAGG + Intronic
969053542 4:4388072-4388094 GCCCCTGGGGCCACGGGGCAAGG - Intronic
969337935 4:6522559-6522581 GCCCCCGGAGTCACCGGGCATGG + Intronic
975778940 4:77819550-77819572 GCCCCCCGAGACCCCGGGCCCGG - Intronic
976002414 4:80387897-80387919 GCCCCCGGTGGCACTGGTCATGG + Intronic
985726299 5:1517528-1517550 GGCACAGGAGGCACCGGGCATGG + Intronic
990362389 5:55033757-55033779 GCCCCCTGAGTCACCCTGGAAGG - Exonic
997214068 5:132095819-132095841 ACCCCAGGAGTTACGGGGCAAGG - Intergenic
997412713 5:133702482-133702504 GCCCCCGGAGTCCGGGGGCTTGG + Intergenic
997955370 5:138274658-138274680 GCCCCGGGAGCCGCCGGGCTTGG + Exonic
1002439603 5:179257455-179257477 GCCCCTGGACTCCCCGGGCTGGG - Intronic
1002503698 5:179664530-179664552 GCCCCTGGAGCCACAGAGCAAGG - Intergenic
1006518712 6:34559056-34559078 ACCCCCTGATCCACCGGGCATGG + Intergenic
1006599262 6:35214627-35214649 GCACCCGGACTCCCCGGCCAGGG + Intronic
1013273094 6:108560529-108560551 GCCCGCGCAGTCCCCGGGCTCGG + Intronic
1016817129 6:148313420-148313442 GCCCCAGGAATCACAGGACATGG - Intronic
1019323261 7:425117-425139 GCACGCTGAGTCACGGGGCAGGG - Intergenic
1025206493 7:56996192-56996214 TCCCCCGAAGGCACAGGGCAGGG + Intergenic
1025665445 7:63580735-63580757 TCCCCCGAAGGCACAGGGCAGGG - Intergenic
1026014848 7:66664905-66664927 CCCCCAAGAGTCACCAGGCAGGG - Intronic
1026891245 7:73984040-73984062 CCCCCGAGAGTCACCAGGCAGGG - Intergenic
1036652126 8:10651347-10651369 GGCCCCAGATTCACCTGGCAAGG - Intronic
1037950945 8:23018570-23018592 GCCCTCGGAGCCAGCTGGCAGGG - Intronic
1045035969 8:98176681-98176703 GGCCCCAGGGACACCGGGCACGG + Intergenic
1049377095 8:142294471-142294493 GACCTGGGAGGCACCGGGCATGG + Intronic
1053529804 9:38869403-38869425 GCCCACCGAGTGACAGGGCAGGG + Intergenic
1054202029 9:62093830-62093852 GCCCACCGAGTGACAGGGCAGGG + Intergenic
1054636328 9:67494529-67494551 GCCCACCGAGTGACAGGGCAGGG - Intergenic
1056725088 9:89107306-89107328 GAGCCCAGAGTCACAGGGCAAGG - Intronic
1061754400 9:132802609-132802631 GCCCTCCCAGGCACCGGGCATGG + Intronic
1062577601 9:137215810-137215832 GCACCCAGGGTCTCCGGGCAGGG + Intronic
1197782384 X:130171499-130171521 GCGCACGGGGTCAGCGGGCAGGG - Intergenic
1199188492 X:144942498-144942520 CCCCCCGGAGTCACCATGCTAGG - Intergenic
1199880960 X:151974202-151974224 GGCCCCGGGGTGACCGGCCAGGG - Intronic
1200161814 X:154013474-154013496 GCCCACGGGGTGACCGGCCAGGG - Intronic